Dige

YDW-BY3: PG3P90N4
MDKA Birth: Denmark 1635

Tree Position

R-U106/S21 > Z2265 > Z381/S263 > S264/Z156 > Y18100 > FGC80190

Unique Mutations

The mutations unique to this man are summarized in the table below. Those with a '+' or '*' confidence level are considered by FamilyTreeDNA or FullGenomesCorp to be high quality SNPs/INDELs. For completeness, all other mutations of lesser confidence are included as well. These additional mutations may be useful for distinguishing between very closely related men.

Occasionally, some of the mutations listed here will be thought to be shared with other men in which case they might appear in upstream blocks on the tree. When this happens, the 'Blocks' field will indicate what block they appear in. Such a situation might arise with BigY men if the BED data suggests another man may be positive for a SNP, even though it doesn't appear in his VCF data. It might also happen if Chromo2 testing or Sanger sequencing of other men not on the tree show the SNP to be shared.

POS-REF-ALT (hg19) POS-REF-ALT (hg38) Blocks Names Region McDonald BED combBED STRYDW-BY3
PG3P90N4
24583664-C-G 22437517-C-G P3_t2 A+
19888749-A-T 17776869-A-T P5_Prx A*
20229254-G-GT 18067368-G-GT P5_Dst 15×TA*
26361483-C-T 24215336-C-T P1_Y1 A*
25998918-G-T 23852771-G-T P1_Y1 A*
26030977-C-CA 23884830-C-CA P1_Y1 9×AA*
4009628-G-T 4141587-G-T A*
20727531-A-AT 18565645-A-AT P4_Prx 9×TA*
21006593-C-A 18844707-C-A P4_Dst YA*
19670640-G-C 17558760-G-C P5_Prx A*
19723081-G-A 17611201-G-A P5_Prx A*
22317143-C-T 20155257-C-T DYZ19 A*
25980271-A-T 23834124-A-T P1_Y1 A*
26082356-C-CCA 23936209-C-CCA P1_Y1 A*
26382394-C-T 24236247-C-T P1_Y1 A*
26396490-C-T 24250343-C-T P1_Y1 A*
27982116-T-A 25835969-T-A P1_Y2 A*
28817312-A-G 26671165-A-G A*
15840187-G-A 13728307-G-A FTA16371 YY+
27507577-G-A 25361430-G-A FGC19517 P1_Y2 +
11030856-C-A FT90758 +
3436288-G-A 3568247-G-A FT317223 +
8907673-ATGTGTGTGTGTGTG-A 9039632-ATGTGTGTGTGTGTG-A 18×TG+
3971673-G-A 4103632-G-A FTB65352 +
4373179-T-G 4505138-T-G FTB65434 +
4469831-T-C 4601790-T-C FTA15563 +
4778992-C-T 4910951-C-T FTB65518 +
4979505-TATC-T 5111464-TATC-T +
5035629-T-C 5167588-T-C FTA34172 +
5049215-G-A 5181174-G-A FTB65564 +
7071966-A-G 7203925-A-G FTB59539 YY+
9008616-T-C 9171007-T-C FTA16030 Y+
13310876-G-A 11155200-G-A +
13642687-C-T 11487011-C-T +
13949791-G-A 11829085-G-A FTB59957 Y+
14200089-C-T 12079383-C-T FTB60009 YY+
14722861-T-A 12610929-T-A FTB60108 YY+
15299403-C-CA 13187502-C-CA +
15324593-G-A 13212711-G-A FTB60182 YY+
15334096-A-G 13222214-A-G FTB60186 Y+
15851681-GTT-G 13739801-GTT-G +
16060093-T-A 13948213-T-A FTB60308 Y+
16069751-G-C 13957871-G-C FTB60310 Y+
16217308-C-G 14105428-C-G FTB60323 YY+
16407939-G-A 14296059-G-A YY+
17228857-C-T 15116977-C-T FT23316 Y+
17290288-A-AT 15178408-A-AT +
17372493-C-A 15260613-C-A FT330369 Y+
17801607-G-A 15689727-G-A FTB60609 YY+
17841978-G-C 15730098-G-C FTB60618 YY+
18892593-C-T 16780713-C-T YY+
18922957-T-C 16811077-T-C FTB60788 YY+
18925708-T-A 16813828-T-A FTB60790 YY+
19261981-C-G 17150101-C-G FTB60870 YY+
19333328-G-T 17221448-G-T FTA16771 YY+
19410596-T-C 17298716-T-C FTB60899 YY+
19563234-T-A 17451354-T-A FTB60932 Y+
21084186-C-T 18922300-C-T YY+
21748727-T-C 19586841-T-C YY+
22656734-A-G 20494848-A-G BY20530 YY+
22686587-C-T 20524701-C-T YY+
28724176-T-A 26578029-T-A Y*
10774023-C-CCCATT *
10960259-C-CTCCAT *
3710029-G-C 3841988-G-C *
4030053-TG-T 4162012-TG-T *
22277055-A-G 20115169-A-G DYZ19 *
23558556-T-TCACACA 21396670-T-TCACACA 12×CA*
25096506-A-G 22950359-A-G g1 *
28724175-T-TA 26578028-T-TA *
3930715-CAT-C 4062674-CAT-C **
25858468-T-G 23712321-T-G P1_Y1 **
13484081-A-C 11328405-A-C **
19753404-T-C 17641524-T-C P5_Prx **
19639885-A-T 17528005-A-T P5_Prx **
13484076-G-T 11328400-G-T **
13484095-A-T 11328419-A-T **
13484105-A-C 11328429-A-C **
28078722-GA-G 25932575-GA-G P1_Y2 17×A**
19872461-C-A 17760581-C-A P5_Prx **
26244879-C-A 24098732-C-A P1_Y1 **
26244868-C-A 24098721-C-A P1_Y1 **
25883647-TC-T 23737500-TC-T P1_Y1 **
13464927-A-G 11309251-A-G **
14566159-C-T 12454359-C-T FTA16216 **
14630493-AC-A 12518562-AC-A **
16162068-G-T 14050188-G-T P8_Dst **
17372533-T-C 15260653-T-C **
19765977-C-CTT 17654097-C-CTT P5_Prx 12×T**
19782014-A-C 17670134-A-C P5_Prx **
19872476-G-T 17760596-G-T P5_Prx **
19938649-T-G 17826769-T-G P5_Prx **
21770576-T-C 19608690-T-C **
22289116-T-C 20127230-T-C DYZ19 **
22438682-G-T 20276796-G-T DYZ19 **
24388126-T-C 22241979-T-C **
25579296-G-T 23433149-G-T P1_gr1 **
25579317-G-T 23433170-G-T P1_gr1 **
13722877-A-G 11567201-A-G 10×GAATG***
18454815-C-CT 16342935-C-CT P6_Dst 10×TTCT***
17950825-AATATATATATAT-A 15838945-AATATATATATAT-A 27×AT***
10803923-CTCCATTCCAT-C ***
7199342-CTTT-C,CTT 7331301-CTTT-C,CTT 24×T***
13457761-C-G,T 11302085-C-G,T ***
7452806-C-T 7584765-C-T IR1_L ***
8062893-G-A 8194852-G-A ***
11024705-CTCCAT-C ***
13489620-CCCCCACCACCACCCACCACCCC-C,CCCCACACCCCCACCCCCCATCCA 11333944-CCCCCACCACCACCCACCACCCC-C,CCCCACACCCCCACCCCCCATCCA ***
17724214-G-T 15612334-G-T ***
21350981-G-C 19189095-G-C ***
22194821-A-G 20032935-A-G ***
22983863-T-A 20821977-T-A ***

In the table above, the meaning of the confidence field depends on whether the data comes from an FTDNA kit or an FGC kit. For FTDNA kits, + implies a "PASS" result with just one possible variant, * indicates a "PASS" but with multiple variants, ** indicates "REJECTED" with just a single variant, and *** indicates "REJECTED" with multiple possible variants. 'A*' are heterozygous variants not called by FTDNA, but still pulled from the VCF file. For FGC kits, + indicates over 99% likely genuine (95% for INDELs); * over 95% likely genuine (90% for INDELs); ** about 40% likely genuine; *** about 10% likely genuine. Manual entries read directly from a BAM file will be either + indicating positive, or * indicating that the data show a mixture of possible variants.

For the FTDNA kits, the BED data is encoded in the background color of the cells. Those cells with a white background have coverage, those with a grey background indicate no coverage in the BED file, and those with a pink background indicate the mutation is on the edge of a coverage region. These pink regions often indicate that the individual may be positive for a SNP even if there is no corresponding entry in the vcf file.

The combBED column indicates whether or not the mutation is a SNP and falls in the combBED region defined in Defining a New Rate Constant for Y-Chromosome SNPs based on Full Sequencing Data by Dmitry Adamov, Vladimir Guryanov, Sergey Karzhavin, Vladimir Tagankin, Vadim Urasin.

The McDonald BED column indicates whether or not the mutation is a SNP and falls in the BED region used by Dr. Iain McDonald in the age analysis he does for R-U106 men.