Tree Position

R-P312/S116 > Z40481 > ZZ11 > U152/S28 > L2/S139 > Z258 > Z367/S255 > L20/S144 > Z46420 > S3856 > S1505 > BY3579 > BY3555

Unique Mutations

The mutations unique to this man are summarized in the table below. Those with a '+' or '*' confidence level are considered by FamilyTreeDNA or FullGenomesCorp to be high quality SNPs/INDELs. For completeness, all other mutations of lesser confidence are included as well. These additional mutations may be useful for distinguishing between very closely related men.

Occasionally, some of the mutations listed here will be thought to be shared with other men in which case they might appear in upstream blocks on the tree. When this happens, the 'Blocks' field will indicate what block they appear in. Such a situation might arise with BigY men if the BED data suggests another man may be positive for a SNP, even though it doesn't appear in his VCF data. It might also happen if Chromo2 testing or Sanger sequencing of other men not on the tree show the SNP to be shared.

POS-REF-ALT (hg19) POS-REF-ALT (hg38) Blocks Names Region McDonald BED combBED STRKane-BY3
809016
BigY3
809016
14559665-G-GA 12447866-G-GA 10×A*A*
18728721-G-T 16616841-G-T YY16×AA*
13489955-C-T 11334279-C-T A*
18348856-C-T 16236976-C-T P6_Prx A*
20363954-C-A 18202068-C-A P5_Dst A*
22307733-C-A 20145847-C-A DYZ19 A*
25565569-C-A 23419422-C-A P1_gr1 A*
25897881-C-T 23751734-C-T P1_Y1 A*
26501537-C-T 24355390-C-T P1_Y1 A*
28064496-G-A 25918349-G-A P1_Y2 A*
58975095-CCATGT-C 56828948-CCATGT-C +
13963824-ATTTTTTTTTTTTTTTTTTTTT-A 11843118-ATTTTTTTTTTTTTTTTTTTTT-A 49×T+
17802166-T-TAAA 15690286-T-TAAA 30×A+
6017605-AC-A 6149564-AC-A +***
13708998-A-G 11553322-A-G +
9429669-A-G 9592060-A-G Y+
9429672-A-T 9592063-A-T Y+
9429673-A-T 9592064-A-T Y+
9429676-A-G 9592067-A-G Y+
9310445-T-C 9472836-T-C Y+**
14963374-A-G 12851449-A-G Y+
16480225-TAA-T 14368345-TAA-T +
26463097-C-A 24316950-C-A P1_Y1 36×T+
15799164-C-T 13687284-C-T YY*
18434859-CAG-C 16322979-CAG-C P6_Dst *
28536045-TAC-T 26389898-TAC-T *
17105356-TA-T 14993476-TA-T 9×A*
13478998-G-A 11323322-G-A *
13470244-GT-G 11314568-GT-G *
16535034-G-A 14423154-G-A CTS5884 YY*
17913815-GT-G 15801935-GT-G 11×T*
18870080-C-CTG 16758200-C-CTG 12×TG*
7803353-GA-G 7935312-GA-G 10×A*
13250436-C-T 11094760-C-T *
4645850-G-GA 4777809-G-GA 9×A*
3432966-TTATA-T 3564925-TTATA-T 10×TA*
13484591-T-G 11328915-T-G ****
4597740-T-TTG 4729699-T-TTG 12×TG*
5344380-C-G 5476339-C-G *
5366776-G-A 5498735-G-A *
5393970-GTC-G 5525929-GTC-G *
5497400-A-G 5629359-A-G *
9070124-C-CAATAAT 9232515-C-CAATAAT 10×AAT****
13888691-T-TG 11767985-T-TG *
21084333-ATG-A 18922447-ATG-A ***
23142317-C-G 20980431-C-G CTS11503 Z2869 YY*
5814488-G-GAA 5946447-G-GAA 18×A*
4267560-TTC-T 4399519-TTC-T *
4380146-C-G 4512105-C-G *
5502210-G-C 5634169-G-C *
5679799-G-A 5811758-G-A *
5680402-G-A 5812361-G-A *
8582982-CAG-C 8714941-CAG-C *
13445955-A-C 11290279-A-C *
15799158-TCC-T 13687278-TCC-T *
17585545-CATT-C 15473665-CATT-C 5×ATT*
20824599-C-CTA 18662713-C-CTA P4_Gap *
22751951-TGA-T 20590065-TGA-T *
24355593-AAC-A 22209446-AAC-A *
24447175-AAG-A 22301028-AAG-A *
59026537-A-G 56880390-A-G *
28671978-AT-A 26525831-AT-A 9×T*
13253198-A-G 11097522-A-G *
18615932-C-CTT 16504052-C-CTT 27×T*
13470573-A-T 11314897-A-T F18175 *
21721165-C-CA 19559279-C-CA 10×A*
15558431-GAGATAGATAGATAGAT-G,GAGAT 13446551-GAGATAGATAGATAGAT-G,GAGAT 17×AGAT*
13258166-G-GT 11102490-G-GT 10×T*
21180074-CA-C 19018188-CA-C 10×A*
20712287-TACACAC-T 18550401-TACACAC-T P4_Prx 16×AC*
25931652-T-TA 23785505-T-TA P1_Y1 8×A*
13199164-CA-C 11043488-CA-C 18×A*
7258755-C-CA 7390714-C-CA 25×A*
17959052-A-AT 15847172-A-AT 10×T*
5270716-G-T 5402675-G-T *
16938194-C-A 14826314-C-A YY*
7189585-G-GA 7321544-G-GA 9×A*
7569510-G-GAT 7701469-G-GAT *
22179363-CAAA-C 20017477-CAAA-C 13×A*
13488845-C-CCG 11333169-C-CCG *
4511683-G-GA 4643642-G-GA 10×A*
21905354-G-GAA 19743468-G-GAA 16×A*
14184727-CAAA-C 12064021-CAAA-C 14×A*
7436097-T-TA 7568056-T-TA 10×A*
16938209-C-A 14826329-C-A YY*
17597154-CTTT-C,CTT 15485274-CTTT-C,CTT 20×T*
3051387-AT-A 3183346-AT-A 10×T*
18695923-ATT-A 16584043-ATT-A 12×T*
13470073-G-C 11314397-G-C *
18806044-CTT-C,CT 16694164-CTT-C,CT 19×T*
5869994-G-T 6001953-G-T *
13488854-T-G 11333178-T-G *
16938218-C-A 14826338-C-A YY19×T*
15750502-CT-C,CTT 13638622-CT-C,CTT 18×T*
2686435-C-CAA 2818394-C-CAA 13×A*
13869049-GGACTC-G 11748343-GGACTC-G *
17633686-C-CAA 15521806-C-CAA 17×A*
22023684-GTT-G,GTTT 19861798-GTT-G,GTTT 17×T*
18037000-GA-G 15925120-GA-G 10×A*
10949974-A-C *
15904149-CA-C,CAA 13792269-CA-C,CAA 20×A*
10671793-A-G *
18534169-C-T 16422289-C-T P6_Dst *
3093161-CT-C 3225120-CT-C 10×T*
16506766-C-CAA 14394886-C-CAA 19×A*
18593205-C-CT 16481325-C-CT 10×T*
5221065-C-A 5353024-C-A *
15106356-TA-T 12994444-TA-T 10×A*
21415991-G-GA 19254105-G-GA 10×A*
13296184-G-GTT 11140508-G-GTT 14×T*
5170787-CT-C 5302746-CT-C 10×T*
3398980-CT-C 3530939-CT-C 10×T*
5961842-C-CA 6093801-C-CA 10×A*
10942711-C-G *
5084713-A-AT 5216672-A-AT 10×T*
18195154-A-ATT 16083274-A-ATT 29×T*
14403323-A-AT 12282620-A-AT 10×T*
17361057-T-A 15249177-T-A YY*
13565595-GA-G 11409919-GA-G 10×A*
14593459-TTTTC-T 12481659-TTTTC-T *
21044090-TAA-T 18882204-TAA-T 14×A*
14109316-C-CTT 11988610-C-CTT 14×T*
6874882-C-CA 7006841-C-CA 9×A*
13472217-C-G 11316541-C-G *
19291569-A-AT 17179689-A-AT 10×T*
23127414-CAAAA-C,CAAAAA 20965528-CAAAA-C,CAAAAA 24×A*
7617852-A-AT 7749811-A-AT 10×T*
17419464-TG-T 15307584-TG-T *
13045947-C-CAA 20×A*
21132681-G-GTT 18970795-G-GTT 18×T*
10671792-C-T *
13464452-T-C 11308776-T-C *
13489389-G-C 11333713-G-C *
5022667-GGTGT-G 5154626-GGTGT-G 12×GT*
13690157-A-C 11534481-A-C *
17755384-T-TAAA 15643504-T-TAAA 17×A*
18695889-G-GT 16584009-G-GT 8×T*
19266279-G-GT 17154399-G-GT 9×T*
23459373-GAA-G 21297487-GAA-G 12×A*
13489802-C-A 11334126-C-A *
13246182-G-C 11090506-G-C *
5207368-CATTT-C 5339327-CATTT-C 10×ATTT****
17189355-GAAA-G 15077475-GAAA-G 19×A*
22528159-T-C 20366273-T-C Y****
13463161-T-G 11307485-T-G *
10942721-C-A *
6068017-C-CT 6199976-C-CT 10×T*
10889373-A-C *
13992191-CAA-C,CA 11871485-CAA-C,CA 22×A*
17597150-C-A 15485270-C-A YY*
15947951-CTT-C,CT 13836071-CTT-C,CT 19×T*
10942687-C-T *
21992963-TAAAA-T,TAAA 19831077-TAAAA-T,TAAA 23×A*
14814998-C-CT 12703069-C-CT 10×T*
28816449-G-T 26670302-G-T *
4560677-G-GA 4692636-G-GA 9×A*
17731014-C-CAAA 15619134-C-CAAA 35×A*
5221071-C-A 5353030-C-A *
4061992-G-GT 4193951-G-GT 9×T*
17697015-C-G 15585135-C-G YY*
13253196-A-T 11097520-A-T *
28229322-T-TAA 26083175-T-TAA P1_b4 17×A*
13253195-C-T 11097519-C-T *
16336897-G-GTTT 14225017-G-GTTT 23×T*
22755400-G-GAA 20593514-G-GAA 14×A*
10784495-C-A *
13924970-CAAA-C 11804264-CAAA-C 20×A*
17046741-A-T 14934861-A-T YY*
22802868-ATTTT-A 20640982-ATTTT-A 32×T*
13617121-C-A 11461445-C-A ****
28813241-G-A 26667094-G-A *
8428974-C-A 8560933-C-A YY*
8428979-C-A 8560938-C-A YY*
3912233-C-CT 4044192-C-CT 14×T*
5471873-A-G 5603832-A-G *
7303517-C-A 7435476-C-A Y*
28816448-G-T 26670301-G-T *
8616329-CT-C 8748288-CT-C 9×T*
7162285-G-A 7294244-G-A YY*
13489386-G-T 11333710-G-T *
7364399-T-A 7496358-T-A YY*
15468505-C-T 13356625-C-T YY*
19547236-G-A 17435356-G-A YY*
13323494-CAAA-C,CAA 11167818-CAAA-C,CAA 24×A*
28620201-C-CAA 26474054-C-CAA 11×A*
28766460-G-T 26620313-G-T Y*
7364393-T-A 7496352-T-A YY*
9953233-C-CTT 10115624-C-CTT 11×T*
19030072-TAA-T,TA 16918192-TAA-T,TA 13×A*
27998485-CAAAAA-C 25852338-CAAAAA-C P1_Y2 30×A*
17798286-A-C 15686406-A-C Y*
13476571-A-G 11320895-A-G *
5815594-C-CAA 5947553-C-CAA 22×A*
10678194-T-C *
28791773-G-T 26645626-G-T *
28813044-T-C 26666897-T-C *
6489371-C-A 6621330-C-A 25×A*
28813240-C-G 26667093-C-G *
10889371-T-TCCTCC *
5502176-A-C 5634135-A-C *
3519250-AT-A 3651209-AT-A 10×T*
22995376-GTTTTTT-G 20833490-GTTTTTT-G 21×T*
4282570-TACAC-T 4414529-TACAC-T 17×AC*
7364401-C-A 7496360-C-A YY*
7383851-CA-C,CAA 7515810-CA-C,CAA 24×A*
4375417-CT-C,CTT 4507376-CT-C,CTT 22×T*
3039839-CTT-C,CT 3171798-CTT-C,CT 22×T*
3522968-T-TA,TAA 3654927-T-TA,TAA 24×A*
3606672-GT-G,GTT 3738631-GT-G,GTT 19×T*
13476570-C-A 11320894-C-A *
3930083-CTT-C 4062042-CTT-C 12×T*
17114685-TACAC-T,TAC 15002805-TACAC-T,TAC 19×AC*
22618584-AATAT-A 20456698-AATAT-A 9×AT*
5999363-CAAA-C 6131322-CAAA-C 20×A****
15683628-CAA-C,CA 13571748-CAA-C,CA 24×A*
6946221-G-GA 7078180-G-GA 10×A*
21966549-GTTT-G 19804663-GTTT-G 16×T*
4498179-ATTT-A,ATT 4630138-ATTT-A,ATT 23×T*
4794855-CTTTTT-C 4926814-CTTTTT-C 21×T*
5492439-CT-C,CTT 5624398-CT-C,CTT 18×T*
17192961-G-A 15081081-G-A YY*
19180464-T-TA 17068584-T-TA 9×A*
4908175-CAA-C,CAAA 5040134-CAA-C,CAAA 17×A*
14458558-CA-C,CAA 12337831-CA-C,CAA 21×A*
10632709-A-C,C *
10632714-CA-C,C *
10632717-G-C,C *
10632738-ATTCCATCCATATCATTCCATTCCC-A,A *
10632765-CAACTG-C,C *
10632777-ACTCCTGTCCTCTTCT-A,A *
10632799-TC-T,T *
10632802-ATTCCATTCCACTCCAT-A,A *
13888692-T-TG 11767986-T-TG 9×TG*
56835940-A-ACTCCACTCAATTCCACTCCACTCAATTCCACTCCACTCAATTCCACTCCACTCTG *
56884424-T-TA *
10672973-G-GTT *
10672974-GAA-G *
13472563-C-CT 11316887-C-CT *
13489689-G-GCA 11334013-G-GCA *
10661296-T-TCCACTC *
13478929-CTG-C 11323253-CTG-C *
13478935-A-ACG 11323259-A-ACG *
13479001-C-A 11323325-C-A *
13479009-G-T 11323333-G-T *
13479013-C-A 11323337-C-A *
56830260-CTCCACTCCATTCCTCTCCATTCCAT-C *
56884425-T-TAA 8×TA*
3514522-CTT-C,CT 3646481-CTT-C,CT 16×T*
16897643-CAAAA-C,CAAA 14785763-CAAAA-C,CAAA 23×A*
13884529-CAAA-C,CAAAA 11763823-CAAA-C,CAAAA 17×A*
14097945-ATT-A,ATTT 11977239-ATT-A,ATTT 23×T*
13417221-C-CA 11261545-C-CA 9×A*
22507811-A-G 20345925-A-G DYZ19 *
19721811-T-G 17609931-T-G P5_Prx *
5320593-T-A 5452552-T-A *
10986812-CA-C *
3481528-A-C 3613487-A-C *
5203779-TA-T,TAA 5335738-TA-T,TAA 24×A*
23120561-ATT-A 20958675-ATT-A 11×T*
56834591-T-G *
17196753-A-AAGGT,AAGGT 15084873-A-AAGGT,AAGGT *
13476551-G-A 11320875-G-A *
8563745-CTTT-C,CTTTT 8695704-CTTT-C,CTTTT 21×T*
10692317-CA-C *
10692320-TACCC-T *
10692328-A-C *
10692336-CCAGTCCACTCCACTCTGCCCAATTA-C *
13283105-CT-C 11127429-CT-C *
56834790-C-CATTCCACTCCACTCCATTCA,CATTCCATTCCACTCCACTCA *
16282398-CA-C,CAA 14170518-CA-C,CAA 24×A*
5776638-C-CA 5908597-C-CA 9×A*
10671808-ATTGC-A *
11294441-CATCCCATCCCATTCT- *
56832053-CACT- *
56832067-CCACTCCA- *
10671795-TCCA-T *
56826622-C- *
56830265-CTCCATTCCTCTCCATTCCAT- *
11294473-T- *
56832058-CACTCCA- *
18019832-CTTT-C,CTT 15907952-CTTT-C,CTT 22×T*
10673921-TCCATTCCATTCCATTCCATTGCACC-T *
13489686-CAT-C 11334010-CAT-C *
15876360-CAAA-C,CAAAA 13764480-CAAA-C,CAAAA 21×A*
15084869-TAGAA- 14×AGAA*
9885635-TC-T 10048026-TC-T 9×C*
12371725-C-T ****
15865946-CTTTTTTTTTTTTTTTTTTTT-C,CT 13754066-CTTTTTTTTTTTTTTTTTTTT-C,CT 37×T****
28561186-T-C 26415039-T-C ****
10678189-T-TCAC *
10678201-C-CAA *
10678202-C-CTCCGTTCA *
10692326-CCA-C *
11021497-CACTCCTCCCT-C *
28816870-T-G,G 26670723-T-G,G *
10987851-TTCCATTCCATTCCACTCCAC-T,T *
2772684-C-T 2904643-C-T Y*
2888358-A-AT 3020317-A-AT 9×T*
2894570-T-A 3026529-T-A YY*
3181878-G-T 3313837-G-T *
3482590-CA-C,CAA 3614549-CA-C,CAA 22×A*
3491332-G-A 3623291-G-A *
3692374-G-A 3824333-G-A *
3763283-C-CA 3895242-C-CA *
3867718-T-C 3999677-T-C *
4373604-TTC-T 4505563-TTC-T *
4373609-T-C 4505568-T-C *
4378604-T-G 4510563-T-G *
4378614-G-A 4510573-G-A *
4380019-T-C 4511978-T-C *
4404871-C-A 4536830-C-A *
4555391-T-C 4687350-T-C *
4787643-T-C 4919602-T-C *
4837522-C-T 4969481-C-T *
4848869-A-G 4980828-A-G *
5158999-A-AT 5290958-A-AT 9×T*
5221066-T-G 5353025-T-G *
5439292-G-T 5571251-G-T *
5502254-C-CAA 5634213-C-CAA 16×A*
5502268-AAAG-A 5634227-AAAG-A *
5562638-G-T 5694597-G-T *
5574077-CT-C,CTT 5706036-CT-C,CTT 19×T*
5575398-T-C 5707357-T-C *
5588358-A-G 5720317-A-G *
5739769-AT-A 5871728-AT-A 10×T*
5855442-C-T 5987401-C-T *
6130448-A-G 6262407-A-G *
7141147-T- *
7162289-T-TGTCCCACAGGCTAG 7294248-T-TGTCCCACAGGCTAG *
7179734-GTTT-G,GTTTT 7311693-GTTT-G,GTTTT 25×T*
7750025-CTCTCTCTCTCTCTCTCTCTCTCTT- *
7986096-CA-C 8118055-CA-C *
8057169-G-GTGTATA 8189128-G-GTGTATA 12×TA*
8261193-A-AAT 8393152-A-AAT *
8816438-C-T 8948397-C-T Y*
8888375-CTT-C,CTTT 9020334-CTT-C,CTTT 25×T*
8970353-G-T 9132744-G-T *
9173053-T-C 9335444-T-C Y*
9543768-AC- *
9679143-T- *
10057781-G-T 10220172-G-T *
10669543-C-CAT *
10669544-CGT-C *
10671800-TCG-T *
10671804-CCTCAT-C *
10692382-CAATCTA-C *
10753353-T-G *
13251022-T-G 11095346-T-G *
13272409-A-G 11116733-A-G *
11292561-C- *
13450372-T-TCCA 11294696-T-TCCA *
11296194-TTCCAG- *
13470070-C-A 11314394-C-A *
13472565-C-CAGTAAGCAGAGCCTAGACAAGAGTTACATCACCTGGG 11316889-C-CAGTAAGCAGAGCCTAGACAAGAGTTACATCACCTGGG *
11322582-A- *
11322583-G- *
13478456-C-G 11322780-C-G *
13484586-G-A 11328910-G-A *
13489884-C-CT 11334208-C-CT *
13559078-C-A 11403402-C-A *
13607577-C-T 11451901-C-T *
13621855-A-G 11466179-A-G *
13636055-C-T 11480379-C-T *
14233163-ATCCT-A 12112457-ATCCT-A 4×TCCT*
12199946-T- *
14421322-CA-C 12300597-CA-C 9×A*
14730571-GC-G 12618639-GC-G *
14753891-A-T 12641960-A-T YY*
12807338-C-CT 43×T*
15116660-T-C 13004747-T-C YY*
15164608-A-AATAT,AATATATATAT 13052694-A-AATAT,AATATATATAT 12×AT*
15271548-C-CAA 13159637-C-CAA 9×A*
15359080-C-CT 13247200-C-CT 10×T*
15507783-G-GTTTT 13395903-G-GTTTT 25×T*
15557017-G-C 13445137-G-C YY*
15791505-G-GT 13679625-G-GT *
15799167-CCTTT-C 13687287-CCTTT-C *
16244792-G-GGT 14132912-G-GGT 16×GT*
16328493-ATT-A,AT 14216613-ATT-A,AT 10×T*
16535088-TGAGG-T 14423208-TGAGG-T *
14423209-GAGGGTGA- *
16535093-G-T 14423213-G-T YY*
16535095-GA-G 14423215-GA-G *
16598984-CAAA-C,CAA 14487104-CAAA-C,CAA 25×A*
16665338-A-G 14553458-A-G Y*
16868801-T-C 14756921-T-C YY*
16938183-G-T 14826303-G-T YY*
17046745-A-T 14934865-A-T YY*
17096097-C-T 14984217-C-T Y*
17192963-A-G 15081083-A-G BY112937 YY*
17203302-G-A 15091422-G-A YY*
17283489-A-T 15171609-A-T YY*
17361058-CA-C,CAAA 15249178-CA-C,CAAA 25×A*
17697009-GT-G 15585129-GT-G *
17697012-C-G 15585132-C-G YY*
17697016-T-TA 15585136-T-TA *
17781438-A-G 15669558-A-G YY*
18135987-T-C 16024107-T-C Y*
18263952-T-C 16152072-T-C *
16314603-A- P6_Gap *
18434981-T-G 16323101-T-G P6_Dst *
18874618-C-T 16762738-C-T Y*
19032538-C-CAA 16920658-C-CAA 14×A*
19438082-G-A 17326202-G-A Y*
19547239-G-T 17435359-G-T YY*
19753914-C-T 17642034-C-T P5_Prx *
21091202-G-A 18929316-G-A YY*
21397970-A-T 19236084-A-T YY*
21639038-TA-T,TAA 19477152-TA-T,TAA 25×A*
22270102-T-C 20108216-T-C DYZ19 *
22722338-C-CTTT 20560452-C-CTTT 24×T*
23441477-G-T 21279591-G-T Y*
23464784-GT-G 21302898-GT-G *
23505532-C-A 21343646-C-A YY*
23505540-G-T 21343654-G-T YY*
23574259-T-C 21412373-T-C YY*
23650038-G-GTT 21488152-G-GTT 15×T*
25356465-G-C 23210318-G-C P2_r2 *
26101362-CA-C,CAA 23955215-CA-C,CAA P1_Y1 17×A*
26354704-C-T 24208557-C-T P1_Y1 *
26477996-A-G 24331849-A-G P1_Y1 *
27757439-T-C 25611292-T-C P1_Y2 *
27823840-A-G 25677693-A-G P1_Y2 *
28550159-C-A 26404012-C-A *
28575956-G-A 26429809-G-A *
28575960-G-A 26429813-G-A *
28575963-G-A 26429816-G-A *
28642809-G-GAC,GACAC 26496662-G-GAC,GACAC 22×AC*
28816456-G-A 26670309-G-A *
56830111-T-C *
56832336-A-ACTCCT,ATTCCATTCCACTCCT *
56858316-AAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGGAAAGAAAAGAAAGAAAAGAAAGAAAGAAAAGAAAGAAAGAAAGAAAGAAAAGAAAGAAAGAAGGAAAGAAGGAAAGAAGGAAAGAAGGAAAGAAGGAAGG-A 15×AAAG*
56858327-AG-A *
56858329-AAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGGAAAGAAAAGAAAGAAAAGAAAGAAAGAAAAGAAAGAAAGAAAGAAAGAAAAGAAAGAAAGAAGGAAAGAAGGAAAGAAGGAAAGAAGGAAAGAAGGAAGGAAAGAAAGAAAG-A *
56858370-AAGAAAGGAAAGAAAAGAAAGAAAAGAAAGAAAGAAAAGAAAGAAAGAAAGAAAGAAAAGAAAGAAAGAAGGAAAGAAGGAAAGAAGGAAAGAAGGAAAGAAGGAAGGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGTT-A *
56873108-T-G *
56873110-A-G *
13141054-A-G 10630540-A-G **
4848574-G-GT 4980533-G-GT 29×T**
13745546-T-A 11589870-T-A **
24306930-C-A 22160783-C-A P3_t1 **
10652918-G-T ***
13476532-C-A 11320856-C-A ***
13476550-C-A 11320874-C-A ***
16050950-CTT-C,CTTTCTT 13939070-CTT-C,CTTTCTT ***
7832216-CTT-C,CTTTC 7964175-CTT-C,CTTTC ***
5784590-GA-G,GAA 5916549-GA-G,GAA 13×A***
13745549-C-G 11589873-C-G ***
13745554-A-G 11589878-A-G ***
13963824-ATTTTTTTTTTTTTTTTTTTTTTTT-A,ATTTT 11843118-ATTTTTTTTTTTTTTTTTTTTTTTT-A,ATTTT 49×T***

In the table above, the meaning of the confidence field depends on whether the data comes from an FTDNA kit or an FGC kit. For FTDNA kits, + implies a "PASS" result with just one possible variant, * indicates a "PASS" but with multiple variants, ** indicates "REJECTED" with just a single variant, and *** indicates "REJECTED" with multiple possible variants. 'A*' are heterozygous variants not called by FTDNA, but still pulled from the VCF file. For FGC kits, + indicates over 99% likely genuine (95% for INDELs); * over 95% likely genuine (90% for INDELs); ** about 40% likely genuine; *** about 10% likely genuine. Manual entries read directly from a BAM file will be either + indicating positive, or * indicating that the data show a mixture of possible variants.

For the FTDNA kits, the BED data is encoded in the background color of the cells. Those cells with a white background have coverage, those with a grey background indicate no coverage in the BED file, and those with a pink background indicate the mutation is on the edge of a coverage region. These pink regions often indicate that the individual may be positive for a SNP even if there is no corresponding entry in the vcf file.

The combBED column indicates whether or not the mutation is a SNP and falls in the combBED region defined in Defining a New Rate Constant for Y-Chromosome SNPs based on Full Sequencing Data by Dmitry Adamov, Vladimir Guryanov, Sergey Karzhavin, Vladimir Tagankin, Vadim Urasin.

The McDonald BED column indicates whether or not the mutation is a SNP and falls in the BED region used by Dr. Iain McDonald in the age analysis he does for R-U106 men.