Tree Position

R-P312/S116 > Z290 > L21/S145 > S552 > DF13 > ZZ10 > Z253 > Z2534 > ZZ5 > Z2187 > Z2201 > DF73

Unique Mutations

The mutations unique to this man are summarized in the table below. Those with a '+' or '*' confidence level are considered by FamilyTreeDNA or FullGenomesCorp to be high quality SNPs/INDELs. For completeness, all other mutations of lesser confidence are included as well. These additional mutations may be useful for distinguishing between very closely related men.

Occasionally, some of the mutations listed here will be thought to be shared with other men in which case they might appear in upstream blocks on the tree. When this happens, the 'Blocks' field will indicate what block they appear in. Such a situation might arise with BigY men if the BED data suggests another man may be positive for a SNP, even though it doesn't appear in his VCF data. It might also happen if Chromo2 testing or Sanger sequencing of other men not on the tree show the SNP to be shared.

POS-REF-ALT (hg19) POS-REF-ALT (hg38) Blocks Names Region McDonald BED combBED STRKane-Dante
9883b7c8-7e1e-4
58837277-G-A 56753594-C-T +
15100576-C-A 12988664-C-A Y+
18537394-T-C 16425514-T-C P6_Dst +
17726852-G-A 15614972-G-A Y+
17264272-G-A 15152392-G-A YY+
16266345-G-A 14154465-G-A Y+
56722464-G-GCCACGGAATGGAATGGACAC +
4819268-T-C 4951227-T-C +
15544749-C-T 13432869-C-T YY+
14255727-C-T 12135021-C-T Y+
18625675-C-T 16513795-C-T Y+
14218561-G-T 12097855-G-T YY+
17442340-G-A 15330460-G-A Y5124Y5123 YY+
10848731-TCACTC-T FGC29444 +
24206157-T-C 22060010-T-C P3_b1 +
4067645-C-T 4199604-C-T FTB18574 +
10761085-C-A +
10761084-G-T +
18585194-T-C 16473314-T-C YY+
19099150-T-C 16987270-T-C Y+
11032982-A-C +
21559403-G-T 19397517-G-T YY+
58882276-C-T 56708595-G-A +
22646727-C-T 20484841-C-T YY+
7434148-G-A 7566107-G-A Y+
58840730-G-C 56750141-C-G +
58868568-A-T 56722303-T-A +
21656394-C-T 19494508-C-T YY+
6430439-T-TTA 6562398-T-TTA 19×TA+
21401432-T-C 19239546-T-C YY+
19283524-T-C 17171644-T-C YY+
58840728-C-T 56750143-G-A +
21298424-C-T 19136538-C-T YY+
21298423-G-A 19136537-G-A YY+
21223714-T-C 19061828-T-C YY+
19551163-T-C 17439283-T-C Y+
58868604-C-T 56722267-G-A +
56708512-AGGAATGGAATAGAAT-A +
19318683-G-C 17206803-G-C YY+
10801794-A-T +
10995422-C-A +
58882292-G-C 56708579-C-G +
5036583-CATATATAT-C 5168542-CATATATAT-C 27×AT+
3838601-CT-C 3970560-CT-C 31×T+
56708746-ATGG-A +
58882362-G-T 56708509-C-A +
58866884-C-G 56723987-G-C +
6931534-A-AAATCGGAATGAGTCAGGATGGAGTAGGT 7063493-A-AAATCGGAATGAGTCAGGATGGAGTAGGT +
58857361-C-G 56733510-G-C +
58856537-A-T 56734334-T-A +
58824569-CATTCCAATAG-C 56766285-ATGGAATCTAT-A +
3295987-T-C 3427946-T-C +
58868369-T-G 56722502-A-C +
28818222-G-C 26672075-G-C +
13838485-A-AGGAAT 11717779-A-AGGAAT 9×GGAAT+
9780155-G-C 9942546-G-C Y+
4819329-C-A 4951288-C-A +
3822962-G-GAT 3954921-G-GAT 26×AT+
5962109-C-CATAT 6094068-C-CATAT 20×AT+
58882324-T-A 56708547-A-T +
56708750-AAT-A +
3502210-A-T 3634169-A-T +
10632686-TGGCTGGAGTGCAGTGGCACAATATCAGCATGACATTTCATTTCTCCATTTCATTCCATCCATATCATTCCATTCCCCTCAACTGCACTCCACTCCTGTCCTCTTCTCTCCACTCCATTCCATTCCACTCCATATCCATTCCATTCCTTTTCTTCGACAGGATCTCGCTCTGTCACTCA-T +
10761076-TCCACTC-T +
58882106-G-T 56708765-C-A +
58882170-G-T 56708701-C-A +
11014432-A-AATTCC +
21346975-T-TTATATA 19185089-T-TTATATA 29×TA+
17143891-A-AT 15032011-A-AT 35×T+
10782439-C-T +
10764552-C-CTCCAT +
8538222-G-A 8670181-G-A YY+
3758791-G-T 3890750-G-T +
7952868-T-G 8084827-T-G YY+
6614542-G-T 6746501-G-T +
5477070-CA-C 5609029-CA-C +
5476956-C-G 5608915-C-G +
5374367-A-G 5506326-A-G +
5308799-T-TAGAG 5440758-T-TAGAG 19×AG+
5134510-G-T 5266469-G-T +
4103475-A-G 4235434-A-G +
24471950-G-A 22325803-G-A Y+
3930563-G-GTA 4062522-G-GTA 21×TA+
25531045-T-G 23384898-T-G P1_gr1 +
28818235-TCAAATCACA-T 26672088-TCAAATCACA-T +
58882307-G-C 56708564-C-G +
22491469-T-C 20329583-T-C DYZ19 +
56708587-T-C +
28662017-G-A 26515870-G-A Y+
28789796-T-C 26643649-T-C FGC81294 +
28818230-TG-T 26672083-TG-T +
28775439-G-A 26629292-G-A +
27388637-G-C 25242490-G-C P1_g3 +
9983925-G-T 10146316-G-T Y*
10025342-T-C 10187733-T-C Y*
10668330-T-TTCCACTCC *
13443889-G-A 11288213-G-A *
28812892-G-GTATAC 26666745-G-GTATAC *
13443895-A-G 11288219-A-G *
13464715-G-T 11309039-G-T *
13465492-CTT-C 11309816-CTT-C *
13465497-A-AGG 11309821-A-AGG *
13469903-C-T 11314227-C-T *
13689478-A-G 11533802-A-G BY35210 *
13476763-T-A 11321087-T-A *
13476765-C-A 11321089-C-A *
13488845-C-CAT 11333169-C-CAT *
13489886-C-T 11334210-C-T *
13489900-A-C 11334224-A-C *
13489910-C-T 11334234-C-T *
13489926-C-T 11334250-C-T *
13502883-C-T 11347207-C-T *
28588479-T-C 26442332-T-C *
13489854-C-A 11334178-C-A *
56832170-T-C *
9983924-T-G 10146315-T-G Y*
13512559-G-A 11356883-G-A *
13484191-C-G 11328515-C-G *
13484203-A-T 11328527-A-T *
13484209-G-C 11328533-G-C *
13488673-G-A 11332997-G-A *
13512567-T-A 11356891-T-A *
13488820-C-G 11333144-C-G *
13488969-G-T 11333293-G-T *
13489407-G-C 11333731-G-C *
13489862-C-T 11334186-C-T *
13489904-A-T 11334228-A-T *
13499463-G-T 11343787-G-T *
13512540-T-TCTAC 11356864-T-TCTAC *
8314317-TA-T 8446276-TA-T *
13512543-C-CTATATT 11356867-C-CTATATT *
13636943-G-C 11481267-G-C *
21757200-T-C *
21757201-C-T *
21757208-G-C *
21757212-T-A *
28805415-G-T 26659268-G-T BY227407 *
13512551-A-G 11356875-A-G *
13504705-G-C 11349029-G-C *
28814048-A-AATGGC 26667901-A-AATGGC *
56830278-C-CCTTCCATTACACTCCACTCA *
28812897-C-A 26666750-C-A 4×AGTGG*
28812894-A-G 26666747-A-G *
9992719-T-A 10155110-T-A Y*
56828732-TCC-T *
13473742-C-T 11318066-C-T *
11017798-G-A *
11017807-A-G BY49644 *
11017825-C-G *
13339071-CCCTCACATTGTATTCCAGAACACTCCTTCTGTGGTCTGAATGTTTGTT-C 11183395-CCCTCACATTGTATTCCAGAACACTCCTTCTGTGGTCTGAATGTTTGTT-C *
13351819-G-C 11196143-G-C *
13449513-A-ATT 11293837-A-ATT *
13449514-C-CCAT,T 11293838-C-CCAT,T *
13452707-TCTCC-T 11297031-TCTCC-T *
13452712-ACTACTC-A 11297036-ACTACTC-A *
13473730-C-T 11318054-C-T *
13485477-A-C 11329801-A-C *
10678033-A-G *
56678030-G-A,A *
56833472-C-CAGTA *
56833476-AACC-A *
9931375-T-C 10093766-T-C Y*
9960519-G-A 10122910-G-A Y*
9960520-C-A 10122911-C-A Y*
13504702-C-T 11349026-C-T *
9965172-C-T 10127563-C-T Y*
13502712-T-C 11347036-T-C *
9965173-T-G 10127564-T-G Y*
10780676-ATT-A *
10678022-CTTTCCAT-C *
56829190-A-ACTCCATTCCATTCCCTTCTTTTCCATTCCATTCCT *
13261497-G-A 11105821-G-A *
56871651-TGAG-T *
13482137-G-A 11326461-G-A *
9992725-G-A 10155116-G-A Y*
10038665-A-T 10201056-A-T *
10038666-T-C 10201057-T-C *
10038674-G-T 10201065-G-T *
10038676-T-C 10201067-T-C *
10038686-C-T 10201077-C-T *
10038687-T-G 10201078-T-G *
10677167-C-CACT,CCCACT *
13464628-C-T 11308952-C-T *
10678018-ATTG-A *
13476733-C-A 11321057-C-A *
13482204-T-G 11326528-T-G *
13484219-A-T 11328543-A-T *
13488668-G-A 11332992-G-A *
13489673-G-C 11333997-G-C *
13497585-T-C 11341909-T-C *
13497593-C-G 11341917-C-G *
22446666-CTG-C 20284780-CTG-C DYZ19 *
28796605-T-C 26650458-T-C *
56834011-TG-T *
10025344-C-G 10187735-C-G Y*
13482226-G-T 11326550-G-T *
13479083-C-A 11323407-C-A *
13480389-T-G 11324713-T-G *
13489277-ATG-A 11333601-ATG-A *
13483072-G-T 11327396-G-T *
13519185-C-A 11363509-C-A *
13483084-T-A 11327408-T-A *
13483091-C-T 11327415-C-T *
13485031-A-G 11329355-A-G *
13487879-G-T 11332203-G-T *
13487918-C-T 11332242-C-T *
13487920-G-A 11332244-G-A *
13488812-A-G 11333136-A-G *
13488818-A-T 11333142-A-T *
13489689-G-GCA 11334013-G-GCA *
13482801-T-G 11327125-T-G *
13684870-T-C 11529194-T-C BY88374 *
13720503-C-T 11564827-C-T *
22489898-C-A 20328012-C-A DYZ19 *
23793825-T-G 21631939-T-G Y*
23793833-G-A 21631947-G-A Y*
23793835-T-G 21631949-T-G Y*
23793841-T-C 21631955-T-C Y*
23793842-G-A 21631956-G-A Y*
28795194-TCAAATGGAATG-T 26649047-TCAAATGGAATG-T *
56678312-T-A *
56829176-T-TTCCAC *
13482811-CA-C 11327135-CA-C *
13482270-A-T 11326594-A-T *
56830986-C-CTA *
13478610-C-G 11322934-C-G *
13469892-A-C 11314216-A-C *
13469899-A-T 11314223-A-T *
13469905-G-C 11314229-G-C *
13472294-T-TCCGGTGGCTCGCCTCATGTGAGCCTCC 11316618-T-TCCGGTGGCTCGCCTCATGTGAGCCTCC *
13472744-G-T 11317068-G-T *
13472752-C-A 11317076-C-A *
13472755-A-G 11317079-A-G *
13473860-TG-T 11318184-TG-T *
13476560-G-T 11320884-G-T *
13476563-G-T 11320887-G-T *
13476573-G-A 11320897-G-A *
13478616-G-C 11322940-G-C *
13482231-G-C 11326555-G-C *
13519363-G-A 11363687-G-A *
13478619-T-C 11322943-T-C *
13479515-A-T 11323839-A-T *
13479518-G-A 11323842-G-A *
13479524-T-C 11323848-T-C *
13479544-C-T 11323868-C-T *
13479553-G-T 11323877-G-T *
13479562-T-C 11323886-T-C *
13479582-G-A 11323906-G-A *
13479593-T-A 11323917-T-A *
13479638-G-T 11323962-G-T *
56830380-C-CT *
56830987-C-CTCT *
13479253-C-A 11323577-C-A *
13473725-GC-G 11318049-GC-G *
13466448-C-G 11310772-C-G *
13469998-G-C 11314322-G-C *
13470480-C-T 11314804-C-T *
13471882-GTGTCA-G 11316206-GTGTCA-G *
13471892-G-GATTCT 11316216-G-GATTCT *
13472265-GAA-G 11316589-GAA-G *
13472271-C-CCT 11316595-C-CCT *
13472295-G-A 11316619-G-A *
13472688-A-T 11317012-A-T *
13472739-T-A 11317063-T-A *
13473764-G-C 11318088-G-C *
13464478-A-C 11308802-A-C *
13473765-G-T 11318089-G-T *
13477321-C-T 11321645-C-T *
13478665-CAA-C 11322989-CAA-C *
13478669-C-CCA 11322993-C-CCA *
13478673-G-A 11322997-G-A *
13479037-G-T 11323361-G-T *
13479038-G-C 11323362-G-C *
13479071-C-G 11323395-C-G *
13479073-CT-C 11323397-CT-C *
13502696-T-C 11347020-T-C *
13479251-T-A 11323575-T-A *
13464493-C-G 11308817-C-G *
13512570-C-T 11356894-C-T *
56860115-G-A,GA *
11021427-C-CATT *
9933593-A-AT 10095984-A-AT *
9933594-C-G 10095985-C-G Y*
9984346-C-T 10146737-C-T BY82473 Y*
10013131-CACGGAAGGAAGA-C 10175522-CACGGAAGGAAGA-C *
10013155-G-GC 10175546-G-GC *
10013158-TGC-T 10175549-TGC-T *
13516739-A-G 11361063-A-G *
10668345-T-TCC *
10671359-CTATTG-C *
10826876-C-CTCCAT *
10885132-C-CATTTT *
11021429-C-CATTCTGT *
13462224-G-A 11306548-G-A *
11021437-A-G *
13263826-G-T 11108150-G-T *
13516738-C-T 11361062-C-T *
13514707-G-T 11359031-G-T *
13263828-G-C 11108152-G-C *
13514697-G-A 11359021-G-A *
13372806-C-G 11217130-C-G *
13372811-C-T 11217135-C-T *
13448930-G-GTA 11293254-G-GTA *
13451489-T-C,C 11295813-T-C,C *
13451490-G-A,A 11295814-G-A,A *
10061590-C-T 10223981-C-T *
13473439-A-G 11317763-A-G *
10688065-C-CCT *
13358716-T-A 11203040-T-A *
13488298-C-T 11332622-C-T *
13488576-TCC-T 11332900-TCC-T *
13489662-T-G 11333986-T-G *
13489665-G-T 11333989-G-T *
13473682-G-C 11318006-G-C *
13516696-C-T 11361020-C-T *
13531417-C-T 11375741-C-T *
28815341-A-ATGGAATGGAG 26669194-A-ATGGAATGGAG *
13358701-A-G 11203025-A-G *
13358706-G-A 11203030-G-A *
13448927-T-TCCA 11293251-T-TCCA *
13488067-T-TCC 11332391-T-TCC *
13557689-C-T 11402013-C-T *
28585761-G-T 26439614-G-T *
56826146-TCGATTCCATTCC-T *
56826511-T-C *
56835940-A-ACTCCACTCAATTCCACTCCACTCAATTCCACTCCACTCTG *
13476339-AATAAAGTCC-A 11320663-AATAAAGTCC-A *
13489280-C-CAA 11333604-C-CAA *
13708106-G-GTT 11552430-G-GTT *
13708107-GAA-G 11552431-GAA-G *
22269604-GTATA-G 20107718-GTATA-G DYZ19 *
22269609-G-GCCAC 20107723-G-GCCAC DYZ19 *
13473708-C-A 11318032-C-A *
13488064-CGG-C 11332388-CGG-C *
13262767-CCT-C 11107091-CCT-C *
10807614-C-A *
10006139-G-A 10168530-G-A Y*
10006155-T-G 10168546-T-G Y*
10624483-T-TA *
10624485-G-T *
13482700-C-G 11327024-C-G *
10784088-C-G *
10784091-T-A *
10784093-C-G *
10784096-T-C *
13482690-A-C 11327014-A-C *
13473717-G-C 11318041-G-C *
13487935-G-A 11332259-G-A *
10831892-A-T *
10986456-TTC-T *
13345115-G-T 11189439-G-T *
13345128-A-G 11189452-A-G *
13373099-G-A 11217423-G-A *
13447488-CCATGG-C 11291812-CCATGG-C *
13449708-CCA-C 11294032-CCA-C *
13463765-G-GA 11308089-G-GA *
13470261-C-G 11314585-C-G *
13470595-C-G 11314919-C-G *
13478434-G-T 11322758-G-T *
56832175-T-C *
13448141-T-TAA 11292465-T-TAA *
13482793-C-G 11327117-C-G *
9067938-CT-C 9230329-CT-C *
13478563-C-A 11322887-C-A *
13479020-C-T 11323344-C-T *
13444761-G-T 11289085-G-T *
10022422-G-C 10184813-G-C Y*
13442777-G-A 11287101-G-A *
10791028-C-G *
10980594-CTAA-C *
13465163-A-C 11309487-A-C *
13471796-G-C 11316120-G-C *
13709404-T-A 11553728-T-A *
9067944-A-G 9230335-A-G Y*
13478499-T-G 11322823-T-G *
9067949-G-A 9230340-G-A Y*
9067950-T-C 9230341-T-C Y*
13442753-T-C 11287077-T-C *
13427928-C-T 11272252-C-T *
9067951-C-T 9230342-C-T Y*
13397980-T-A 11242304-T-A *
9067959-T-G 9230350-T-G Y*
9067963-A-C 9230354-A-C Y*
9067967-T-C 9230358-T-C Y*
9067969-A-G 9230360-A-G Y*
9067977-C-T 9230368-C-T Y*
13478550-C-A 11322874-C-A *
13478484-T-C 11322808-T-C *
13449758-C-CATTT 11294082-C-CATTT *
13718175-CAA-C 11562499-CAA-C *
13476117-C-T 11320441-C-T *
13476124-G-T 11320448-G-T *
13481077-C-T 11325401-C-T *
13468962-G-T 11313286-G-T *
9946136-G-T 10108527-G-T Y*
23793919-C-T 21632033-C-T Y*
23793927-A-T 21632041-A-T Y*
23793929-C-T 21632043-C-T Y*
23793937-A-G 21632051-A-G FT144426 Y*
10986812-CA-C *
13718180-GGAATAGAA-G 11562504-GGAATAGAA-G *
13478447-C-T 11322771-C-T *
28549924-G-A 26403777-G-A *
13489706-C-T 11334030-C-T *
13468592-A-G 11312916-A-G *
13464412-C-A 11308736-C-A FT45566 *
10055585-A-T 10217976-A-T *
13417495-A-G 11261819-A-G *
13465160-G-C 11309484-G-C *
13461366-C-G 11305690-C-G *
13469182-G-T 11313506-G-T *
13470599-G-T 11314923-G-T *
13475771-A-T 11320095-A-T *
10006131-G-A 10168522-G-A Y*
10006130-T-C 10168521-T-C Y*
10688068-TCC-T *
13463972-C-G 11308296-C-G *
13443763-T-C 11288087-T-C *
13444785-C-G 11289109-C-G *
13444808-T-C 11289132-T-C *
13461695-G-C 11306019-G-C *
13498814-T-C 11343138-T-C *
13461711-G-A 11306035-G-A *
13462696-C-G 11307020-C-G *
13498426-C-T 11342750-C-T *
13463969-G-C 11308293-G-C *
13495140-C-T 11339464-C-T *
13463974-G-T 11308298-G-T *
10006042-A-G 10168433-A-G Y*
13464069-C-G 11308393-C-G *
13468993-CCTTGTAAGCAGAGCCTAGAGAAGAGTTACGTCA-C 11313317-CCTTGTAAGCAGAGCCTAGAGAAGAGTTACGTCA-C *
13469484-C-G 11313808-C-G *
13476528-C-T 11320852-C-T *
13476578-C-A 11320902-C-A *
13479068-G-C 11323392-G-C *
13484955-G-A,C 11329279-G-A,C *
13489192-GAGCTGGAGGCCTTCGAAGAGGCCGCCT-G 11333516-GAGCTGGAGGCCTTCGAAGAGGCCGCCT-G *
13489223-TGGAA-T 11333547-TGGAA-T *
13684840-T-TTAACC 11529164-T-TTAACC *
13684841-G-C 11529165-G-C *
11014883-C-A *
10006038-G-T 10168429-G-T Y*
28784225-GGA-G 26638078-GGA-G *
13479476-T-A 11323800-T-A *
10820363-CCG-C *
10988675-A-T *
13469863-A-T 11314187-A-T *
13501498-G-A 11345822-G-A *
13476723-C-T 11321047-C-T *
13477334-T-G 11321658-T-G *
13479434-G-T 11323758-G-T *
13501089-G-A 11345413-G-A *
13479451-G-T 11323775-G-T *
13479456-G-T 11323780-G-T *
13482772-G-C 11327096-G-C *
13466503-C-A 11310827-C-A *
13489549-C-G 11333873-C-G *
13500434-C-T 11344758-C-T *
23793558-A-G 21631672-A-G Y*
23793578-A-G 21631692-A-G Y*
28549880-GCCAGGGCCAGAGCCAGGGCCAGGGCCTGGGCAGGA-G 26403733-GCCAGGGCCAGAGCCAGGGCCAGGGCCTGGGCAGGA-G *
28804118-G-A 26657971-G-A *
28804188-C-T 26658041-C-T BY202325 *
28814645-C-T 26668498-C-T *
28814740-G-A 26668593-G-A *
13462689-G-T 11307013-G-T *
16757043-AT-A,ATTT 14645163-AT-A,ATTT 27×T*
13694178-A-G 11538502-A-G *
28784229-A-AGT 26638082-A-AGT *
10006127-T-C 10168518-T-C Y*
13491848-A-C 11336172-A-C *
28805933-G-C 26659786-G-C *
9943878-G-A 10106269-G-A Y*
9943883-AC-A 10106274-AC-A *
9943885-ATTACATTAAACTCAGTGCTGCCATGTCAGTAAAGACCTGGCAGAATTCATCACCTGCTGACTAAAGAACCCCTGTAC-A 10106276-ATTACATTAAACTCAGTGCTGCCATGTCAGTAAAGACCTGGCAGAATTCATCACCTGCTGACTAAAGAACCCCTGTAC-A *
10661674-CATT-C *
10661678-CCACTCCA-C *
11022172-A-G *
13334400-G-C 11178724-G-C *
13448871-CTTCATTCCATTCCACTCCACTCCAG-C 11293195-CTTCATTCCATTCCACTCCACTCCAG-C *
13495134-A-T 11339458-A-T *
13491845-T-G 11336169-T-G *
13711747-TGGAAC-T 11556071-TGGAAC-T *
13466486-G-T 11310810-G-T *
13480769-C-T 11325093-C-T *
13484223-C-A 11328547-C-A *
13484225-C-A 11328549-C-A *
13484240-CAA-C 11328564-CAA-C *
13484247-A-ATT 11328571-A-ATT *
13484263-C-A 11328587-C-A *
13485028-A-G 11329352-A-G *
13723175-G-A 11567499-G-A *
56831928-C-CGTTCG *
13489299-G-C 11333623-G-C *
17913371-A-G 15801491-A-G YY*
13541190-T-C 11385514-T-C *
28785999-T-A 26639852-T-A *
13688926-G-T 11533250-G-T *
28813884-A-C 26667737-A-C *
56728039-C-A *
6605511-T-TTA,TTATA 6737470-T-TTA,TTATA 14×TA*
13463337-G-A 11307661-G-A *
13469997-G-T 11314321-G-T *
13470033-T-C 11314357-T-C *
13470519-C-T 11314843-C-T *
13476500-A-T 11320824-A-T *
13489802-C-T 11334126-C-T *
13489873-C-A 11334197-C-A *
13688925-G-T 11533249-G-T *
56825964-G-GCATTCTATTCGATTT *
13480142-A-C 11324466-A-C *
13516478-C-G 11360802-C-G *
13488175-G-A 11332499-G-A *
28786038-A-T 26639891-A-T *
10831333-C-T *
10831338-C-A *
13195254-C-CATTTT 11039578-C-CATTTT *
13410509-A-G 11254833-A-G *
13435787-ACTGTCATCGT-A 11280111-ACTGTCATCGT-A *
13461375-C-A 11305699-C-A *
13465134-C-T 11309458-C-T *
13465140-G-T 11309464-G-T *
13469875-C-G 11314199-C-G *
13469821-G-T 11314145-G-T *
13469858-G-A 11314182-G-A *
9941595-C-T 10103986-C-T Y*
13466428-C-A 11310752-C-A *
13511717-C-T 11356041-C-T *
13569835-TA-T 11414159-TA-T 11×A*
13712513-G-A 11556837-G-A *
13490421-C-T 11334745-C-T *
13492886-T-C 11337210-T-C *
13709589-G-A 11553913-G-A *
13711855-G-T 11556179-G-T *
13489875-C-T 11334199-C-T *
6403320-A-C 6535279-A-C *
13433575-T-C 11277899-T-C *
13372863-C-G 11217187-C-G *
13509024-C-A 11353348-C-A *
13712541-T-A 11556865-T-A *
13719766-C-T 11564090-C-T *
6531755-A-AT 6663714-A-AT 10×T*
13488042-C-T 11332366-C-T *
13488052-T-A 11332376-T-A *
13488062-G-A 11332386-G-A *
13488088-C-T 11332412-C-T *
13488098-G-A 11332422-G-A *
13533930-G-T 11378254-G-T *
13538867-T-G 11383191-T-G *
13372881-A-G 11217205-A-G *
13372336-G-C 11216660-G-C *
28793855-A-T 26647708-A-T *
13428108-AT-A 11272432-AT-A *
10022407-T-C 10184798-T-C Y*
10082017-T-A 10244408-T-A *
10082019-C-A 10244410-C-A *
10082033-A-C 10244424-A-C *
10082046-G-A 10244437-G-A *
13540005-G-A 11384329-G-A *
13395933-A-C 11240257-A-C *
13406756-A-G 11251080-A-G *
13420140-T-C 11264464-T-C *
13427941-G-T 11272265-G-T *
13552601-C-A 11396925-C-A *
13369989-G-A 11214313-G-A *
13591385-T-C 11435709-T-C *
13598103-T-C 11442427-T-C *
13598167-G-A 11442491-G-A *
28785463-G-T 26639316-G-T *
13476736-G-A 11321060-G-A BY85959 *
9940484-G-A 10102875-G-A Y*
9940505-C-T 10102896-C-T Y*
9940532-TC-T 10102923-TC-T *
9967676-A-T 10130067-A-T Y*
13347531-T-C 11191855-T-C *
13369920-T-C 11214244-T-C *
13689740-C-G 11534064-C-G *
28794151-T-A 26648004-T-A *
9946013-C-G 10108404-C-G Y*
13257603-G-A 11101927-G-A *
13478535-A-C 11322859-A-C *
10025444-G-C 10187835-G-C Y*
23505495-C-CA,CAA 21343609-C-CA,CAA 23×A*
13730449-G-T 11574773-G-T *
13512529-C-CTA 11356853-C-CTA *
10667693-A-G *
13348221-G-A 11192545-G-A *
13348249-G-A 11192573-G-A *
6403004-TA-T 6534963-TA-T *
9980190-A-C 10142581-A-C Y*
13361946-A-T 11206270-A-T *
28579995-G-A 26433848-G-A *
13439458-G-A 11283782-G-A *
13501398-A-G 11345722-A-G *
56886701-A-C *
9943866-G-C 10106257-G-C Y*
9983938-C-A 10146329-C-A Y*
10055448-A-G 10217839-A-G *
13338704-G-A 11183028-G-A *
13339725-A-G 11184049-A-G *
13351715-T-C 11196039-T-C *
13366220-T-C 11210544-T-C *
13369411-G-GT 11213735-G-GT *
56685818-A-G *
22510583-C-A 20348697-C-A DYZ19 *
28795141-G-C 26648994-G-C *
13476549-C-T 11320873-C-T *
28795149-C-G 26649002-C-G *
13475841-T-A 11320165-T-A *
13464557-G-C 11308881-G-C *
9940715-T-C 10103106-T-C Y*
13351976-G-T 11196300-G-T *
13444949-C-T 11289273-C-T *
13688956-T-C 11533280-T-C *
13693594-G-A 11537918-G-A *
13489949-C-A 11334273-C-A *
13469830-G-A 11314154-G-A *
3449187-A-G 3581146-A-G *
13607590-C-T 11451914-C-T FT354037 *
13377381-C-T 11221705-C-T *
13438462-A-C 11282786-A-C *
13689283-A-G 11533607-A-G *
13476694-T-G 11321018-T-G *
13484174-A-C 11328498-A-C *
13484175-G-T 11328499-G-T *
13436931-A-G 11281255-A-G *
13476582-C-T 11320906-C-T *
13468977-G-A 11313301-G-A *
9942758-G-C 10105149-G-C Y*
13420927-G-C 11265251-G-C *
10022398-T-C 10184789-T-C Y*
10930375-A-T *
9943700-T-A 10106091-T-A FT263042 Y*
13705116-G-T 11549440-G-T *
13533921-G-A 11378245-G-A *
13537105-G-A 11381429-G-A *
13537107-T-G 11381431-T-G *
13540703-A-G 11385027-A-G *
28803139-A-C 26656992-A-C *
13562309-G-A 11406633-G-A *
13586770-C-T 11431094-C-T *
13693522-T-G 11537846-T-G *
28803043-G-A 26656896-G-A *
13694136-A-G 11538460-A-G *
13707315-C-A 11551639-C-A *
13527168-A-C 11371492-A-C *
13711737-T-A 11556061-T-A *
28585356-G-A 26439209-G-A *
28788970-T-A 26642823-T-A *
28786058-G-A 26639911-G-A *
28809769-G-T 26663622-G-T *
28811854-T-A 26665707-T-A *
28814081-G-A 26667934-G-A *
28785193-T-C 26639046-T-C *
13482758-T-A 11327082-T-A *
28587948-G-A 26441801-G-A *
28583410-C-G 26437263-C-G *
13528502-G-A 11372826-G-A *
13527167-C-A 11371491-C-A *
13495556-T-G 11339880-T-G *
13443846-T-C 11288170-T-C *
28803332-A-C 26657185-A-C *
28809777-G-T 26663630-G-T *
28813677-T-G 26667530-T-G *
28816638-C-G 26670491-C-G *
56856464-A-G *
9961067-A-T 10123458-A-T Y*
9967671-T-C 10130062-T-C Y*
13420161-A-G 11264485-A-G *
13435680-G-A 11280004-G-A *
13443842-T-C 11288166-T-C *
13465019-G-A 11309343-G-A *
13518365-C-T 11362689-C-T *
13465551-G-T 11309875-G-T *
13465562-A-G 11309886-A-G *
13483406-G-C 11327730-G-C *
13483428-A-G 11327752-A-G *
13491032-C-G 11335356-C-G *
13491034-A-C 11335358-A-C *
13491053-C-T 11335377-C-T *
13491095-T-C 11335419-T-C *
13491228-T-C 11335552-T-C *
13507428-T-G 11351752-T-G *
13516291-C-A 11360615-C-A *
10784045-ACTCCG-A *
28583382-G-C 26437235-G-C *
7451294-C-CT 7583253-C-CT IR1_L 29×T*
13696961-A-G 11541285-A-G *
13555833-G-A 11400157-G-A *
13538393-A-G 11382717-A-G *
13538400-A-C 11382724-A-C *
13546947-G-A 11391271-G-A *
13551380-C-T 11395704-C-T *
13550782-A-G 11395106-A-G *
13544283-G-C 11388607-G-C *
13558817-A-T 11403141-A-T *
13541561-T-G 11385885-T-G *
13562720-T-C 11407044-T-C *
13480363-C-A 11324687-C-A *
13500089-G-A 11344413-G-A *
13464506-T-A 11308830-T-A *
13476567-C-T 11320891-C-T *
13464536-T-C 11308860-T-C *
13691906-G-A 11536230-G-A BY54349 *
13469422-C-A 11313746-C-A *
13464553-G-A 11308877-G-A *
13541556-A-C 11385880-A-C *
13540717-A-G 11385041-A-G *
4571254-CAAAA-C 4703213-CAAAA-C 29×A*
13489898-C-T 11334222-C-T *
13335801-T-C 11180125-T-C FGC81666 *
13514243-T-C 11358567-T-C *
13556901-A-T 11401225-A-T *
13827247-T-A 11706541-T-A *
13689724-A-AGGAAT,AGGAATGGAATGGAAT 11534048-A-AGGAAT,AGGAATGGAATGGAAT *
13709938-C-T 11554262-C-T *
13543165-G-A 11387489-G-A *
13706265-A-G 11550589-A-G *
13557751-G-A 11402075-G-A *
28816647-CG-C 26670500-CG-C *
13695002-G-C 11539326-G-C *
13692705-G-A 11537029-G-A *
13692681-A-T 11537005-A-T *
56859284-G-A *
13611330-C-CT 11455654-C-CT *
56880582-T-TA,TAA 9×A*
13563786-G-T 11408110-G-T *
13482671-T-C 11326995-T-C *
13519152-T-C 11363476-T-C *
13540588-C-T 11384912-C-T *
13556051-G-T 11400375-G-T *
9943981-A-T 10106372-A-T Y*
10807585-A-C *
10927906-T-C *
13562032-G-A 11406356-G-A *
13558127-T-A 11402451-T-A *
13558124-C-T 11402448-C-T *
13482667-T-G 11326991-T-G *
13482670-G-A 11326994-G-A *
13499102-T-TAA 11343426-T-TAA *
10092991-A-T 10255382-A-T *
13469836-C-T 11314160-C-T *
9958184-A-G 10120575-A-G Y*
3403265-A-C 3535224-A-C *
4636108-T-A,A 4768067-T-A,A *
4909300-TC-T 5041259-TC-T *
4909304-C-G 5041263-C-G *
6402075-G-GTATATCTTATATTCAC 6534034-G-GTATATCTTATATTCAC *
6402077-G-GGTGTCGTAAAATACTGACGTA 6534036-G-GGTGTCGTAAAATACTGACGTA *
9055886-T-TG *
9055889-G-T *
9055890-T-A *
9933575-G-A 10095966-G-A Y*
9967017-A-T 10129408-A-T Y*
56826141-TCCA-T *
9974155-G-A 10136546-G-A Y*
9986861-G-T 10149252-G-T Y*
9986865-G-A 10149256-G-A Y*
9986869-G-T 10149260-G-T Y*
9986880-G-T 10149271-G-T Y*
9986881-GTCGCC-G 10149272-GTCGCC-G *
10033866-G-A 10196257-G-A BY83205 Y*
10033870-G-T 10196261-G-T Y*
10033906-C-T 10196297-C-T Y*
10055491-T-C 10217882-T-C *
10055492-G-A 10217883-G-A *
56830803-T-TCCGC *
22249773-T-C 20087887-T-C DYZ19 *
10055573-G-A 10217964-G-A *
13469912-T-C 11314236-T-C *
13723165-A-C 11567489-A-C *
13827282-T-A 11706576-T-A *
56830384-A-T *
9108178-TAG-T *
9932076-CAGTTT-C 10094467-CAGTTT-C *
9932082-T-C 10094473-T-C Y*
9965064-A-AG 10127455-A-AG *
9965066-A-AGT 10127457-A-AGT *
13253194-GCA-G 11097518-GCA-G *
13448136-GCTC-G 11292460-GCTC-G *
13470108-CCA-C 11314432-CCA-C *
13699106-AGAATG-A 11543430-AGAATG-A 4×GAATG*
13476534-T-C 11320858-T-C *
13479646-C-T 11323970-C-T *
13480878-T-G 11325202-T-G *
13480907-C-A 11325231-C-A *
13480909-C-T 11325233-C-T *
13488193-G-T 11332517-G-T *
13488718-G-GGA 11333042-G-GGA *
13489293-G-A 11333617-G-A *
13489829-G-A 11334153-G-A *
13538862-C-CA 11383186-C-CA *
13694705-T-A 11539029-T-A *
10055572-T-C 10217963-T-C *
10093305-C-T 10255696-C-T *
13712036-C-A 11556360-C-A *
13374071-G-GCC 11218395-G-GCC *
10831324-T-A *
10880380-T-TACATA *
10893497-C-G *
10951290-C-G *
10951291-T-G *
10951295-C-T *
10986809-CA-C *
11001538-CCATTCCATTA-C *
13341459-G-A 11185783-G-A *
13362142-C-A 11206466-C-A *
13374072-AAT-A 11218396-AAT-A *
13519369-G-T 11363693-G-T *
13443296-C-A 11287620-C-A *
13445731-G-A,A 11290055-G-A,A *
13445780-C-T 11290104-C-T *
13461126-CA-C 11305450-CA-C *
13462114-T-TGA 11306438-T-TGA *
13463283-C-G 11307607-C-G *
13463730-A-T 11308054-A-T *
13463778-G-T 11308102-G-T *
13469381-G-T 11313705-G-T *
28804209-A-C 26658062-A-C *
13469835-C-T 11314159-C-T *
10831321-C-T *
10807609-G-C *
10093312-C-G 10255703-C-G *
10626395-T-A *
10093314-T-C 10255705-T-C *
10626296-A-G *
10626311-G-A *
10626314-C-G *
10626317-T-C *
10626321-T-C *
10626326-C-G *
10626335-G-C *
9067978-T-C 9230369-T-C Y*
10626375-G-T *
10626392-G-A *
10626410-T-G *
10807592-T-TACAG *
10626477-G-C *
13523196-T-C 11367520-T-C *
10626484-G-A *
10667709-T-C FT428708 *
10678989-C-T *
10693377-AG-A,ACTG *
10745361-A-T *
10800349-C-A *
10807576-A-T *
10807587-C-T *
10807590-C-CA *
13723163-G-C 11567487-G-C *
13576763-G-A 11421087-G-A *
13417521-G-C 11261845-G-C *
13489719-T-A 11334043-T-A *
10766371-CCACTCCATCCAATCT-C *
13517323-C-A 11361647-C-A *
13489893-A-T 11334217-A-T *
13480171-T-A 11324495-T-A *
13533834-G-T 11378158-G-T *
13533827-A-T 11378151-A-T *
13470565-C-A 11314889-C-A *
13374066-G-A 11218390-G-A *
13484173-G-C 11328497-G-C *
5094042-CT-C 5226001-CT-C 27×T*
22508536-G-C 20346650-G-C DYZ19 *
13463355-C-T 11307679-C-T *
22011557-CA-C,CAA 19849671-CA-C,CAA 21×A*
13484177-T-C 11328501-T-C *
13440296-C-T 11284620-C-T *
16352456-CAAAAAA-C 14240576-CAAAAAA-C 21×A*
13469914-C-A 11314238-C-A *
9933407-T-C 10095798-T-C Y*
9946115-A-G 10108506-A-G Y*
10043962-A-C 10206353-A-C *
10043963-AC-A 10206354-AC-A *
10043966-A-T 10206357-A-T *
10082082-T-A 10244473-T-A *
13469473-G-A 11313797-G-A *
13576750-G-A 11421074-G-A *
13473712-T-A 11318036-T-A *
13417529-G-A 11261853-G-A *
13491086-G-T 11335410-G-T *
13563578-A-T 11407902-A-T *
28586411-G-C 26440264-G-C *
9944114-C-T 10106505-C-T Y*
13484773-G-T 11329097-G-T *
56734551-G-T *
9931330-T-C 10093721-T-C Y*
9931346-T-C 10093737-T-C Y*
13377091-C-A 11221415-C-A *
13377096-T-C 11221420-T-C *
13419576-C-T 11263900-C-T *
13579357-C-T 11423681-C-T *
56699975-C-G *
10692434-T-TTACAA *
10926332-CTTCCA-C *
13332198-G-T 11176522-G-T *
28578931-C-T 26432784-C-T *
22505765-T-A 20343879-T-A DYZ19 *
13470606-C-T 11314930-C-T *
13480175-G-T 11324499-G-T *
22950193-CT-C,CTT 20788307-CT-C,CTT 21×T*
13531269-C-T 11375593-C-T *
13531304-A-G 11375628-A-G *
10939278-A-G *
13473788-A-C 11318112-A-C *
13576760-T-C 11421084-T-C *
13261705-A-G 11106029-A-G *
10013089-G-A 10175480-G-A Y*
10013095-T-A 10175486-T-A Y*
10013110-G-A 10175501-G-A Y*
10013127-G-C 10175518-G-C Y*
10013146-A-T 10175537-A-T Y*
10013151-T-A 10175542-T-A Y*
10013153-G-C 10175544-G-C Y*
3571940-C-T 3703899-C-T *
10866501-C-T *
13257440-C-T 11101764-C-T *
13335598-G-A 11179922-G-A *
10013066-C-G 10175457-C-G Y*
13335612-T-C 11179936-T-C *
13348257-G-T 11192581-G-T *
13348259-C-T 11192583-C-T *
13352007-A-G 11196331-A-G *
13379420-G-A 11223744-G-A *
13410358-C-T 11254682-C-T *
13410359-A-G 11254683-A-G *
13427793-T-G 11272117-T-G *
13427800-G-A 11272124-G-A *
13457132-C-A 11301456-C-A *
13465561-T-A 11309885-T-A *
10013068-G-C 10175459-G-C Y*
9992694-G-A 10155085-G-A Y*
13827263-T-A 11706557-T-A *
23793873-G-A 21631987-G-A Y*
24488644-C-A 22342497-C-A *
24488651-C-G 22342504-C-G *
28550684-C-T 26404537-C-T *
28550710-G-C 26404563-G-C FT59704 *
28578949-G-T 26432802-G-T *
56864486-G-T *
13470616-C-G 11314940-C-G *
4618773-C-A 4750732-C-A *
23793848-T-C 21631962-T-C Y*
23793856-C-T 21631970-C-T Y*
23793862-G-A 21631976-G-A Y*
13448048-C-T 11292372-C-T *
8314394-C-A 8446353-C-A YY*
14870214-G-A 12758284-G-A YY*
13469842-A-G 11314166-A-G *
13338900-C-T 11183224-C-T *
13478466-C-T 11322790-C-T *
10025443-G-T 10187834-G-T Y*
10025447-C-T 10187838-C-T FT376463 Y*
13688970-G-A 11533294-G-A *
13693498-G-A 11537822-G-A *
13693511-C-T 11537835-C-T *
56736157-T-C *
13462068-C-G 11306392-C-G *
10626363-T-C *
28813885-A-C 26667738-A-C *
9067981-ATG-A 9230372-ATG-A *
13483863-T-A 11328187-T-A *
13482633-C-T 11326957-C-T *
13482638-G-T 11326962-G-T *
13482652-T-C 11326976-T-C BY86100 *
13482659-T-C 11326983-T-C *
13482660-G-C 11326984-G-C *
13482899-G-A 11327223-G-A BY86108 *
13482915-C-A 11327239-C-A *
13482921-C-T 11327245-C-T *
13483860-A-C,G 11328184-A-C,G *
13483861-C-G 11328185-C-G *
13483893-G-C 11328217-G-C *
13482599-A-G 11326923-A-G *
13483908-A-T 11328232-A-T *
13484168-G-T 11328492-G-T *
13485221-A-T 11329545-A-T *
13485235-T-G 11329559-T-G *
13485450-T-A 11329774-T-A *
13485503-TA-T 11329827-TA-T *
13486000-G-C 11330324-G-C *
13486008-T-C 11330332-T-C *
13486382-G-A 11330706-G-A *
13487488-C-T 11331812-C-T *
13487774-TCG-T 11332098-TCG-T *
13482610-T-C 11326934-T-C *
13482592-T-G 11326916-T-G *
13487859-G-GCT 11332183-G-GCT *
13478784-G-A 11323108-G-A *
13476350-ATCAGCTGGGTGATCAGTGTAG-A 11320674-ATCAGCTGGGTGATCAGTGTAG-A *
13476375-TATGTCACAAAGCCCTGTAAGCAGAGCCTAGACAACTG-T 11320699-TATGTCACAAAGCCCTGTAAGCAGAGCCTAGACAACTG-T *
13476531-T-C 11320855-T-C *
13476590-T-A 11320914-T-A *
13476722-A-T 11321046-A-T *
13477182-G-C 11321506-G-C *
13478400-A-G 11322724-A-G *
13478428-GCCT-G 11322752-GCCT-G *
13478442-C-A 11322766-C-A *
13478478-C-CCGGA 11322802-C-CCGGA *
13478571-T-TGGCTATGGACGGGCGTGTCTTCCCCTCGCCACCTCCACC 11322895-T-TGGCTATGGACGGGCGTGTCTTCCCCTCGCCACCTCCACC *
13478788-G-A 11323112-G-A *
13482337-A-G 11326661-A-G *
13478790-G-T 11323114-G-T *
13479062-C-T 11323386-C-T *
13479648-C-G 11323972-C-G *
13480161-C-T 11324485-C-T *
13480165-G-A 11324489-G-A *
13480193-T-C 11324517-T-C *
13480938-T-A 11325262-T-A *
13481714-A-C 11326038-A-C *
13481715-A-T 11326039-A-T *
13481725-A-G 11326049-A-G *
13482249-T-A 11326573-T-A *
13487858-T-TCC 11332182-T-TCC *
13488154-G-C 11332478-G-C *
13475972-C-G 11320296-C-G *
13531311-T-A 11375635-T-A *
13489874-T-C 11334198-T-C *
13489879-GCGCA-G 11334203-GCGCA-G *
13489884-C-T 11334208-C-T *
13489890-C-A 11334214-C-A *
13489908-C-A 11334232-C-A *
13490340-T-TGAACTCATCA 11334664-T-TGAACTCATCA *
13491117-T-G 11335441-T-G *
13500371-A-G 11344695-A-G *
13508968-A-T 11353292-A-T *
13508972-C-T 11353296-C-T *
13524557-A-G 11368881-A-G *
13533618-C-G 11377942-C-G *
13489857-C-T 11334181-C-T *
13539936-T-A 11384260-T-A *
13544343-CA-C 11388667-CA-C *
13550404-C-T 11394728-C-T *
13558822-G-A 11403146-G-A *
13565285-T-A 11409609-T-A *
13571531-CTTCT-C 11415855-CTTCT-C *
13571542-A-T 11415866-A-T *
13571589-G-A 11415913-G-A *
13572620-T-A 11416944-T-A *
13576782-G-A 11421106-G-A FT219310 *
13590986-T-C 11435310-T-C *
13489860-G-T 11334184-G-T *
13489781-G-T 11334105-G-T *
13488173-T-A 11332497-T-A *
13488959-GC-G,TC 11333283-GC-G,TC *
13488218-G-T 11332542-G-T *
13488330-A-C 11332654-A-C *
13488390-C-T 11332714-C-T BY197905 *
13488406-C-CTG 11332730-C-CTG *
13488407-CAG-C 11332731-CAG-C *
13488590-TGCCCTGCACGACTGGG-T 11332914-TGCCCTGCACGACTGGG-T *
11332915-G- *
11332919-T- *
13488702-T-A 11333026-T-A *
13488717-G-GA 11333041-G-GA *
11333058-C- *
11333284-C- *
13489723-A-AC 11334047-A-AC *
13488965-G-GGT 11333289-G-GGT *
13489015-C-CTCT 11333339-C-CTCT *
13489094-C-G 11333418-C-G *
13489115-T-C 11333439-T-C *
13489295-G-T 11333619-G-T *
11333939-ACCC- *
13489627-C-CCA 11333951-C-CCA *
11333955-ACCCAC- *
13489657-T-A 11333981-T-A *
13489658-C-A 11333982-C-A *
13489686-CAT-C 11334010-CAT-C *
13476032-A-T 11320356-A-T *
13475868-A-C 11320192-A-C *
13591023-G-A 11435347-G-A *
13462775-CCAGG-C 11307099-CCAGG-C *
13457128-T-C 11301452-T-C *
13458426-C-CCTTCT 11302750-C-CCTTCT *
13459569-C-T 11303893-C-T *
13459570-C-T 11303894-C-T *
13461705-C-G 11306029-C-G *
13462018-A-G 11306342-A-G *
13462026-A-T 11306350-A-T *
13462063-ACC-A 11306387-ACC-A *
13462076-G-T 11306400-G-T *
13462094-G-A 11306418-G-A *
13462782-G-GGGTC 11307106-G-GGGTC *
13455152-T-C 11299476-T-C *
13463338-G-T 11307662-G-T *
13463340-G-C 11307664-G-C *
13463354-T-A 11307678-T-A *
11308162-T- *
13463961-A-AC 11308285-A-AC *
13463964-G-GGCTCACTGACT 11308288-G-GGCTCACTGACT *
13464044-C-T 11308368-C-T *
13464052-T-A 11308376-T-A *
13464087-G-A 11308411-G-A *
13464406-C-G 11308730-C-G *
13464459-G-C 11308783-G-C *
13455154-C-T 11299478-C-T BY85418 *
13455149-C-T 11299473-C-T *
13464502-C-T 11308826-C-T *
13438497-C-G 11282821-C-G *
13417496-G-C 11261820-G-C *
13419577-G-C 11263901-G-C *
13420553-AATTGTGCCAGAACATT-A 11264877-AATTGTGCCAGAACATT-A *
13420932-A-G 11265256-A-G *
13423488-G-A 11267812-G-A *
13436825-T-G 11281149-T-G *
13436918-A-G 11281242-A-G *
13436974-A-G 11281298-A-G *
13437928-G-T 11282252-G-T *
13438487-T-C 11282811-T-C *
13438489-C-T 11282813-C-T *
13440299-CTA-C 11284623-CTA-C *
13455145-C-A 11299469-C-A *
13447501-T-C 11291825-T-C *
13447595-A-G 11291919-A-G *
13448039-C-A 11292363-C-A *
13448042-C-T 11292366-C-T *
13448045-C-G 11292369-C-G *
13449327-T-TCCATTCCAA 11293651-T-TCCATTCCAA *
13453888-C-T 11298212-C-T *
13453907-C-G 11298231-C-G *
13453908-C-A 11298232-C-A *
13455140-C-CACGTGG 11299464-C-CACGTGG *
13455143-T-TGTTA 11299467-T-TGTTA *
13464479-G-T 11308803-G-T *
13464738-G-C 11309062-G-C *
13475867-G-C 11320191-G-C *
13472070-T-A 11316394-T-A *
13470461-G-C 11314785-G-C *
13470734-C-G 11315058-C-G *
13470912-A-AGCCCCAGGCAAAGCCGCCTGTATCATAAAGTCCGCTGGAGGAAAAGC 11315236-A-AGCCCCAGGCAAAGCCGCCTGTATCATAAAGTCCGCTGGAGGAAAAGC *
13471721-C-G 11316045-C-G *
13471770-G-A 11316094-G-A *
13471772-G-T 11316096-G-T *
13471780-G-T 11316104-G-T *
13471802-G-A 11316126-G-A *
13471805-C-G 11316129-C-G *
11316208-G- *
13472060-A-T 11316384-A-T *
13472072-C-G 11316396-C-G *
13470446-T-C 11314770-T-C *
13472222-C-A,CAA 11316546-C-A,CAA *
13472285-CT-C 11316609-CT-C *
13472289-G-GCAACCCACAGCGTCCAGTCCTGACA 11316613-G-GCAACCCACAGCGTCCAGTCCTGACA *
13472293-CT-C 11316617-CT-C *
13473551-A-T 11317875-A-T *
13473553-C-G 11317877-C-G *
13473845-A-G 11318169-A-G *
13474570-G-C 11318894-G-C *
13475436-C-T 11319760-C-T *
13475706-G-A 11320030-G-A *
13475711-T-C 11320035-T-C *
13470447-G-GC 11314771-G-GC *
13470432-G-T 11314756-G-T *
13464760-C-G 11309084-C-G *
13468109-C-T 11312433-C-T *
13464778-G-T 11309102-G-T *
13464789-C-CGTCATTTAGGTG 11309113-C-CGTCATTTAGGTG *
13464794-C-G 11309118-C-G *
13464795-T-TGGAGAGA 11309119-T-TGGAGAGA *
13465178-G-T 11309502-G-T *
13465507-A-T 11309831-A-T *
13466513-A-T 11310837-A-T *
13466525-T-G 11310849-T-G *
13466989-G-A 11311313-G-A BY51960 *
13467312-A-T 11311636-A-T *
13467313-A-T 11311637-A-T *
13468462-G-A 11312786-G-A *
13470430-G-A 11314754-G-A *
13469433-T-A 11313757-T-A *
13469445-T-G 11313769-T-G *
13469463-A-T 11313787-A-T *
13469488-A-G 11313812-A-G *
13469695-A-T 11314019-A-T *
13469900-AAC-A 11314224-AAC-A *
13469908-A-T 11314232-A-T *
13469915-A-C 11314239-A-C *
13470201-G-A 11314525-G-A *
13470203-T-A 11314527-T-A *
13470206-C-T 11314530-C-T *
13590996-G-C 11435320-G-C *
13591036-G-A 11435360-G-A *
13393489-C-G 11237813-C-G *
28523354-T-C 26377207-T-C *
23999054-G-GAACT 21852907-G-GAACT *
23999058-TTTA-T 21852911-TTTA-T *
23999062-A-C 21852915-A-C Y*
23999066-TTCCTAACACTG-T 21852919-TTCCTAACACTG-T *
24152650-C-G 22006503-C-G P3_b1 *
24499858-C-A 22353711-C-A *
26286106-ATT-A 24139959-ATT-A P1_Y1 *
26728156-G-A 24582009-G-A P1_g2 *
28523352-G-A 26377205-G-A *
28523353-G-A 26377206-G-A *
28550756-A-G 26404609-A-G *
23999048-C-G 21852901-C-G Y*
28550758-T-C 26404611-T-C *
28550768-G-A 26404621-G-A *
28586986-T-A 26440839-T-A *
28785506-GA-G 26639359-GA-G *
28785519-A-G 26639372-A-G *
28785523-G-A 26639376-G-A *
28785525-A-T 26639378-A-T *
28785530-T-G 26639383-T-G *
28786051-G-A 26639904-G-A *
28786675-AAT-A 26640528-AAT-A *
28786678-GGAATGGAA-G 26640531-GGAATGGAA-G *
23999050-A-G 21852903-A-G FTB69921 Y*
23999030-TTACTATTATTATTC-T 21852883-TTACTATTATTATTC-T *
28787302-T-G 26641155-T-G *
22714028-AGT-A 20552142-AGT-A *
22489736-C-T 20327850-C-T DYZ19 *
22506783-T-A 20344897-T-A DYZ19 *
22506798-T-C 20344912-T-C DYZ19 *
22508096-CT-C 20346210-CT-C DYZ19 *
22508132-T-G 20346246-T-G DYZ19 *
22509305-A-G 20347419-A-G DYZ19 *
22509308-G-T 20347422-G-T DYZ19 *
22510551-G-A 20348665-G-A DYZ19 *
22511824-G-C 20349938-G-C DYZ19 *
22512780-G-C 20350894-G-C DYZ19 *
22512800-C-G 20350914-C-G DYZ19 *
22749340-AAT-A 20587454-AAT-A *
23999019-GCAGGTTCCT-G 21852872-GCAGGTTCCT-G *
22996969-G-GAT,GATAT 20835083-G-GAT,GATAT 21×AT*
23117239-C-CGCTAAAGTGAAAAAAGGTAAGAAAAAAGCCGTTGTGGTGG 20955353-C-CGCTAAAGTGAAAAAAGGTAAGAAAAAAGCCGTTGTGGTGG *
23570323-CACTT-C 21408437-CACTT-C *
23723544-CATAT-C,CAT 21561658-CATAT-C,CAT 27×AT*
23793539-T-A 21631653-T-A Y*
23793549-A-G 21631663-A-G FT55112 Y*
23793556-C-T 21631670-C-T Y*
23793791-G-T 21631905-G-T Y*
23793836-A-G 21631950-A-G Y*
23825067-T-A 21663181-T-A Y*
23988879-A-G 21842732-A-G Y*
28786697-T-C 26640550-T-C *
28787310-A-T 26641163-A-T *
22489718-TG-T 20327832-TG-T DYZ19 *
56829551-A-C *
28816543-T-A 26670396-T-A *
56699973-G-A *
56708557-T-C *
56708641-A-C *
56708682-T-C *
56720961-G-T *
56722578-C-A *
56724598-A-T *
56734550-T-G *
56742759-G-GGAAATGGACTGGAAAGGAATGGACTCAAA *
56771234-G-T *
56830738-T-TCCAC *
28815058-G-T 26668911-G-T *
56830739-T-C,TC *
56832539-C-A,CTCCAATCCATTCCAT *
56833446-A-ACCATT,ATCATT *
56834380-T-TTCCATTCCATTCCAC,TTCCGTTCAATTCCTC *
56834400-C-CCACTCCGTTCCACTCCTATCCACTCCATTCCTCTCCACTCCACTCCAT *
56834605-C-CTCAACTTTAA *
56834609-A-ACTCCACTCCACTCCT *
56839742-T-TG *
56859641-G-A *
56874027-C-A *
56883900-C-A *
28815081-G-C 26668934-G-C *
26668209-T- *
28787312-T-G 26641165-T-G *
28801954-G-T 26655807-G-T *
28791300-G-A,GTGGAGTGGAA 26645153-G-A,GTGGAGTGGAA *
28793833-G-A 26647686-G-A *
28794306-TGGAATGTAAG-T 26648159-TGGAATGTAAG-T *
28798917-G-T 26652770-G-T *
28798918-T-A 26652771-T-A *
28800265-TGGAAA-T 26654118-TGGAAA-T *
28800276-G-C 26654129-G-C *
28800287-G-C 26654140-G-C *
28801937-GT-G 26655790-GT-G *
28801941-ACTG-A 26655794-ACTG-A *
28801948-A-AAT 26655801-A-AAT *
28801955-G-T 26655808-G-T *
28814346-GGAATGGAATT-G 26668199-GGAATGGAATT-G *
26656923-GTGGAGTGGAA- *
28803147-G-A 26657000-G-A *
28804162-T-A 26658015-T-A *
28804288-G-T 26658141-G-T *
28805427-TGAATG-T 26659280-TGAATG-T *
28805954-G-T 26659807-G-T *
28806259-G-C 26660112-G-C *
28806297-T-A 26660150-T-A *
28808957-G-C 26662810-G-C *
28808958-G-T 26662811-G-T *
28811805-T-C 26665658-T-C *
22489722-C-T 20327836-C-T DYZ19 *
22484023-C-T 20322137-C-T DYZ19 *
13591042-C-T 11435366-C-T FT106466 *
13716978-T-C 11561302-T-C *
13705108-A-T 11549432-A-T *
13705155-A-C 11549479-A-C BY181424 *
13706562-T-A 11550886-T-A *
13706588-G-C 11550912-G-C *
13707066-T-G 11551390-T-G *
13707072-G-A 11551396-G-A *
13707157-C-T 11551481-C-T *
13708091-A-AGAATG 11552415-A-AGAATG 4×GAATG*
13713452-T-G 11557776-T-G *
13714936-G-A 11559260-G-A *
13714939-A-G 11559263-A-G *
13718189-A-T 11562513-A-T *
13694040-A-T 11538364-A-T *
13718202-A-C 11562526-A-C *
13718238-C-A 11562562-C-A *
13719055-T-A 11563379-T-A *
13730455-A-T 11574779-A-T *
13734518-A-G 11578842-A-G *
11658489-A-T *
13803170-C-T 11682464-C-T *
13827950-T-C 11707244-T-C *
13832134-G-T 11711428-G-T *
13832136-A-G 11711430-A-G *
13832139-TTAAAAAAA-T 11711433-TTAAAAAAA-T *
13704476-A-T 11548800-A-T *
13693914-A-G 11538238-A-G *
13864971-G-C 11744265-G-C *
13679920-C-CT 11524244-C-CT *
13593939-G-T 11438263-G-T *
13593974-G-A 11438298-G-A FTA54791 *
13600468-A-T 11444792-A-T *
13607617-GAAAAGAAAA-G 11451941-GAAAAGAAAA-G *
13647991-G-T 11492315-G-T *
13648000-G-A 11492324-G-A *
13648003-A-G 11492327-A-G *
13648004-T-A 11492328-T-A *
13648006-G-A 11492330-G-A *
13648011-A-G 11492335-A-G *
13650618-G-A 11494942-G-A FT447190 *
13679921-C-CAAATATTATGGGCTG 11524245-C-CAAATATTATGGGCTG *
13693322-A-G 11537646-A-G *
13679934-A-C 11524258-A-C *
13679945-T-C 11524269-T-C *
13688235-T-TGGAATGGAATGGAATG 11532559-T-TGGAATGGAATGGAATG *
13688237-C-CATGGAATGTAATGG,G 11532561-C-CATGGAATGTAATGG,G *
13691905-C-T 11536229-C-T FT178193 *
13692136-G-C 11536460-G-C *
13693294-GCAGT-G 11537618-GCAGT-G *
13693300-A-ACTC 11537624-A-ACTC *
13693304-GTAAC-G 11537628-GTAAC-G *
13693313-TC-T 11537637-TC-T *
13693317-A-AG 11537641-A-AG *
13857973-GTGGAA-G 11737267-GTGGAA-G *
13868449-T-C 11747743-T-C *
22479378-G-T 20317492-G-T FT460245 DYZ19 *
19514558-G-GTGGATTGGGTAGTCTCTTTTGATGAAGATACACCACAACGTTTAATCGGT 17402678-G-GTGGATTGGGTAGTCTCTTTTGATGAAGATACACCACAACGTTTAATCGGT *
18271715-A-G 16159835-A-G P6_Prx *
18738808-CATATATATATATATATATGT-C 16626928-CATATATATATATATATATGT-C 9×AT*
18850423-ATATG-A 16738543-ATATG-A *
18938799-C-T 16826919-C-T FTB67121 YY*
19025861-G-T 16913981-G-T Y*
19025863-C-G 16913983-C-G Y*
19025871-T-A 16913991-T-A Y*
19173957-T-C 17062077-T-C Y*
19202810-A-T 17090930-A-T YY*
19315551-C-CGACCGAGACCTCAAGATCAAGGTCAACTGGAGAGAGCAGGGTATCAGCGAGACCGTCAGCCTGAAG 17203671-C-CGACCGAGACCTCAAGATCAAGGTCAACTGGAGAGAGCAGGGTATCAGCGAGACCGTCAGCCTGAAG *
19401105-T-TAGGCTTCGAGCCCTTCATGGCGGGCAGTATCGATATTCCACTGAAGCAGACGACGCATCAATCGGCGTTTGC 17289225-T-TAGGCTTCGAGCCCTTCATGGCGGGCAGTATCGATATTCCACTGAAGCAGACGACGCATCAATCGGCGTTTGC *
19549313-G-A 17437433-G-A YY*
17632570-G-GT,GTTT 15520690-G-GT,GTTT 22×T*
20839464-C-T 18677578-C-T P4_Gap *
21346716-C-T 19184830-C-T Y*
21365422-C-CA,CAA 19203536-C-CA,CAA 17×A*
21624825-C-G 19462939-C-G YY*
21832764-C-CCGCTAGATTATCTGTCATCTGACGGTTCATCTCTTCTGGAAATGGTGAATATTTATCAAAGGTTCTTAACCCTGCT 19670878-C-CCGCTAGATTATCTGTCATCTGACGGTTCATCTCTTCTGGAAATGGTGAATATTTATCAAAGGTTCTTAACCCTGCT *
22233371-A-G 20071485-A-G DYZ19 *
22346617-G-T 20184731-G-T DYZ19 *
22424933-A-G 20263047-A-G DYZ19 *
22427477-A-AG 20265591-A-AG DYZ19 *
22427479-TA-T 20265593-TA-T DYZ19 *
22447187-G-T 20285301-G-T DYZ19 *
17777669-C-T 15665789-C-T Y*
16490650-C-CGCGGTGGGTAATCCAGACGGTGAGCAGGATAATCAGGGGCAGGGCGAGGAGCATGGGGAGGATGCTCTGCACGGCAG 14378770-C-CGCGGTGGGTAATCCAGACGGTGAGCAGGATAATCAGGGGCAGGGCGAGGAGCATGGGGAGGATGCTCTGCACGGCAG *
13868454-T-A 11747748-T-A *
14613459-CT-C,CTT 12501657-CT-C,CTT 26×T*
13868868-ACGGAT-A 11748162-ACGGAT-A *
13868878-AC-A 11748172-AC-A *
13868881-GAAC-G 11748175-GAAC-G *
13868888-A-T 11748182-A-T *
13868890-AG-A 11748184-AG-A *
13868896-G-A 11748190-G-A BY91723 *
13868899-T-C 11748193-T-C *
14002953-A-ACTCGCCGTTTTTCTGC 11882247-A-ACTCGCCGTTTTTCTGC *
14002956-C-CCTCGGCTCACCGATGCGCGATTTAAACGGCAAAACACTGGCAATTTTCGGTCGCGGCA 11882250-C-CCTCGGCTCACCGATGCGCGATTTAAACGGCAAAACACTGGCAATTTTCGGTCGCGGCA *
14195800-C-T 12075094-C-T Y*
14505034-T-TA 12393239-T-TA 9×A*
14656047-C-T 12544112-C-T BY166929 YY*
16336685-G-A 14224805-G-A YY*
14729487-T-TG 12617555-T-TG *
14729489-T-TTAATTTAGTAAAAATTTGAAATTTTAGATTTTTGGGAGTATAATATTAACATCAGTTGAAAAA 12617557-T-TTAATTTAGTAAAAATTTGAAATTTTAGATTTTTGGGAGTATAATATTAACATCAGTTGAAAAA *
14870206-G-A 12758276-G-A YY*
14945508-G-GAAGAAAATCTAAAGAAACAAAATCCTGATTATCAGAACACTT 12833582-G-GAAGAAAATCTAAAGAAACAAAATCCTGATTATCAGAACACTT *
14984023-CA-C 12872091-CA-C 9×A*
12903343-CT-C,C 25×T*
15456215-T-TGTTTTCTAAGTGGCTTGTCCTTATGGTGTTATGTTGTCTCGGTGTGAAGGGGCTTTTGCAACCTATA 13344335-T-TGTTTTCTAAGTGGCTTGTCCTTATGGTGTTATGTTGTCTCGGTGTGAAGGGGCTTTTGCAACCTATA *
15552641-C-CGTCTATTTCTT 13440761-C-CGTCTATTTCTT *
15552644-G-GTCTATT 13440764-G-GTCTATT *
15552645-G-GGATGGAGAGATAGATTTTGTAACAAACATTCTATTATGA 13440765-G-GGATGGAGAGATAGATTTTGTAACAAACATTCTATTATGA *
16195806-G-GTCTGCTGAGATTTATGAAGAGAAAACTAAACAAATTAAAGAC 14083926-G-GTCTGCTGAGATTTATGAAGAGAAAACTAAACAAATTAAAGAC *
13410547-C-T 11254871-C-T *
13390446-G-T 11234770-G-T *
9067987-A-G 9230378-A-G Y*
13489939-G-C 11334263-G-C *
13469468-GC-G 11313792-GC-G *
22505741-T-A 20343855-T-A DYZ19 *
9992575-A-ATG,G 10154966-A-ATG,G *
9992576-C-A,T 10154967-C-A,T *
10780531-T-A *
11018305-T-C *
13469200-C-CCCT 11313524-C-CCCT *
13484788-G-A 11329112-G-A *
13484839-T-C 11329163-T-C *
13489849-G-C 11334173-G-C *
13689745-G-A 11534069-G-A *
56731760-G-C *
28785479-A-ATATAC 26639332-A-ATATAC *
28785744-A-C 26639597-A-C *
28785764-A-C 26639617-A-C *
56756756-A-G *
2749841-C-CCGTACTTCACTTGGCTTGCA 2881800-C-CCGTACTTCACTTGGCTTGCA *
2749843-G-GCGATGTTCCCGAAGGCACATGGTATTCAGGCTGGACATTCAAATCCATTATC 2881802-G-GCGATGTTCCCGAAGGCACATGGTATTCAGGCTGGACATTCAAATCCATTATC *
2801188-G-A 2933147-G-A YY*
2820854-G-GT 2952813-G-GT *
2820856-TC-T 2952815-TC-T *
2820858-A-G 2952817-A-G YY*
2820875-T-C 2952834-T-C YY*
10082061-A-T 10244452-A-T *
23793922-C-T 21632036-C-T Y*
3293092-G-A 3425051-G-A *
10975824-T-TCC *
56722628-A-T *
56831651-C-A *
9967915-T-C 10130306-T-C Y*
10992862-C-A *
11005118-A-C *
11308163-T- *
13472751-G-A 11317075-G-A *
13482545-C-CT 11326869-C-CT *
9943965-A-G 10106356-A-G Y*
10818728-CTCCGTTCTATTCCTTTGCTT-C *
10975822-A-AATC *
13488282-A-G 11332606-A-G *
13489722-C-A 11334046-C-A *
13489585-G-A 11333909-G-A *
56854311-G-T *
10800352-C-T *
10800356-A-ATT *
10959013-T-TTGTAC *
13253111-G-C 11097435-G-C *
13332273-C-T 11176597-C-T *
13461609-G-T 11305933-G-T *
13488562-T-TTA 11332886-T-TTA *
13488565-G-GA 11332889-G-GA *
13488961-C-A 11333285-C-A *
2930483-G-A 3062442-G-A *
3293099-G-C 3425058-G-C *
13447591-T-C 11291915-T-C *
9432727-G-A 9595118-G-A Y*
5621284-C-CTG 5753243-C-CTG *
6069744-C-G 6201703-C-G *
6440631-C-T 6572590-C-T *
6498772-G-A 6630731-G-A *
6644597-C-CTTTT 6776556-C-CTTTT 15×T*
7567753-C-CT,CT 7699712-C-CT,CT 25×T*
8425712-C-G 8557671-C-G YY*
8703110-A- *
9389800-T-TGCGAGAGAGATGAGGC 9552191-T-TGCGAGAGAGATGAGGC *
9389804-C-CAGCCCGTCTATGATTT 9552195-C-CAGCCCGTCTATGATTT *
9432723-A-G 9595114-A-G Y*
9432738-C-G 9595129-C-G Y*
5360073-T-G 5492032-T-G *
9909488-C-G 10071879-C-G Y*
9909507-G-C 10071898-G-C Y*
9910062-T-C 10072453-T-C Y*
9910072-C-T 10072463-C-T Y*
9910078-G-T 10072469-G-T Y*
9924382-A-T 10086773-A-T Y*
9924395-T-A 10086786-T-A Y*
10094469-GT- 10×T*
9942043-AT-A,ATT 10104434-AT-A,ATT 28×T*
9942904-A-G 10105295-A-G Y*
9942945-T-C 10105336-T-C Y*
5479867-T-C 5611826-T-C *
5360067-A-T 5492026-A-T *
3424918-C-T 3556877-C-T *
4634556-C-T 4766515-C-T *
3588094-GTATATA-G,GTATA 3720053-GTATATA-G,GTATA 24×TA*
3609132-A-G 3741091-A-G *
3790880-A-G,G 3922839-A-G,G *
4076225-C-T 4208184-C-T *
4090662-G-A 4222621-G-A *
4121087-G-C 4253046-G-C *
4288471-C-T 4420430-C-T *
4416637-C-CGG 4548596-C-CGG *
4459815-C-T 4591774-C-T *
4494380-A-T 4626339-A-T *
4634555-T-C 4766514-T-C *
4634563-A-T 4766522-A-T *
5360057-GC-G 5492016-GC-G *
4634567-A-T 4766526-A-T *
4634571-A-T 4766530-A-T *
4650472-G-GATAT,GATATAT 4782431-G-GATAT,GATATAT 24×AT*
4667256-T-G 4799215-T-G *
4671927-GA-G 4803886-GA-G *
5062760-CA-C 5194719-CA-C *
5138202-G-T 5270161-G-T *
5169889-G-A 5301848-G-A *
5267560-A-G 5399519-A-G *
5270692-TC-T 5402651-TC-T *
5302816-C-T 5434775-C-T *
13487923-C-A 11332247-C-A *
13427774-T-C 11272098-T-C *
9967925-G-T 10130316-G-T Y*
13465141-G-A 11309465-G-A *
22255524-C-A 20093638-C-A DYZ19 *
28813867-T-A 26667720-T-A *
13374158-C-A 11218482-C-A *
56856795-T-TATATTAAA *
56856797-G-T *
9984306-A-C 10146697-A-C Y*
10820366-T-TTG *
10820371-T-G *
13448032-ACTCC-A 11292356-ACTCC-A *
13464729-C-A 11309053-C-A *
13468414-A-T 11312738-A-T *
13461132-A-G 11305456-A-G *
13472290-C-CAA 11316614-C-CAA *
11323254-T- *
11333938-C- *
13489699-G-C 11334023-G-C *
13692147-G-A 11536471-G-A *
13804334-T-A 11683628-T-A *
23793898-C-A 21632012-C-A Y*
9943876-C-T 10106267-C-T Y*
10987432-TCTACTCCATTCCATTCAATTC-T *
10987458-CCAT-C *
13464097-A-C 11308421-A-C *
13480163-A-T 11324487-A-T *
13443773-G-A 11288097-G-A *
11323318-C- *
9980213-AG-A 10142604-AG-A *
9068010-T-A 9230401-T-A Y*
9068015-T-G 9230406-T-G Y*
9068022-AAC-A 9230413-AAC-A *
9068027-A-ATAT 9230418-A-ATAT *
9068034-A-G 9230425-A-G Y*
10939293-A-G *
10939296-C-A *
10939299-C-T *
13345325-G-T 11189649-G-T *
13480237-G-A 11324561-G-A *
13480246-C-T 11324570-C-T *
9980216-A-T 10142607-A-T Y*
13478482-G-GTT 11322806-G-GTT *
10668329-C-CCA *
13390456-C-G 11234780-C-G *
13390479-G-A 11234803-G-A *
13390483-T-G 11234807-T-G *
13476743-G-A 11321067-G-A *
13487944-G-A 11332268-G-A *
13725839-A-T 11570163-A-T *
56746287-A-AATGGAATGGG *
22359610-T-TCA 20197724-T-TCA DYZ19 *
22359611-TGA-T 20197725-TGA-T DYZ19 *
56842344-C- *
13472110-T-G 11316434-T-G *
13479529-G-T 11323853-G-T *
10927900-A-G *
13489010-CCA-C 11333334-CCA-C *
22509554-G-T 20347668-G-T DYZ19 *
13463317-C-T 11307641-C-T *
13469353-C-G 11313677-C-G *
13469359-T-G 11313683-T-G *
56827914-C-CAATCCATTCCATTCCATTCCATTAAATTCG,CAATCCATTCCATTCCATTCTATTCCATTCCATTAAATTCG *
13478460-C-A 11322784-C-A *
13478540-G-A 11322864-G-A *
13479406-A-T 11323730-A-T *
13479411-C-A 11323735-C-A *
13480232-A-T 11324556-A-T *
13488708-G-GA 11333032-G-GA *
11334026-C- *
13463259-G-A 11307583-G-A *
11334027-GCA- *
13489947-G-A 11334271-G-A *
13718573-C-T 11562897-C-T *
56832166-TA-T *
56832194-ATT-A *
56832197-CCAT-C *
11306154-G- *
9909485-G-A 10071876-G-A Y*
9909497-G-T 10071888-G-T Y*
9909501-A-T 10071892-A-T Y*
9984276-G-C 10146667-G-C Y*
13517858-C-A 11362182-C-A *
3421816-G-A 3553775-G-A *
23793910-T-C 21632024-T-C Y*
10930039-CTG-C *
28801359-ACT-A 26655212-ACT-A *
28801363-A-AGG 26655216-A-AGG *
56742552-GAATGGAAAGTAATCC-G *
56747826-AGAATGGAATGGAATC- *
56876124-CAAAAAAAAAAAAAAAAAAAAAAAAAAAA-C 50×A*
9965062-T-A 10127453-T-A Y*
13697358-G-A 11541682-G-A *
28802974-G-C 26656827-G-C BY151658 *
4686573-C-CAAA 4818532-C-CAAA 15×A*
8398537-T-TAA 8530496-T-TAA 13×A*
10930036-T-TTC *
10930372-T-G *
13469201-A-G 11313525-A-G *
13433596-AAG-A 11277920-AAG-A *
11306156-A- *
13469910-A-T 11314234-A-T *
22509074-G-T 20347188-G-T DYZ19 *
23793931-T-C 21632045-T-C Y*
23793944-T-A 21632058-T-A Y*
23793945-A-G 21632059-A-G Y*
23793950-T-C 21632064-T-C Y*
56764001-G-A *
13334385-A-G 11178709-A-G *
56856117-A-AG,G *
9942952-G-A 10105343-G-A Y*
9974352-A-ATTTTT 10136743-A-ATTTTT *
13374282-A-C 11218606-A-C *
10999599-C-G *
10984958-GCACTC-G *
10986526-T-TTCCACTCCACTCCTACTCATTCCACCACTCTCCAA *
10986540-G-C *
10986541-T-TCCCACTCTATTCCAC *
10987245-T-TAGTTCCATTCCTTCCC *
10987249-T-C *
10989102-CACTCCACACCACTGAACTCCACTCCACTCCACTCCATTCCATTCCACTCCACTCCA- *
10989183-ACTCCT-A *
10989195-TCCATGCCATTCTACTGCAGTCCACTCCACTCCATTCCACTCC-T *
10989241-C-T *
11001522-A-C *
10982876-C-CTGT *
11001533-C-A *
11001594-C-A *
11001614-T-A *
11006566-G-A *
11007129-T-C *
11017823-A-G *
11017831-T-A *
11017837-C-A *
11017849-T-C *
11017855-A-G *
11018299-A-G *
10984932-TCCATTCCATTCCATACCATC-T *
10982874-T-TAC *
11025164-A-T *
10969317-TGTCA-T *
10952536-A-ATTTTC *
10952562-CTG-C *
10952565-CAT-C *
10952570-G-A *
10952572-T-TAAAC *
10954088-T-TTATAC *
10954093-T-A *
10954107-A-T *
10964149-G-A *
10964260-T-G *
10964266-C-T *
10969336-C-T *
10980952-A-C *
10972967-C-T *
10972979-A-T *
10973193-C-T *
10974708-C-T *
10980570-TTCAGTC-T *
10980573-AGTCCT-A *
10980574-G- *
10980578-T- *
10980590-TCC-T *
10980602-C-CATTAT *
10980603-AGTGC-A *
11018309-T-A *
11033933-TTCTGC-T *
10952491-AATC-A *
13338718-C-T 11183042-C-T *
13265576-TCTCTTGTG-T 11109900-TCTCTTGTG-T *
13267614-G-A 11111938-G-A *
13287977-A-C 11132301-A-C *
13287979-A-C 11132303-A-C *
13287981-A-C 11132305-A-C *
13298649-TG-T 11142973-TG-T *
13301032-G-A 11145356-G-A *
13334346-G-A 11178670-G-A *
13338500-T-C 11182824-T-C *
13338547-TCC-T 11182871-TCC-T *
13338550-TTCACATAGGATTCTAGAACACTGCTCCCATGGTCTGAATGTTTGTC-T 11182874-TTCACATAGGATTCTAGAACACTGCTCCCATGGTCTGAATGTTTGTC-T *
13338908-T-A 11183232-T-A *
13263500-C-A 11107824-C-A FT442038 *
13342542-T-C 11186866-T-C *
13344101-A-G 11188425-A-G *
13345191-T-A 11189515-T-A *
13348788-C-CT 11193112-C-CT *
13348795-C-T 11193119-C-T 9×T*
13352626-A-T 11196950-A-T *
13354189-G-A 11198513-G-A *
13362419-G-A 11206743-G-A *
13370396-C-G 11214720-C-G *
13374271-G-C 11218595-G-C *
13374272-A-AAAACAAAACAAAACAAAAC 11218596-A-AAAACAAAACAAAACAAAAC *
13264357-A-T 11108681-A-T *
13256392-C-T 11100716-C-T *
11033942-ACTC-A *
13223349-GATGAGAGGAAGAGGACA-G 11067673-GATGAGAGGAAGAGGACA-G *
11033946-ACCTCCACTAAACTCC-A *
11033964-TCC-T *
11033969-T-A *
11033974-T-G *
11033988-T-C *
13194925-T-A 11039249-T-A *
13194929-C-A 11039253-C-A *
13195022-C-A 11039346-C-A *
13195028-A-G 11039352-A-G *
13196255-C-T 11040579-C-T BY30326 *
13223345-GA-G 11067669-GA-G *
13223372-GAGCA-G 11067696-GAGCA-G *
13256376-G-A 11100700-G-A *
13223382-AAGGG-A 11067706-AAGGG-A *
13223396-AAAGGAGGGAG-A 11067720-AAAGGAGGGAG-A *
13223438-AAGGGAAGGAGAGGAGGGG-A 11067762-AAGGGAAGGAGAGGAGGGG-A *
13240146-A-T 11084470-A-T *
13240190-A-G 11084514-A-G *
13248433-A-G 11092757-A-G *
13248463-T-C 11092787-T-C *
13251610-A-G 11095934-A-G *
13256336-C-T 11100660-C-T *
13256337-C-G 11100661-C-G *
13256360-A-G 11100684-A-G *
10952504-C-T *
10952488-TCC-T *
9975398-A-T 10137789-A-T Y*
10688066-T-TCCATTGCA *
10658408-CATCCA-C *
10658421-G-C *
10661798-CCACTG-C *
10661810-A-T *
10678952-CATTCTACTCAACTTCAATCA-C *
10678979-C-T *
10678981-G-T *
10678995-T-A *
10678997-C-T *
10678999-C-T *
10688064-C-CCA *
10688072-T-TTCCTC *
10632293-C-A *
10688086-T-TCTCCA *
10688088-T-TC *
10688246-A-G *
10753581-T-C *
10753583-C-A *
10753593-G-A *
10753603-CCA-C *
10753607-TTCA-T *
10756098-A-G *
10756111-C-T *
10759213-TTCCC-T *
10632300-G-A *
10632291-G-A *
10759332-C-CGACAA *
10006146-G-GGA 10168537-G-GGA *
9975399-G-A 10137790-G-A Y*
9975413-G-C 10137804-G-C Y*
9980159-A-T 10142550-A-T Y*
9980178-G-A 10142569-G-A Y*
9981870-A-G 10144261-A-G Y*
9981884-G-A 10144275-G-A Y*
9981887-T-C 10144278-T-C Y*
9986820-G-A 10149211-G-A Y*
9992590-GC-G 10154981-GC-G *
9992593-A-T 10154984-A-T Y*
9993061-A-G 10155452-A-G BY209515 Y*
10006150-GA-G 10168541-GA-G *
10626639-A-T *
10031390-T-G 10193781-T-G Y*
10031427-G-A 10193818-G-A Y*
10031455-C-A 10193846-C-A Y*
10034731-CACCACCA-C 10197122-CACCACCA-C *
10037888-TCCCAGGGCTA-T 10200279-TCCCAGGGCTA-T *
10037900-GCCTGTCTGAGCTTTGCTTGCCAATCATTAGCCCCTGA-G 10200291-GCCTGTCTGAGCTTTGCTTGCCAATCATTAGCCCCTGA-G *
10069828-ATG-A 10232219-ATG-A *
10069831-G-GCT 10232222-G-GCT *
10082071-A-T 10244462-A-T *
10093004-A-T 10255395-A-T *
10626637-C-T *
10759221-CATTCCTTTATTTTGACTGGATCTCACTCTGTCACTTAGACTTGAGTGGAGTGACACAATCTCAGCTCACATTTCATTTCACTG-C *
10767725-CCAATCAACTT-C *
10951138-CTTCATTCCAT-C *
10930360-A-T *
10866768-A-G *
10896124-T-C *
10896132-A-G *
10898402-C-G *
10900865-A-C *
10909786-C-G *
10921644-T-A *
10925021-T-A *
10927876-C-CTGTACTAAAA *
10927916-T-C *
10927927-T-G *
10930361-C-G *
10866736-CCACTCTAATCCAT-C *
10930364-C-T *
10936977-C-G *
10939303-A-G *
10939306-CAACTA-C *
10941212-A-G *
10941216-C-A *
10941223-T-C *
10941619-T-C *
10947686-C-A *
10947689-C-A *
10950574-C-T *
10866750-T-G *
10866731-CGA-C *
10767743-C-T FT430336 *
10788518-T-G *
10767758-T-C *
10767761-C-CACTAA *
10768565-ACT-A *
10768568-G-GCA *
10778224-T-A *
10778225-G-A *
10784110-AT-A *
10784115-T-TA *
10787797-C-A *
10788508-T-A *
10788517-T-A *
10790977-T-G *
10852731-T-TTCAACTCTACTCCTC *
10799667-T-A *
10826570-ATT-A *
10826573-CCATTCCATTCCATTTCAT-C *
10826605-A-G *
10826610-ATTCC-A *
10826618-CA-C *
10828709-T-C *
10831342-G-A *
10842343-A-T *
10846887-C-CAACTA *
10846897-T-A *
13374252-G-A 11218576-G-A *
13466214-G-C 11310538-G-C *
13374144-T-C 11218468-T-C *
4672538-G-A 4804497-G-A *
13556170-C-T 11400494-C-T *
13332029-G-T 11176353-G-T *
13566572-G-T 11410896-G-T *
22288627-A-G 20126741-A-G DYZ19 *
22288634-G-T 20126748-G-T DYZ19 *
22288646-T-G 20126760-T-G DYZ19 *
3429910-G-A 3561869-G-A *
4423843-G-C 4555802-G-C *
4428202-A-T 4560161-A-T *
4439184-C-T 4571143-C-T *
4439268-G-A 4571227-G-A *
5592218-G-A 5724177-G-A FTB16631 *
58854652-C-G 56736219-G-C *
6101704-T-A 6233663-T-A *
6402211-T-G 6534170-T-G *
6403139-A-G 6535098-A-G *
9909528-G-A 10071919-G-A Y*
9930253-G-A 10092644-G-A Y*
9930307-A-T 10092698-A-T Y*
9933423-G-A 10095814-G-A Y*
9941770-T-C 10104161-T-C Y*
9943551-G-A 10105942-G-A Y*
9943574-A-C 10105965-A-C Y*
9944872-G-C 10107263-G-C Y*
13472643-C-T 11316967-C-T FGC19510 *
13505192-C-T 11349516-C-T *
9954979-G-A 10117370-G-A Y*
9983966-G-A 10146357-G-A Y*
58909602-A-G 56681269-T-C FGC77536 *
59006268-A-T 56860121-A-T *
59006272-C-T 56860125-C-T *
59017791-ATATATATGAG-A 56871644-ATATATATGAG-A *
59027107-C-A 56880960-C-A *
22479390-G-C 20317504-G-C DYZ19 *
13542862-A-G 11387186-A-G *
22288370-T-C 20126484-T-C DYZ19 *
22510831-A-C 20348945-A-C DYZ19 *
13488401-G-T 11332725-G-T BY86207 *
13705110-T-A 11549434-T-A *
13487475-G-T 11331799-G-T *
13505190-G-T 11349514-G-T *
13472071-A-T 11316395-A-T *
58868930-T-C 56721941-A-G *
13370417-G-C 11214741-G-C *
13370465-C-A 11214789-C-A *
28529232-C-CA 26383085-C-CA 23×A*
13488488-G-A 11332812-G-A *
10045220-A-C 10207611-A-C *
10045238-T-A 10207629-T-A *
13489709-C-T 11334033-C-T *
13698978-A-T 11543302-A-T *
13476700-G-A 11321024-G-A *
9951686-A-G 10114077-A-G Y*
9955005-G-T 10117396-G-T Y*
58869341-T-C 56721530-A-G *
13285559-C-A 11129883-C-A *
13136703-G-A 10626189-G-A *
13195038-A-T 11039362-A-T FGC8413 F4852 *
13240412-C-T 11084736-C-T *
13242304-T-G 11086628-T-G *
13251673-T-C 11095997-T-C *
13253212-T-C 11097536-T-C *
13257437-A-G 11101761-A-G *
13264154-C-A 11108478-C-A *
13264180-G-A 11108504-G-A *
13267472-G-GGT 11111796-G-GGT *
13276145-A-G 11120469-A-G *
13295858-C-T 11140182-C-T *
10061591-T-A 10223982-T-A *
13295860-C-T 11140184-C-T FTB2033 *
13297284-G-T 11141608-G-T *
13298592-C-T 11142916-C-T *
13332090-C-T 11176414-C-T *
13332167-C-T 11176491-C-T *
13339022-T-A 11183346-T-A *
13339039-A-G 11183363-A-G *
13370269-C-A 11214593-C-A *
13374043-A-G 11218367-A-G *
13374134-C-T 11218458-C-T *
13378345-G-C 11222669-G-C *
10092999-T-G 10255390-T-G Z27495 *
10061586-C-A 10223977-C-A *
9955971-G-T 10118362-G-T MF2198 Y*
10013086-A-C 10175477-A-C Z27242 Y*
9960356-T-C 10122747-T-C Y*
9964884-G-T 10127275-G-T Y*
9965951-T-C 10128342-T-C Y*
9965955-G-C 10128346-G-C FT426643 Y*
9966073-C-A 10128464-C-A Y*
9977485-T-C 10139876-T-C Y*
9980403-C-A 10142794-C-A Y*
9994793-G-A 10157184-G-A Y*
9997459-T-TTTA 10159850-T-TTTA *
10005997-A-T 10168388-A-T A10369 Y*
10006006-G-T 10168397-G-T A10370 Y*
10014844-G-T 10177235-G-T Y*
10061547-C-A 10223938-C-A *
10014859-A-G 10177250-A-G Y*
10014880-C-A 10177271-C-A Y*
10022206-G-T 10184597-G-T Y*
10042291-G-C 10204682-G-C *
10042306-C-A 10204697-C-A *
10042616-A-G 10205007-A-G *
10045572-A-C 10207963-A-C *
10055575-G-A 10217966-G-A FTA2784 *
10061251-G-A 10223642-G-A *
10061276-G-A 10223667-G-A FT427052 *
10061323-G-A 10223714-G-A *
10061483-A-T 10223874-A-T *
58906775-A-G 56684096-T-C *
58854637-C-G 56736234-G-C *
13382874-G-A 11227198-G-A *
13527052-A-C 11371376-A-C *
13517162-G-A 11361486-G-A *
13518204-A-G 11362528-A-G *
13518490-G-C 11362814-G-C FGC281 Y133723 *
13518879-C-G 11363203-C-G *
13520279-A-C 11364603-A-C *
13520293-G-A 11364617-G-A *
13520387-G-T 11364711-G-T FGC80360 *
13520396-A-T 11364720-A-T *
13521212-A-G 11365536-A-G *
13524548-T-G 11368872-T-G *
13526952-A-C 11371276-A-C *
13529581-C-A 11373905-C-A *
13516928-T-C 11361252-T-C *
13530029-T-C 11374353-T-C *
13530165-T-C 11374489-T-C *
13531259-G-A 11375583-G-A Z14579 *
13531346-T-A 11375670-T-A *
13532774-A-G 11377098-A-G *
13533845-A-G 11378169-A-G *
13538006-A-G 11382330-A-G *
13538350-C-A 11382674-C-A *
13538367-A-G 11382691-A-G *
13541520-C-T 11385844-C-T *
13544327-C-A 11388651-C-A *
13517022-T-A 11361346-T-A *
13516886-A-G 11361210-A-G *
13544547-G-A 11388871-G-A *
13503524-T-TAC 11347848-T-TAC *
13499061-G-A 11343385-G-A *
13500208-A-G 11344532-A-G *
13500344-C-T 11344668-C-T *
13500366-A-T 11344690-A-T *
13500391-G-A 11344715-G-A *
13501038-C-CT 11345362-C-CT *
13501471-A-G 11345795-A-G *
13501793-A-T 11346117-A-T *
13501800-T-A 11346124-T-A *
13501850-C-G 11346174-C-G *
13502954-G-T 11347278-G-T *
13503526-T-C 11347850-T-C *
13516825-C-T 11361149-C-T *
13506170-T-A 11350494-T-A *
13506387-T-A 11350711-T-A *
13507536-A-C 11351860-A-C *
13507808-A-G 11352132-A-G *
13511050-G-C 11355374-G-C BY184365 *
13511876-T-A 11356200-T-A *
13512623-A-G 11356947-A-G *
13515650-AG-A 11359974-AG-A *
13515684-A-AG 11360008-A-AG *
13516255-G-A 11360579-G-A *
13516266-A-C 11360590-A-C *
13544546-T-C 11388870-T-C *
13544680-T-C 11389004-T-C *
28810132-T-C 26663985-T-C *
13641174-C-T 11485498-C-T FT189934 *
13573622-C-T 11417946-C-T *
13573795-T-A 11418119-T-A *
13576799-A-G 11421123-A-G *
13600537-T-C 11444861-T-C *
13622184-G-T 11466508-G-T *
13622191-C-T 11466515-C-T *
13622243-TA-T 11466567-TA-T *
13634919-A-T 11479243-A-T *
13640613-A-C 11484937-A-C *
13640645-T-C 11484969-T-C *
13640780-T-A 11485104-T-A *
13641177-T-C 11485501-T-C *
13571598-T-A 11415922-T-A *
13690832-G-A 11535156-G-A *
16027144-T-G 13915264-T-G Y*
22442221-G-C 20280335-G-C BY219071 DYZ19 *
28549927-A-G 26403780-A-G *
28585927-T-G 26439780-T-G CTS12413 *
28586366-T-C 26440219-T-C *
28586399-C-T 26440252-C-T *
28586429-T-C 26440282-T-C *
28586464-T-C 26440317-T-C *
28588044-C-G 26441897-C-G *
28804848-G-A 26658701-G-A A14399 *
13573618-T-C 11417942-T-C *
13570023-A-G 11414347-A-G *
13545946-C-T 11390270-C-T *
13559785-T-C 11404109-T-C *
13549663-C-G 11393987-C-G *
13554559-A-T 11398883-A-T *
13554730-A-G 11399054-A-G *
13555848-G-T 11400172-G-T *
13555877-G-C 11400201-G-C *
13556416-C-A 11400740-C-A *
13557652-T-G 11401976-T-G *
13557668-C-A 11401992-C-A *
13557734-A-G 11402058-A-G *
13559115-G-A 11403439-G-A *
13559757-A-G 11404081-A-G *
13562208-C-G 11406532-C-G *
13569087-T-C 11413411-T-C *
13562335-C-T 11406659-C-T *
13562339-C-G 11406663-C-G *
13562405-T-C 11406729-T-C *
13562414-T-G 11406738-T-G *
13562597-T-A 11406921-T-A *
13562990-G-T 11407314-G-T *
13562993-T-A 11407317-T-A *
13563039-A-G 11407363-A-G *
13567214-A-C 11411538-A-C *
13567254-A-C 11411578-A-C *
13567313-A-T 11411637-A-T *
13567325-T-C 11411649-T-C *
13382811-G-A 11227135-G-A *
13383525-C-G 11227849-C-G FGC39086 *
13495116-T-G 11339440-T-G *
58903863-A-T 56687008-T-A *
28806428-A-T 26660281-A-T *
21906948-CT-C 19745062-CT-C 10×T*
13719768-C-T 11564092-C-T *
9952611-C-T 10115002-C-T Y*
9952643-C-T 10115034-C-T Y*
13473476-G-C 11317800-G-C S7364BY43112 *
13463320-C-T 11307644-C-T *
13136942-G-A 10626428-G-A *
58854600-T-C 56736271-A-G *
58854644-A-C 56736227-T-G *
58855399-A-G 56735472-T-C FGC82772 *
13472261-T-C 11316585-T-C *
13433737-G-A 11278061-G-A *
13488648-C-T 11332972-C-T *
58833807-C-G 56757064-G-C *
4964479-CGTGT-C 5096438-CGTGT-C 19×GT*
13480428-A-T 11324752-A-T *
10038731-T-C 10201122-T-C S13157 *
13479365-G-T 11323689-G-T *
9997296-T-G 10159687-T-G Y*
13463952-C-CCCTG 11308276-C-CCCTG *
13488292-C-T 11332616-C-T *
28802976-A-C 26656829-A-C *
13712288-G-C 11556612-G-C *
13489727-C-T 11334051-C-T *
13474772-C-A 11319096-C-A *
58916340-T-C 56674531-A-G *
59015542-T-G 56869395-T-G *
59009823-G-C 56863676-G-C *
59009845-A-ACCAG 56863698-A-ACCAG *
59010280-A-G 56864133-A-G FGC82657 *
59010417-A-G 56864270-A-G *
59011281-A-T 56865134-A-T *
59011347-A-C 56865200-A-C *
59011499-A-T 56865352-A-T *
59011768-A-T 56865621-A-T *
59012198-A-G 56866051-A-G *
59012211-G-A 56866064-G-A *
59012880-G-GGT 56866733-G-GGT *
59015606-C-T 56869459-C-T *
59032861-T-G 56886714-T-G *
59015764-G-C 56869617-G-C *
59017817-C-T 56871670-C-T *
59017965-G-A 56871818-G-A *
59018289-A-C 56872142-A-C *
59019670-T-C 56873523-T-C *
59021219-T-G 56875072-T-G *
59023962-C-A 56877815-C-A *
59026824-A-T 56880677-A-T *
59029184-C-T 56883037-C-T *
59029428-G-A 56883281-G-A *
59029638-G-A 56883491-G-A *
13611181-C-T 11455505-C-T *
58869801-C-G 56721070-G-C *
59008979-G-C 56862832-G-C *
10043014-G-T 10205405-G-T *
9964994-C-A 10127385-C-A Y*
13270121-CT-C 11114445-CT-C *
13399871-G-T 11244195-G-T *
13445510-T-C 11289834-T-C *
13445528-C-G 11289852-C-G *
13483376-C-T 11327700-C-T *
13500400-G-C 11344724-G-C *
13529985-G-C 11374309-G-C *
13559823-C-G 11404147-C-G *
13690167-G-A 11534491-G-A *
59026959-GATC-G 56880812-GATC-G *
58830428-C-G 56760443-G-C *
9944596-A-T 10106987-A-T Y*
13470627-C-G 11314951-C-G *
58862268-A-G 56728603-T-C *
58909657-C-T 56681214-G-A *
9296073-C-G 9458464-C-G Y*
13470443-G-T 11314767-G-T *
13489679-C-A 11334003-C-A *
58876968-T-C 56713903-A-G *
58855332-GCATTC-G 56735514-CAATGG-C 4×CATTC*
58854810-T-G 56736061-A-C *
13529716-C-T 11374040-C-T *
13489144-G-C 11333468-G-C *
9944628-G-A 10107019-G-A Y*
10042981-A-G 10205372-A-G *
58916324-T-C 56674547-A-G S3134 *
13489496-A-G 11333820-A-G *
13253199-GTT-G 11097523-GTT-G 14×T*
58854627-C-CCATTG 56736239-G-GAATGC *
10025135-G-A 10187526-G-A Y*
13473674-C-A 11317998-C-A *
10082045-T-TG 10244436-T-TG *
13524079-G-T 11368403-G-T *
13392324-C-G 11236648-C-G *
5587108-A-C 5719067-A-C A13692 *
58855381-T-A 56735490-A-T *
58893784-T-G 56697087-A-C *
13470495-G-T 11314819-G-T *
58854623-C-CATTCT 56736243-G-GGAATA *
9944617-CTT-C 10107008-CTT-C *
13461114-A-T 11305438-A-T *
9963288-T-A 10125679-T-A Y*
15543492-C-CA 13431612-C-CA 10×A*
9951729-A-T 10114120-A-T Y*
13379541-C-T 11223865-C-T *
13537696-G-A 11382020-G-A *
13464025-C-T 11308349-C-T *
9996952-T-G 10159343-T-G Y*
13298598-T-C 11142922-T-C *
13481042-T-C 11325366-T-C *
13465573-A-C 11309897-A-C *
22507724-C-G 20345838-C-G S3103 DYZ19 *
59009641-C-A 56863494-C-A *
59008974-G-A 56862827-G-A *
13383797-C-A 11228121-C-A *
13537778-C-G 11382102-C-G *
13517933-A-G 11362257-A-G *
13518329-G-A 11362653-G-A *
13519022-G-A 11363346-G-A *
13523219-A-G 11367543-A-G *
13523341-C-CG 11367665-C-CG *
13524108-C-T 11368432-C-T *
13526923-T-C 11371247-T-C *
13529319-C-G 11373643-C-G *
13529708-A-G 11374032-A-G *
13531312-A-G 11375636-A-G *
13537129-G-A 11381453-G-A *
13537792-A-G 11382116-A-G FGC87056 *
13513895-G-A 11358219-G-A *
13537967-C-T 11382291-C-T *
13538931-T-G 11383255-T-G *
13538934-T-C 11383258-T-C *
13539506-T-C 11383830-T-C *
13540744-A-C 11385068-A-C *
13549630-T-C 11393954-T-C *
13550252-T-A 11394576-T-A *
13557684-A-G 11402008-A-G *
13562095-G-C 11406419-G-C *
13562103-G-C 11406427-G-C *
13562223-A-G 11406547-A-G *
13517931-T-C 11362255-T-C *
13513709-C-T 11358033-C-T FT189831 *
13563074-A-G 11407398-A-G *
13491838-C-A 11336162-C-A FGC40720 *
13388804-C-T 11233128-C-T *
13410539-A-C 11254863-A-C *
13410560-C-A 11254884-C-A *
13418777-G-T 11263101-G-T *
13423766-T-G 11268090-T-G *
13427940-A-C 11272264-A-C *
13437129-G-A 11281453-G-A *
13449711-TTCCATTCC-T 11294035-TTCCATTCC-T *
13460499-A-G 11304823-A-G *
13473719-C-T 11318043-C-T *
13475435-G-A 11319759-G-A Z10462 *
13493016-G-T 11337340-G-T *
13513412-C-T 11357736-C-T *
13498378-T-A 11342702-T-A *
13498380-T-C 11342704-T-C *
13498417-T-C 11342741-T-C *
13500049-G-T 11344373-G-T *
13500139-C-T 11344463-C-T *
13501384-T-C 11345708-T-C *
13501528-A-T 11345852-A-T *
13502832-A-T 11347156-A-T *
13507807-G-A 11352131-G-A *
13508959-A-AT 11353283-A-AT *
13511060-C-G 11355384-C-G *
13512645-G-A 11356969-G-A *
13562936-A-G 11407260-A-G *
13563076-A-C 11407400-A-C *
59008918-C-T 56862771-C-T *
58999137-G-A 56852990-G-A *
28810099-C-T 26663952-C-T BY55614 *
28810122-T-C 26663975-T-C *
28812750-G-A 26666603-G-A BY48102 *
58854638-G-C 56736233-C-G *
58866388-C-T 56724483-G-A *
58885161-C-G 56705710-G-C *
58970515-C-T 56824368-C-T *
58970917-G-A 56824770-G-A *
58971404-T-G 56825257-T-G *
58995907-G-T 56849760-G-T *
58998387-A-G 56852240-A-G *
58999578-C-A 56853431-C-A *
28792786-C-A 26646639-C-A *
58999813-A-G 56853666-A-G *
59000699-G-A 56854552-G-A *
59002825-CAAA-C 56856678-CAAA-C *
59003880-C-T 56857733-C-T *
59005424-G-A 56859277-G-A *
59005514-T-C 56859367-T-C *
59005746-A-G 56859599-A-G *
59006260-A-G 56860113-A-G *
59006308-A-T 56860161-A-T *
59008339-G-A 56862192-G-A *
59008525-G-A 56862378-G-A *
28809782-G-C 26663635-G-C *
28792783-C-G 26646636-C-G *
13564408-G-C 11408732-G-C *
13695061-C-A 11539385-C-A *
13569797-T-A 11414121-T-A *
13571858-A-T 11416182-A-T *
13586733-A-T 11431057-A-T *
13591269-G-A 11435593-G-A *
13600446-G-A 11444770-G-A *
13611770-T-C 11456094-T-C *
13641061-T-C 11485385-T-C *
13688901-G-C 11533225-G-C *
13690973-T-C 11535297-T-C *
13692703-T-C 11537027-T-C *
13694652-G-A 11538976-G-A *
13706853-G-A 11551177-G-A *
28582781-A-C 26436634-A-C *
13711891-A-G 11556215-A-G *
13711897-T-C 11556221-T-C *
13712053-G-A 11556377-G-A *
13714287-A-T 11558611-A-T *
13722901-T-A 11567225-T-A *
13820954-G-A 11700248-G-A BY90543 *
13827951-G-A 11707245-G-A FT328571 *
14753780-C-T 12641849-C-T YY*
18785652-G-A 16673772-G-A YY*
21998963-GT-G 19837077-GT-G 11×T*
22361859-G-A 20199973-G-A FGC57796 DYZ19 *
22509045-C-A 20347159-C-A DYZ19 *
13495259-T-G 11339583-T-G *
13495092-A-G 11339416-A-G *
13476787-T-G 11321111-T-G *
13294840-A-T 11139164-A-T *
9951786-G-C 10114177-G-C Y*
13253705-T-C 11098029-T-C *
58836372-T-A 56754499-A-T *
13531720-C-T 11376044-C-T *
13475663-G-A 11319987-G-A *
13475674-C-T 11319998-C-T *
13475686-G-T 11320010-G-T *
13488459-A-T 11332783-A-T *
10022318-A-AAATAAATG 10184709-A-AAATAAATG *
13346090-G-A 11190414-G-A *
9432609-T-C 9595000-T-C Y*
13488203-G-T 11332527-G-T *
13484968-T-C 11329292-T-C *
13481732-G-C 11326056-G-C *
13481723-A-C 11326047-A-C *
13256206-G-A 11100530-G-A FGC29766 *
19025729-G-T 16913849-G-T Y*
13484778-C-T 11329102-C-T *
13253694-T-C 11098018-T-C *
13253708-A-T 11098032-A-T *
13253724-T-G 11098048-T-G *
13253729-C-A 11098053-C-A *
13253741-G-T 11098065-G-T *
9439924-CAT-C 9602315-CAT-C FGC11975Z18105 *
23036678-C-CA 20874792-C-CA 21×A*
9952699-G-A 10115090-G-A Y*
13562246-T-C 11406570-T-C *
13475767-A-T 11320091-A-T *
13519831-A-T 11364155-A-T *
13515340-G-T 11359664-G-T *
13467393-C-G 11311717-C-G *
13562893-A-G 11407217-A-G *
23825066-T-A 21663180-T-A FGC77602 Y*
58856239-T-C 56734632-A-G *
13484790-A-T 11329114-A-T *
13465453-A-G 11309777-A-G *
22364693-C-T 20202807-C-T DYZ19 *
24488662-T-A 22342515-T-A *
13253161-G-A 11097485-G-A *
13475703-G-A 11320027-G-A *
13494555-AT-A 11338879-AT-A 13×T*
13253192-C-T 11097516-C-T *
13353839-G-T 11198163-G-T *
13353856-A-G 11198180-A-G *
3933444-CAT-C 4065403-CAT-C *
13353871-GAC-G 11198195-GAC-G *
58856304-T-G 56734567-A-C *
22479566-A-G 20317680-A-G ZS11754 DYZ19 *
17750199-CT-C 15638319-CT-C 11×T*
13421461-G-A 11265785-G-A *
13440112-A-T 11284436-A-T *
9952720-A-T 10115111-A-T Y*
13516726-G-A 11361050-G-A *
58843384-T-G 56747487-A-C *
13292569-A-G 11136893-A-G *
13252766-C-T 11097090-C-T *
13488186-G-T 11332510-G-T *
13488187-C-T 11332511-C-T *
28805271-A-T 26659124-A-T *
13709229-T-A 11553553-T-A *
13282620-A-C 11126944-A-C *
13500242-G-A 11344566-G-A *
13467602-T-A 11311926-T-A *
13500058-A-G 11344382-A-G *
58844820-G-C 56746051-C-G *
13798915-A-G 11678209-A-G *
4819107-C-A 4951066-C-A *
13473507-G-T 11317831-G-T *
9188597-T-A 9350988-T-A Y*
13531507-A-G 11375831-A-G F10891 *
13373437-T-C 11217761-T-C *
13256015-C-T 11100339-C-T *
13509288-C-T 11353612-C-T *
13526375-T-G 11370699-T-G *
13526417-G-T 11370741-G-T *
13558114-T-A 11402438-T-A *
13558604-A-G 11402928-A-G *
13868476-GACTCA-G 11747770-GACTCA-G *
22442215-T-C 20280329-T-C S27566 DYZ19 *
13485845-A-T 11330169-A-T *
13463289-G-T 11307613-G-T *
13136965-T-C 10626451-T-C *
13531771-AAAAAAC-A 11376095-AAAAAAC-A *
13538021-G-A 11382345-G-A *
28808683-T-C 26662536-T-C *
13419933-A-G 11264257-A-G FGC23709 *
58843385-G-A 56747486-C-T *
13245854-G-A 11090178-G-A *
58855842-T-A 56735029-A-T *
13386163-G-A 11230487-G-A *
13382843-T-G 11227167-T-G *
13386168-T-A 11230492-T-A *
13379939-G-C 11224263-G-C *
22424911-A-G 20263025-A-G DYZ19 *
13493079-C-G 11337403-C-G *
13538024-T-C 11382348-T-C *
13472300-A-G 11316624-A-G S14074 *
13541566-T-C 11385890-T-C *
13541584-C-G 11385908-C-G *
13566543-T-G 11410867-T-G *
22249791-T-C 20087905-T-C DYZ19 *
58833312-C-G 56757559-G-C *
58833324-A-G 56757547-T-C *
13488134-A-G 11332458-A-G *
13488148-A-G 11332472-A-G *
13723397-G-A 11567721-G-A *
10038681-A-G 10201072-A-G *
13488044-C-A 11332368-C-A *
13717075-G-T 11561399-G-T *
9951677-A-G 10114068-A-G Y*
13475717-C-T 11320041-C-T *
9951713-C-T 10114104-C-T Y*
13487543-T-C 11331867-T-C *
13479531-T-A 11323855-T-A *
28804299-A-T 26658152-A-T KMS13 *
13478433-G-T 11322757-G-T *
13483957-G-A 11328281-G-A *
10005856-A-T 10168247-A-T Y*
10005878-GA-G 10168269-GA-G *
10005883-A-T 10168274-A-T Y*
13472116-C-T 11316440-C-T *
13480156-C-G 11324480-C-G *
13482818-A-C 11327142-A-C *
13487537-A-C 11331861-A-C *
13523053-G-A 11367377-G-A *
13455110-T-A 11299434-T-A *
13700609-T-C,G 11544933-T-C,G *
22423729-T-C 20261843-T-C FGC58229 DYZ19 *
28808749-A-T 26662602-A-T PF1351 *
28808785-A-G 26662638-A-G PF1352 *
13709254-T-A 11553578-T-A BY48800 *
13694217-G-A 11538541-G-A *
13550800-T-C 11395124-T-C *
13550801-G-A 11395125-G-A *
13447598-G-C 11291922-G-C *
13489763-C-T 11334087-C-T *
13465566-G-A 11309890-G-A *
13511019-T-G 11355343-T-G *
13723422-G-A 11567746-G-A *
13482882-C-A 11327206-C-A *
28800264-A-G 26654117-A-G *
13688450-A-T 11532774-A-T *
13694195-T-A 11538519-T-A *
13447579-CATTGT-C 11291903-CATTGT-C *
13692194-A-T 11536518-A-T *
6010403-A-C 6142362-A-C PF166 *
13477327-G-A 11321651-G-A *
9980142-C-A 10142533-C-A Y*
22489867-T-A 20327981-T-A DYZ19 *
13706283-C-T 11550607-C-T *
13507393-C-T 11351717-C-T *
28795928-T-A 26649781-T-A *
28806849-G-T 26660702-G-T *
28804283-G-T 26658136-G-T KMS167 *
22458111-A-G 20296225-A-G DYZ19 *
13507402-A-G 11351726-A-G *
28795901-G-C 26649754-G-C *
13447601-A-T 11291925-A-T *
13488138-G-A 11332462-G-A *
13488176-A-G 11332500-A-G *
13827275-T-A 11706569-T-A *
13714226-A-T 11558550-A-T *
9986844-A-G 10149235-A-G Y*
13447603-G-C 11291927-G-C *
28804277-T-G 26658130-T-G BY15999BY24943 *
13478524-C-T 11322848-C-T *
13482911-A-C 11327235-A-C *
13378120-C-T 11222444-C-T *
13484795-T-C 11329119-T-C *
13137007-A-C 10626493-A-C *
14358235-A-G 12237530-A-G CTS2546 M1342 YY*
22484037-A-C 20322151-A-C DYZ19 *
10025140-C-T 10187531-C-T Y*
13469904-G-T 11314228-G-T *
58843030-GATTCCATTCCATTCT-G 56747815-AGGAATGGAATAGAAT-A *
58893596-C-G 56697275-G-C *
13465310-T-C 11309634-T-C A18084 *
13488215-C-G 11332539-C-G *
28784223-G-A 26638076-G-A *
13723383-A-T 11567707-A-T *
13257337-C-T 11101661-C-T *
22507508-T-A 20345622-T-A DYZ19 *
13374277-G-C 11218601-G-C 13×A*
9340831-A-AACAC 9503222-A-AACAC 22×AC*
13507416-C-A 11351740-C-A *
9945050-C-A 10107441-C-A Y*
13428793-C-T 11273117-C-T *
9963199-A-G 10125590-A-G Y*
9992791-T-C 10155182-T-C Y*
13460490-T-A 11304814-T-A *
13505201-T-G 11349525-T-G *
13475702-C-T 11320026-C-T *
13378119-G-C 11222443-G-C *
13137003-A-C 10626489-A-C *
18139822-C-T 16027942-C-T CTS8670 Y*
58854641-G-T 56736230-C-A *
13479273-CG-C 11323597-CG-C *
13714218-A-C 11558542-A-C *
13469902-C-A 11314226-C-A *
13600598-T-C 11444922-T-C *
22510756-A-T 20348870-A-T DYZ19 *
13650592-T-C 11494916-T-C *
9988071-C-G 10150462-C-G Y*
13648009-C-T 11492333-C-T *
13486018-T-C 11330342-T-C *
9351151-C-CAT 9513542-C-CAT 21×AT*
13466497-C-T 11310821-C-T *
14429405-T-TTA,TTATA 12308680-T-TTATA,TTATATA 15×TA*
28808638-T-C 26662491-T-C *
28755152-C-T 26609005-C-T CTS12937 Y*
13693513-C-T 11537837-C-T *
13463363-T-C 11307687-T-C *
9988101-A-T 10150492-A-T Y*
13273545-C-T 11117869-C-T *
13294872-A-T 11139196-A-T *
13294920-C-CCTTTT 11139244-C-CCTTTT *
13301691-C-T 11146015-C-T *
13301700-T-C 11146024-T-C *
22512764-G-C 20350878-G-C DYZ19 *
28804929-G-C 26658782-G-C BY2555 *
28808818-A-G 26662671-A-G BY23331 *
10031414-T-C 10193805-T-C Y*
22288356-C-A 20126470-C-A DYZ19 *
9951765-T-A 10114156-T-A Y*
13495077-T-C 11339401-T-C *
13270025-G-A 11114349-G-A *
13243953-A-G 11088277-A-G *
13243978-T-G 11088302-T-G *
13244468-AG-A 11088792-AG-A *
13245806-T-C 11090130-T-C ZS170 *
13252190-A-G 11096514-A-G *
13255029-C-T 11099353-C-T *
13259808-G-C 11104132-G-C *
13261739-C-T 11106063-C-T *
13264031-T-G 11108355-T-G *
13269070-G-A 11113394-G-A *
13269866-C-A 11114190-C-A *
13270032-C-T 11114356-C-T FT240956FT263003 *
13243290-T-A 11087614-T-A *
13270083-C-T 11114407-C-T *
13274061-C-A 11118385-C-A *
13278488-G-C 11122812-G-C *
13278499-A-T 11122823-A-T *
13280464-C-A 11124788-C-A FT108578 *
13282709-G-A 11127033-G-A *
13284814-C-T 11129138-C-T *
13284990-G-A 11129314-G-A FT442292 *
13285142-G-T 11129466-G-T *
13287961-T-A 11132285-T-A *
13287973-A-C 11132297-A-C *
13243793-T-C 11088117-T-C *
13242337-C-T 11086661-C-T *
13290509-T-C 11134833-T-C *
10042288-A-T 10204679-A-T *
9974102-T-A 10136493-T-A Y*
9995862-G-A 10158253-G-A Y*
9995876-G-A 10158267-G-A Y*
9996875-C-T 10159266-C-T Y*
9996920-T-G 10159311-T-G Y*
9997082-C-A 10159473-C-A Y*
9997125-TA-T 10159516-TA-T *
10005992-G-A 10168383-G-A Y*
10006033-T-G 10168424-T-G Y*
10006250-C-T 10168641-C-T Y*
10033862-A-G 10196253-A-G Z11986 Z40374 Y*
10043064-C-T 10205455-C-T *
13240388-C-T 11084712-C-T *
10045142-A-C 10207533-A-C *
10045191-T-A 10207582-T-A *
10045243-T-G 10207634-T-G FT426896 *
10045456-C-G 10207847-C-G *
10045466-C-G 10207857-C-G *
10055473-T-A 10217864-T-A *
10061475-C-A 10223866-C-A *
10093217-G-T 10255608-G-T *
10093259-G-A 10255650-G-A FT91461 *
10093273-G-A 10255664-G-A *
13195252-G-T 11039576-G-T *
13287975-A-C 11132299-A-C *
13290616-T-A 11134940-T-A *
9964862-T-C 10127253-T-C Z8939 Y*
13440194-T-C 11284518-T-C *
13384381-A-T 11228705-A-T *
13386176-A-T 11230500-A-T *
13386219-C-T 11230543-C-T *
13388708-A-G 11233032-A-G *
13419641-C-T 11263965-C-T *
13423792-G-A 11268116-G-A *
13429055-C-A 11273379-C-A *
13436062-G-A 11280386-G-A *
13436191-T-G 11280515-T-G *
13439275-GT-G 11283599-GT-G *
13440146-C-T 11284470-C-T *
13440197-G-C 11284521-G-C *
13383638-C-G 11227962-C-G *
13440225-T-C 11284549-T-C *
13440270-C-A 11284594-C-A *
13440286-C-T 11284610-C-T *
13440310-T-C 11284634-T-C *
13442410-T-C 11286734-T-C FT443692 *
13442696-G-A 11287020-G-A *
13443303-G-A 11287627-G-A *
13443315-A-T 11287639-A-T *
13479634-C-G 11323958-C-G *
13479637-G-A 11323961-G-A *
13480875-G-A 11325199-G-A *
13383653-A-T 11227977-A-T *
13383604-C-A 11227928-C-A *
13290630-A-C 11134954-A-C *
13313238-G-T 11157562-G-T *
13290645-G-T 11134969-G-T *
13290692-G-C 11135016-G-C *
13291824-T-C 11136148-T-C *
13292600-C-T 11136924-C-T *
13294211-C-T 11138535-C-T *
13295933-T-A 11140257-T-A *
13295949-T-A 11140273-T-A *
13296390-A-G 11140714-A-G *
13298736-G-T 11143060-G-T ZS737 *
13308716-G-T 11153040-G-T *
13308717-C-T 11153041-C-T *
13313242-A-C 11157566-A-C PR1267 *
13383230-A-G 11227554-A-G *
13319692-C-T 11164016-C-T *
13338480-A-G 11182804-A-G *
13339813-C-T 11184137-C-T *
13354443-T-C 11198767-T-C *
13362149-C-A 11206473-C-A *
13373487-G-A 11217811-G-A *
13379763-G-C 11224087-G-C *
13379781-G-A 11224105-G-A *
13379846-T-A 11224170-T-A *
13382963-G-A 11227287-G-A *
13382987-C-T 11227311-C-T *
13383047-C-T 11227371-C-T *
9965784-G-C 10128175-G-C Y*
9960332-A-C 10122723-A-C Y*
13443238-G-T 11287562-G-T *
6011314-T-C 6143273-T-C FGC41377 *
13485254-C-T 11329578-C-T *
13464098-G-T 11308422-G-T *
9957933-C-G 10120324-C-G Y*
13428727-A-C 11273051-A-C *
13428740-A-T 11273064-A-T *
13428747-G-A 11273071-G-A *
13258700-A-G 11103024-A-G *
13434969-A-T 11279293-A-T *
13556017-C-G 11400341-C-G *
13591259-C-T 11435583-C-T FGC78758 *
9930334-C-T 10092725-C-T Y*
13530026-A-G 11374350-A-G *
13308703-C-T 11153027-C-T *
13517206-T-A 11361530-T-A *
10022421-T-G 10184812-T-G Y*
13487791-T-C 11332115-T-C *
13506141-T-G 11350465-T-G *
13517191-G-C 11361515-G-C *
13531157-A-T 11375481-A-T *
13705644-T-C 11549968-T-C *
22512760-C-A 20350874-C-A DYZ19 *
13463776-G-T 11308100-G-T *
13489663-G-T 11333987-G-T *
13489724-C-A 11334048-C-A *
13243806-A-G 11088130-A-G *
13308710-G-T 11153034-G-T *
13254609-T-TGTGTG 11098933-T-TGTGTG *
58833803-G-C 56757068-C-G *
13245531-C-A 11089855-C-A *
4909318-G-C 5041277-G-C *
9944214-A-G 10106605-A-G Y*
9944218-C-T 10106609-C-T Y*
9944224-C-A 10106615-C-A Y*
13263999-T-C 11108323-T-C *
13444645-C-T 11288969-C-T *
13493046-C-A 11337370-C-A *
13518191-G-C 11362515-G-C *
13554532-G-A 11398856-G-A FTA37654 *
28588477-G-A 26442330-G-A *
58869182-G-A 56721689-C-T *
13517949-T-G 11362273-T-G *
13467450-G-T 11311774-G-T *
13489019-T-A 11333343-T-A *
9952698-T-C 10115089-T-C Y*
17245529-GAA-G 15133649-GAA-G 22×A*
22298619-T-G 20136733-T-G BY22932 DYZ19 *
9974347-CAAA-C 10136738-CAAA-C *
9963238-G-A 10125629-G-A Y*
13489725-C-A 11334049-C-A *
13489729-C-T 11334053-C-T *
58833894-A-T 56756977-T-A *
13256242-A-T 11100566-A-T *
13285180-C-T 11129504-C-T *
13709195-AGAATG-A 11553519-AGAATG-A 8×GAATG*
9983930-T-A 10146321-T-A Y*
9955981-T-G 10118372-T-G Y*
5630669-T-C 5762628-T-C *
4410776-T-A 4542735-T-A *
4416300-A-G 4548259-A-G *
4416473-A-T 4548432-A-T *
4416630-T-G 4548589-T-G *
4474593-G-A 4606552-G-A *
4548036-A-G 4679995-A-G *
5410823-A-G 5542782-A-G *
5497400-A-G 5629359-A-G *
5560056-G-A 5692015-G-A *
5567296-A-G 5699255-A-G *
5621287-C-T 5753246-C-T *
5653464-T-C 5785423-T-C FT93785 *
3478330-T-C 3610289-T-C *
6599422-C-G 6731381-C-G *
9930295-T-TG 10092686-T-TG *
9931548-G-A 10093939-G-A Y*
9934722-G-GA 10097113-G-GA *
9939159-G-A 10101550-G-A Y*
9939214-G-A 10101605-G-A Y*
9943512-G-A 10105903-G-A Y*
9945024-C-T 10107415-C-T Y*
9945028-T-C 10107419-T-C Y*
9951804-A-G 10114195-A-G Y*
9955964-A-C 10118355-A-C Y*
3547140-T-A 3679099-T-A 8×A*
3443228-T-C 3575187-T-C *
13285136-T-C 11129460-T-C *
9984482-C-A 10146873-C-A Y*
5474635-A-C 5606594-A-C FGC52898 *
13258031-A-C 11102355-A-C *
13507935-C-A 11352259-C-A *
13295870-G-C 11140194-G-C *
13507927-G-A 11352251-G-A *
13508957-T-C 11353281-T-C *
28791631-G-A 26645484-G-A Z27085 *
13295813-G-T 11140137-G-T *
9955949-A-C 10118340-A-C Y*
13529699-A-C 11374023-A-C *
13290707-G-A 11135031-G-A *
2988358-G-T 3120317-G-T *
3432581-C-A 3564540-C-A *
3035139-G-A 3167098-G-A *
3107155-A-T 3239114-A-T *
3145232-C-T 3277191-C-T FGC50875 *
3166904-T-C 3298863-T-C *
3166913-G-A 3298872-G-A *
3215068-T-A 3347027-T-A *
3413343-T-C 3545302-T-C *
3413894-C-A 3545853-C-A FTA35176 *
3426238-C-T 3558197-C-T *
3426961-C-T 3558920-C-T FT191387 *
3427557-A-G 3559516-A-G FGC81616 *
3432547-G-C 3564506-G-C *
13489152-G-A 11333476-G-A *
13804346-A-G 11683640-A-G *
13270225-A-G 11114549-A-G *
10930371-C-T *
56822142-G-GT,GTT 8×T*
13480798-A-T 11325122-A-T *
10927926-C-A *
13704934-C-G 11549258-C-G *
58872690-C-A 56718181-G-T *
13466452-G-A 11310776-G-A *
11020747-C-A *
10927911-T-C *
8314326-G-A 8446285-G-A YY*
13484444-G-A 11328768-G-A *
10930366-C-T *
28804325-A-ATGGAT 26658178-A-ATGGAT *
13707083-G-T 11551407-G-T *
10784098-T-C *
13473721-C-A 11318045-C-A *
56830294-A-ATTC *
56830296-T-TTA *
56871623-T-TAAAAAAA 9×A*
13478602-C-A 11322926-C-A *
10807354-C-G *
22446669-A-ATT 20284783-A-ATT DYZ19 *
10791031-T-C *
10753578-C-A *
13465395-C-A 11309719-C-A FT444002 *
58905471-C-A 56685400-G-T *
10753567-T-A *
56728054-A-C *
13468076-C-A 11312400-C-A *
13475629-G-C 11319953-G-C *
13550796-T-C 11395120-T-C *
28813787-T-G 26667640-T-G BY152177 *
13515301-C-A 11359625-C-A *
10811371-T-G *
10055539-C-T 10217930-C-T FGC41055 *
10930054-C-T *
13469365-C-A 11313689-C-A *
28796906-G-C 26650759-G-C *
58856329-C-T 56734542-G-A *
56854662-G-A *
13461895-C-A 11306219-C-A *
28764037-T-A 26617890-T-A *
10761504-A-T *
13472140-T-C 11316464-T-C *
10767765-C-T *
58843130-G-C 56747741-C-G *
10896135-C-A *
56830286-T-A *
10884974-TTCCACTTCACTGCAC-T *
13469447-A-T 11313771-A-T *
13469459-T-G 11313783-T-G *
13463802-C-G 11308126-C-G *
13696942-A-G 11541266-A-G *
13489354-G-A 11333678-G-A *
9967154-C-A 10129545-C-A Y*
10912471-A-C *
13462098-T-A,C 11306422-T-A,C *
10807506-GTTCCA-G *
10807346-A-T *
13461827-C-A 11306151-C-A *
13531498-GA-G 11375822-GA-G 10×A*
10954096-C-A *
56830205-T-TTCCACTCCAC,TTCCACTCCACTCCAC *
13482276-C-A 11326600-C-A *
13484934-C-A 11329258-C-A *
11021434-C-T *
13370136-G-T 11214460-G-T *
13489005-C-A 11333329-C-A *
9992712-G-C 10155103-G-C Y*
28785136-G-T 26638989-G-T *
13650586-A-T 11494910-A-T *
28810144-C-G 26663997-C-G FT462556 *
28810149-G-A 26664002-G-A *
28810158-G-A 26664011-G-A *
13488246-G-A 11332570-G-A *
13447728-C-T 11292052-C-T *
13463285-A-C 11307609-A-C *
56847351-T-C *
10950564-C-A *
13479007-G-C 11323331-G-C *
13479565-A-T 11323889-A-T *
13453502-T-G 11297826-T-G *
11001623-C-G *
13487820-T-A 11332144-T-A *
13469464-C-A 11313788-C-A *
13488625-T-G 11332949-T-G *
13489319-C-A 11333643-C-A *
13489345-G-T 11333669-G-T *
13354820-T-C 11199144-T-C FT38049 *
13460670-C-A 11304994-C-A *
13804345-C-A 11683639-C-A *
10880394-T-C *
11001611-T-C *
13494028-T-C 11338352-T-C *
9944075-G-T 10106466-G-T Y*
11656197-A-G *
14195801-A-G 12075095-A-G Y*
13411564-C-CA 11255888-C-CA 8×A*
11656202-C-A *
13695026-G-T 11539350-G-T *
13480257-T-C 11324581-T-C *
13622200-G-A 11466524-G-A *
22303581-T-C 20141695-T-C DYZ19 *
22303585-G-C 20141699-G-C DYZ19 *
3122678-C-T 3254637-C-T *
13688948-T-A 11533272-T-A *
28794794-T-G 26648647-T-G *
28794799-T-G 26648652-T-G *
13351728-A-G 11196052-A-G *
58883730-T-A 56707141-A-T *
10866502-C-T *
10964263-A-C *
10006044-T-C 10168435-T-C Y*
28812645-G-A 26666498-G-A *
13463767-G-A 11308091-G-A *
13461377-A-G 11305701-A-G *
10784106-C-T *
56734489-T-A *
56734494-C-A *
14097945-A-AT,ATT 11977239-A-AT,ATT 23×T*
13714336-G-A 11558660-G-A *
10784083-G-C *
10964264-C-T *
10930011-C-A *
10930013-C-G *
10930037-T-A *
10061329-A-T 10223720-A-T *
10930038-T-A *
10927884-C-A *
10952546-A-G *
13480230-G-A 11324554-G-A *
10952554-C-G *
13748275-A-T 11592599-A-T *
10815148-C-A *
13482607-C-A 11326931-C-A *
10801004-C-G *
10851078-T-A *
16548363-TAAA-T 14436483-TAAA-T 15×A*
10827937-T-G *
13557205-C-T 11401529-C-T *
13484928-A-T 11329252-A-T *
13489112-G-T 11333436-G-T *
10061334-A-G 10223725-A-G *
10061337-T-G 10223728-T-G *
10791035-A-T *
13263859-G-T 11108183-G-T *
10688241-A-C *
10688047-C-T *
10688048-T-C *
10081894-A-T 10244285-A-T *
13480233-G-T 11324557-G-T *
10658387-C-T *
13480799-C-A 11325123-C-A *
10658425-C-T *
13470499-C-A 11314823-C-A *
22449682-C-A 20287796-C-A DYZ19 *
13482919-A-T 11327243-A-T *
13489009-C-G 11333333-C-G *
10980566-C-T *
10980572-C-T *
13558138-C-A 11402462-C-A *
10069824-G-T 10232215-G-T *
13466302-T-A 11310626-T-A *
13462195-A-T 11306519-A-T *
10921170-C-T *
10925019-A-G *
9966120-AAAAT-A 10128511-AAAAT-A *
13484960-C-G 11329284-C-G *
10880384-T-C *
13260129-A-T 11104453-A-T *
13332044-G-T 11176368-G-T *
13421503-A-G 11265827-A-G *
13464990-T-A 11309314-T-A *
13466524-G-T 11310848-G-T *
13708897-A-C 11553221-A-C *
22509555-A-T 20347669-A-T DYZ19 *
28805688-G-C 26659541-G-C *
28805690-G-A 26659543-G-A *
58865917-C-T 56724954-G-A *
10964249-T-A *
4834245-T-TA,TAA 4966204-T-TA,TAA 23×A*
13636932-A-T 11481256-A-T *
5930901-C-T 6062860-C-T A3241 *
13690464-G-C 11534788-G-C BY48173 *
13697143-T-C 11541467-T-C *
58884103-C-T 56706768-G-A *
59004282-G-A 56858135-G-A *
13480148-C-G 11324472-C-G *
10836491-C-T FT433431 *
13314924-G-A 11159248-G-A *
13710557-G-A 11554881-G-A *
10936248-A-C *
13708061-C-A 11552385-C-A *
11017671-C-T *
9995971-T-G 10158362-T-G Y*
28814785-A-C 26668638-A-C *
10986826-C-A *
9984270-T-C 10146661-T-C Y*
13488276-C-G 11332600-C-G *
13488772-G-A 11333096-G-A *
10959000-C-G *
28806307-C-T 26660160-C-T *
28815032-C-A 26668885-C-A *
56861827-A-G *
28793764-T-A 26647617-T-A *
11006076-G-A *
11006080-T-A *
11006083-A-C *
6402987-T-C 6534946-T-C *
9984319-G-A 10146710-G-A FT373752 Y*
22508738-G-A 20346852-G-A DYZ19 *
9984331-A-G 10146722-A-G FT373753 Y*
9984372-A-C 10146763-A-C Y*
9984384-A-C 10146775-A-C Y*
9992037-T-C 10154428-T-C Y*
9992565-T-C 10154956-T-C Y*
9992567-C-T 10154958-C-T Y*
9997147-A-T 10159538-A-T Y*
13385035-T-A 11229359-T-A *
13385047-A-G 11229371-A-G *
13474297-A-G 11318621-A-G *
13503538-T-C 11347862-T-C *
13708052-G-A 11552376-G-A *
13464005-C-T 11308329-C-T *
11022171-C-T *
13463304-G-A 11307628-G-A *
59013635-T-A 56867488-T-A *
13516242-C-A 11360566-C-A *
13573600-G-A 11417924-G-A *
13573609-G-A 11417933-G-A *
13704614-G-T 11548938-G-T *
22512739-G-T 20350853-G-T DYZ19 *
23793876-T-C 21631990-T-C Y*
23793906-T-G 21632020-T-G Y*
58882187-C-A 56708684-G-T *
58882287-A-G 56708584-T-C *
58882301-T-G 56708570-A-C *
58882303-G-T 56708568-C-A *
6092948-CTTTTTTTT-C 6224907-CTTTTTTTT-C 39×T*
13484812-G-A 11329136-G-A *
6599473-GAA-G 6731432-GAA-G 9×A*
9967984-TGC-T 10130375-TGC-T *
9967987-TC-T 10130378-TC-T *
9980155-A-AT 10142546-A-AT *
10006143-AC-A 10168534-AC-A *
10006160-AG-A 10168551-AG-A *
10093297-A-AAG 10255688-A-AAG *
13463836-CGTT-C 11308160-CGTT-C *
13463956-C-CCCT 11308280-C-CCCT *
13465292-GAT-G 11309616-GAT-G *
13465298-T-TCC 11309622-T-TCC *
13484830-T-A 11329154-T-A *
13481864-T-A 11326188-T-A *
13472685-G-GAGAT 11317009-G-GAGAT *
13479081-G-T 11323405-G-T *
10069808-T-A 10232199-T-A *
10069813-C-A 10232204-C-A *
10069821-G-A 10232212-G-A *
10069826-A-T 10232217-A-T *
9965991-C-T 10128382-C-T Y*
13482516-G-T 11326840-G-T *
10692449-C-T *
8314398-C-T 8446357-C-T YY*
13461864-G-C 11306188-G-C *
13480824-A-T 11325148-A-T *
13465684-C-A 11310008-C-A *
13481075-C-T 11325399-C-T *
13481853-A-C 11326177-A-C *
10880383-A-T *
10942670-T-G *
9933393-C-G 10095784-C-G Y*
9963156-C-G 10125547-C-G Y*
10033835-G-A 10196226-G-A Y*
10033840-C-G 10196231-C-G Y*
10033841-C-T 10196232-C-T Y*
10033882-G-A 10196273-G-A Y*
10033888-T-C 10196279-T-C Y*
10056487-A-C 10218878-A-C *
13142819-C-G 10632305-C-G *
13472292-CCT-C 11316616-CCT-C *
13488733-GC-G 11333057-GC-G *
10800341-A-T *
9967977-G-A 10130368-G-A Y*
13442790-A-T 11287114-A-T *
13475847-C-T 11320171-C-T *
13475853-C-G 11320177-C-G *
10952533-TC-T *
13464468-C-G 11308792-C-G *
10045597-C-T 10207988-C-T FT225539 *
13479203-G-C 11323527-G-C *
13598839-C-T 11443163-C-T *
13466225-C-T 11310549-C-T *
13481835-T-C 11326159-T-C *
9940534-A-T 10102925-A-T Y*
9967979-C-A 10130370-C-A Y*
13489955-C-T 11334279-C-T *
10022267-C-T 10184658-C-T Y*
10022375-G-A 10184766-G-A Y*
10632315-G-C *
10632318-C-T *
10778213-C-A *
10828900-T-C *
10872553-T-C *
11017815-A-C FT183085 *
11026257-T-C FGC80881 *
13195271-T-C 11039595-T-C *
13251678-C-T 11096002-C-T *
13461796-G-C 11306120-G-C *
13467607-A-G 11311931-A-G *
13488945-C-CT 11333269-C-CT *
13476525-T-A 11320849-T-A *
13488954-C-CG 11333278-C-CG *
13489630-C-CAA 11333954-C-CAA *
13573602-CA-C 11417926-CA-C *
13573607-CT-C 11417931-CT-C *
23793923-T-TC 21632037-T-TC *
23793952-G-GT 21632066-G-GT *
28785490-TGAAGCGGACCAGAG-T 26639343-TGAAGCGGACCAGAG-T *
58856385-C-CCATTCCATTCGATTG 56734476-A-AAATGGAATGCAATCG *
59013639-T-TAAATA 56867492-T-TAAATA *
13466200-T-C 11310524-T-C *
13463146-C-T 11307470-C-T *
10852565-T-A *
13476536-G-T 11320860-G-T *
10626136-C-T *
28808651-A-T 26662504-A-T *
13476473-C-G 11320797-C-G *
13476477-G-T 11320801-G-T *
13206784-C-CAA,CAAA 11051108-C-CAA,CAAA 14×A*
13470590-C-G 11314914-C-G *
9799134-CA-C,CAA 9961525-CA-C,CAA 24×A*
13476612-G-T 11320936-G-T *
5288945-T-TAA 5420904-T-TAA 13×A*
13478611-A-G 11322935-A-G *
28813812-AGGAAT-A 26667665-AGGAAT-A 5×GGAAT*
13470577-T-C 11314901-T-C *
10069800-A-T 10232191-A-T *
10967895-T-C *
13470238-G-C 11314562-G-C *
9993019-G-A 10155410-G-A Y*
13489314-G-T 11333638-G-T *
10791039-C-A *
13473773-G-A 11318097-G-A *
13438321-G-T 11282645-G-T *
13696949-T-G 11541273-T-G *
13696950-C-G 11541274-C-G *
13711298-T-G 11555622-T-G *
13484970-T-C 11329294-T-C *
10828890-T-C *
13480851-G-A 11325175-G-A *
2955378-C-CAT 3087337-C-CAT 9×AT*
10831343-T-A *
10784066-A-T *
13470477-G-T 11314801-G-T *
13489106-C-T 11333430-C-T *
10828894-T-A *
10688254-C-G *
13699085-T-A 11543409-T-A *
14468196-A-G 12347465-A-G YY*
13709476-T-G 11553800-T-G *
9952607-G-T 10114998-G-T Y*
10777714-T-C *
13499311-T-C 11343635-T-C *
13499445-A-C 11343769-A-C *
13488693-C-T 11333017-C-T *
10952530-C-A *
10658381-T-C *
13488757-C-A 11333081-C-A *
13489608-C-G 11333932-C-G *
13489660-C-A 11333984-C-A *
56678188-G-A *
58905453-G-T 56685418-C-A *
13428056-G-A 11272380-G-A *
13428100-C-A 11272424-C-A *
13428113-T-C 11272437-T-C *
13515238-A-G 11359562-A-G *
13559651-A-G 11403975-A-G *
13464054-C-A 11308378-C-A BY32169 *
13562499-G-C 11406823-G-C *
13476735-C-A 11321059-C-A *
28812459-A-T 26666312-A-T *
10927879-C-T *
10930384-C-A *
13705858-G-A 11550182-G-A FT449117 *
13461700-A-G 11306024-A-G *
56674544-C-T *
13489083-G-A 11333407-G-A *
11018283-C-T *
13483401-C-G 11327725-C-G *
10952555-C-A *
13480942-C-A 11325266-C-A *
13470475-C-T 11314799-C-T *
10866756-C-T *
13499484-T-C 11343808-T-C *
10986832-C-T *
10967882-C-G *
10791029-C-A *
13472346-A-G 11316670-A-G *
13730286-A-G 11574610-A-G *
13464556-C-A 11308880-C-A *
10827932-A-G *
9952609-G-T 10115000-G-T Y*
13558743-G-A 11403067-G-A *
13598640-A-G 11442964-A-G *
13481861-C-A 11326185-C-A *
13709556-A-G 11553880-A-G *
13489818-G-A 11334142-G-A *
13489107-C-A 11333431-C-A *
13483914-C-T 11328238-C-T *
13463370-C-G 11307694-C-G *
13462665-C-G 11306989-C-G *
10987234-T-C *
13462030-C-T 11306354-C-T *
13464047-G-A 11308371-G-A *
13489909-G-A 11334233-G-A *
10766393-A-C *
6402240-C-A 6534199-C-A *
6402249-A-G 6534208-A-G *
10927886-T-A *
10828710-G-A *
13488738-G-T 11333062-G-T *
8531044-GAA-G 8663003-GAA-G 14×A*
13463365-G-C 11307689-G-C *
13469825-T-C 11314149-T-C *
9965224-G-A 10127615-G-A Y*
28812287-A-T 26666140-A-T *
13479585-G-T 11323909-G-T *
13494024-T-G 11338348-T-G *
13494054-G-C 11338378-G-C *
13494067-G-T 11338391-G-T FT444312 *
13494068-T-G 11338392-T-G *
13489039-G-T 11333363-G-T *
13489081-G-C 11333405-G-C *
11001619-C-T *
13488980-C-T 11333304-C-T *
13470060-G-C 11314384-G-C *
10836492-T-C *
13465553-G-T 11309877-G-T *
10880933-T-C *
10807612-T-G *
13465376-C-A 11309700-C-A *
13463330-T-A 11307654-T-A *
28811020-A-T 26664873-A-T *
28811021-A-G 26664874-A-G *
13476585-G-A 11320909-G-A *
56835618-C-T *
13470018-C-A 11314342-C-A *
13462651-C-A 11306975-C-A *
12288301-CT-C,CTT 19×T*
13472514-C-A 11316838-C-A *
10927896-T-C *
9967951-G-A 10130342-G-A FGC241 Y*
22509799-C-A 20347913-C-A FT90135 DYZ19 *
13461823-T-C 11306147-T-C *
13487772-C-A 11332096-C-A *
22361896-G-T 20200010-G-T DYZ19 *
13239531-G-A 11083855-G-A *
58868236-C-G 56722635-G-C *
58844636-C-A 56746235-G-T *
13465431-T-C 11309755-T-C *
13449759-CATTCT-C 11294083-CATTCT-C *
13485231-C-T 11329555-C-T BY86150 *
13857962-A-C 11737256-A-C *
13463665-G-T 11307989-G-T *
22512812-G-A 20350926-G-A BY225927 DYZ19 *
13463773-G-GT 11308097-G-GT *
58893461-A-G 56697410-T-C *
13463775-G-A 11308099-G-A FGC69115 *
58979606-A-T 56833459-A-T *
58893427-G-C 56697444-C-G *
5430808-C-CA 5562767-C-CA 25×A*
9959584-C-T 10121975-C-T Y*
13542956-AAAAC-A 11387280-AAAAC-A *
10022219-A-G 10184610-A-G Y*
13542945-AAAC-A 11387269-AAAC-A *
22361878-C-G 20199992-C-G DYZ19 *
7223194-C-CA 7355153-C-CA 22×A*
13449742-T-TAAACC 11294066-T-TAAACC *
59011368-G-A 56865221-G-A *
58855135-T-C 56735736-A-G *
58890174-T-C 56700697-A-G *
13348228-A-C 11192552-A-C *
28795913-TG-T 26649766-TG-T *
13523202-A-G 11367526-A-G *
22298474-A-T 20136588-A-T A4068 DYZ19 *
13351776-T-C 11196100-T-C *
7002998-G-T 7134957-G-T Y*
13463310-G-C 11307634-G-C *
13520001-A-C 11364325-A-C FGC82677 *
28813664-T-C 26667517-T-C BY188751 *
28583394-T-C 26437247-T-C CTS12373 *
10081895-G-T 10244286-G-T *
13348184-T-C 11192508-T-C *
13827234-G-A 11706528-G-A *
58836957-G-C 56753914-C-G *
13332172-T-C 11176496-T-C *
58868526-C-G 56722345-G-C *
13471231-C-T 11315555-C-T *
9967489-CCTGA-C 10129880-CCTGA-C *
10022394-T-C 10184785-T-C Y*
13489586-C-T 11333910-C-T *
13718788-A-T 11563112-A-T *
10025473-C-T 10187864-C-T Y*
13469829-C-T 11314153-C-T *
13489680-C-A 11334004-C-A *
58833835-T-C 56757036-A-G *
58857101-C-T 56733770-G-A *
58890180-A-G 56700691-T-C *
13466264-C-G 11310588-C-G *
13472103-C-A 11316427-C-A *
10771898-T-C *
13719788-A-G 11564112-A-G *
13463852-AG-A 11308176-AG-A *
10927883-C-G *
10969349-G-T *
13691820-AG-A 11536144-AG-A *
10930021-T-C *
13489597-C-A 11333921-C-A *
4067508-C-CT 4199467-C-CT 29×T*
13489773-C-A 11334097-C-A *
10898404-T-A *
13464466-G-T 11308790-G-T *
13571609-C-A 11415933-C-A *
13464486-C-G 11308810-C-G *
10651611-T-G *
10688084-A-C *
10941626-G-C *
11021436-C-A *
4976787-C-CA 5108746-C-CA 21×A*
10892572-C-T *
13488641-C-A 11332965-C-A *
13488653-C-A 11332977-C-A *
10930025-A-G *
10930033-C-G *
13383814-T-G 11228138-T-G *
13473862-C-A 11318186-C-A *
13491116-T-C 11335440-T-C FGC26046 *
13471704-CTGATACTGGATG-C 11316028-CTGATACTGGATG-C *
13396059-TTG-T 11240383-TTG-T *
13410351-AC-A 11254675-AC-A *
13501556-TGAA-T 11345880-TGAA-T *
22188682-AACAC-A,AAC 20026796-AACAC-A,AAC 23×AC*
13421471-C-G 11265795-C-G *
13421495-C-T 11265819-C-T *
13470556-G-T 11314880-G-T *
28691447-C-CA 26545300-C-CA 16×A*
13468338-GC-G 11312662-GC-G *
9986873-C-G 10149264-C-G Y*
28549459-C-A 26403312-C-A *
28549469-G-T 26403322-G-T *
13698997-G-C 11543321-G-C *
17913389-A-G 15801509-A-G CTS8278 YY*
13693461-A-G 11537785-A-G *
13469919-T-A 11314243-T-A *
9986828-C-T 10149219-C-T Y*
9944139-G-A 10106530-G-A Y*
28586459-A-T 26440312-A-T FGC72148 *
13488558-CGCG-C 11332882-CGCG-C *
58981699-T-C 56835552-T-C *
9962446-T-G 10124837-T-G Y*
58834188-C-T 56756683-G-A *
58916394-T-A 56674477-A-T *
9975414-C-G 10137805-C-G Y*
58843067-T-C 56747804-A-G *
58905084-T-C 56685787-A-G *
13489765-T-TCG 11334089-T-TCG *
13379472-G-A 11223796-G-A *
9975404-A-G 10137795-A-G Y*
13478262-G-A 11322586-G-A *
58880029-G-A 56710842-C-T *
58916381-C-T 56674490-G-A *
13256236-C-T 11100560-C-T *
28813686-A-C 26667539-A-C *
9183437-G-A 9345828-G-A Y*
13489678-C-T 11334002-C-T *
13511066-CA-C 11355390-CA-C 8×A*
13515666-C-A 11359990-C-A *
58916292-T-C 56674579-A-G *
13529074-T-A 11373398-T-A *
58836198-G-A 56754673-C-T *
13482910-A-G 11327234-A-G *
13442604-T-G 11286928-T-G *
13442607-A-G 11286931-A-G *
28812842-G-A 26666695-G-A FT462621 *
13711457-T-A 11555781-T-A *
58833749-A-G 56757122-T-C *
58882422-T-C 56708449-A-G *
58882444-T-G 56708427-A-C *
58893863-T-C 56697008-A-G *
58893894-G-C 56696977-C-G 4×CATTC*
13692605-T-A 11536929-T-A *
58836204-T-A 56754667-A-T *
58836197-C-A 56754674-G-T *
13711571-A-G 11555895-A-G *
13488170-C-A 11332494-C-A *
13465036-C-T 11309360-C-T *
13476596-G-A 11320920-G-A *
13465291-A-T 11309615-A-T *
13469820-G-A 11314144-G-A *
13488398-C-A 11332722-C-A *
13693301-A-T 11537625-A-T *
13650607-T-A 11494931-T-A *
28785998-G-A 26639851-G-A *
58980964-C-CTCCAT 56834817-C-CTCCAT *
9967475-A-G 10129866-A-G Y*
13257583-T-C 11101907-T-C FGC80358 *
13472741-G-A 11317065-G-A *
13712671-C-A,G 11556995-C-A,G *
9935117-G-A 10097508-G-A Y*
58912483-C-A 56678388-G-T *
13256044-GTT-G 11100368-GTT-G 12×T*
13463799-C-T 11308123-C-T *
13469493-C-A 11313817-C-A *
58916377-G-C 56674494-C-G *
13488159-G-C 11332483-G-C *
58893752-T-A 56697119-A-T *
13136902-T-A 10626388-T-A *
13136953-T-G 10626439-T-G *
13488169-G-A 11332493-G-A *
13689451-G-C 11533775-G-C *
13713048-C-A 11557372-C-A *
13142825-T-A 10632311-T-A *
13526461-C-T 11370785-C-T *
13518489-A-C 11362813-A-C *
13559638-A-G 11403962-A-G *
13559640-T-G 11403964-T-G *
13559726-C-T 11404050-C-T *
13559736-T-C 11404060-T-C *
13559741-A-C 11404065-A-C *
13559742-C-T 11404066-C-T *
13559743-A-C 11404067-A-C *
13562981-G-C 11407305-G-C *
19025744-G-A 16913864-G-A Y*
13362927-C-CT 11207251-C-CT 12×T*
13526462-C-G 11370786-C-G *
13464013-G-T 11308337-G-T *
13516698-A-G 11361022-A-G *
13517828-G-T 11362152-G-T FGC78252 *
13562436-C-A 11406760-C-A *
13598260-A-G 11442584-A-G *
13611755-C-G 11456079-C-G *
22510804-G-T 20348918-G-T DYZ19 *
58862798-G-A 56728073-C-T *
13489048-C-A 11333372-C-A *
58865894-A-T 56724977-T-A *
13142810-C-G 10632296-C-G *
13142820-A-G 10632306-A-G *
13518488-G-T 11362812-G-T *
13559625-T-A 11403949-T-A *
13713079-A-C 11557403-A-C *
13467289-C-T 11311613-C-T *
13748255-T-A 11592579-T-A *
13473884-T-G 11318208-T-G *
13482492-C-T 11326816-C-T BY38298 *
13485502-G-A 11329826-G-A *
13734212-G-T 11578536-G-T *
13348902-C-T 11193226-C-T *
4773481-C-CT 4905440-C-CT 25×T*
13857960-G-C 11737254-G-C *
10037661-A-G 10200052-A-G *
10037676-G-A 10200067-G-A *
10043186-C-T 10205577-C-T *
10022261-C-T 10184652-C-T Y*
9909154-T-A 10071545-T-A Y*
13471872-G-A 11316196-G-A *
13479378-T-A 11323702-T-A *
13565960-C-G 11410284-C-G BY86438 *
28804871-G-C 26658724-G-C BY157244 *
23013789-T-C 20851903-T-C YY*
13446099-A-T 11290423-A-T *
13488585-C-A 11332909-C-A *
58834192-G-C 56756679-C-G *
13696873-T-A 11541197-T-A *
13489167-T-A 11333491-T-A *
9952688-T-A 10115079-T-A Y*
13365945-G-A 11210269-G-A FGC61955 *
11018307-T-C *
10771852-A-C *
10671988-C-G *
13484488-G-A 11328812-G-A *
10661812-A-T *
10969331-A-C *
11033978-C-T *
2885071-G-GTT 3017030-G-GTT 13×T*
10980937-A-G *
18931131-GA-G 16819251-GA-G 10×A*
10688063-T-G *
13466317-A-T 11310641-A-T *
13484452-A-G 11328776-A-G *
13484469-G-A 11328793-G-A *
13484472-G-A 11328796-G-A *
10831328-C-T *
10826525-C-A *
13484449-G-A 11328773-G-A *
13567202-A-G 11411526-A-G *
11001615-G-A *
10987133-T-A *
13480429-G-A 11324753-G-A *
10987427-TC-T *
10898397-C-T *
10925027-G-A FT171787 *
10668343-T-TCAA *
13480400-G-T 11324724-G-T *
13223420-GAGGA-G 11067744-GAGGA-G *
13460803-G-C 11305127-G-C *
28804340-C-A 26658193-C-A *
13488973-T-G 11333297-T-G *
13515677-G-A 11360001-G-A *
13462226-G-T 11306550-G-T *
13468582-A-G 11312906-A-G *
13726299-C-G 11570623-C-G *
13726305-G-T 11570629-G-T *
9943708-C-A 10106099-C-A Y*
10688239-T-G *
10969310-C-A *
10761510-T-C *
11005116-AT-A *
13515671-T-C 11359995-T-C *
13515676-T-C 11360000-T-C *
10801006-A-T *
10947699-T-C *
10952516-ATTTCT-A *
13488934-T-C 11333258-T-C *
13518022-A-G 11362346-A-G *
23372219-CTT-C 21210333-CTT-C 13×T*
56833683-C-A *
13488940-T-A 11333264-T-A *
10753591-G-T *
10688050-C-G *
13488803-G-T 11333127-G-T *
10973674-A-T *
10791018-C-A *
10925361-C-T *
13466271-G-A 11310595-G-A *
16978999-G-GA 14867119-G-GA 14×A*
10807581-A-T *
10828886-T-C *
13487822-A-T 11332146-A-T *
13480413-A-G 11324737-A-G *
10893452-C-G *
10767755-C-A *
10866503-A-T *
11022173-C-A *
56860281-C-T *
56860285-G-A *
56860291-C-T *
56860301-T-C *
10980564-C-T *
56875026-C-T *
11001562-T-C *
11001588-A-G *
11006571-A-T *
11006572-A-G *
10843022-T-C *
21922080-CAA-C,CA 19760194-CAA-C,CA 23×A*
11001489-A-T *
13700588-T-A 11544912-T-A *
10952509-A-T *
10952510-C-A *
13700689-G-T 11545013-G-T *
59021174-A-G 56875027-A-G *
58912864-A-G 56678007-T-C *
13466275-G-C 11310599-G-C *
10759203-T-A *
10774729-C-T FT63708 *
10980942-G-A *
10980945-T-A *
10980949-G-C *
13711854-G-T 11556178-G-T *
13705117-G-T 11549441-G-T *
11030414-G-A *
13488837-G-T 11333161-G-T *
10936238-A-T *
10969307-T-G *
10759198-T-A *
13488244-C-A 11332568-C-A *
13463871-G-T 11308195-G-T *
10852566-C-T *
10967892-A-C *
10967896-C-T *
10807399-G-C *
13474575-A-C 11318899-A-C *
10866762-A-C *
13487878-T-C 11332202-T-C *
17913366-G-A 15801486-G-A FT405881 YY*
17913368-T-C 15801488-T-C YY*
10939317-C-A *
13483431-A-G 11327755-A-G *
13463866-G-A 11308190-G-A *
10759331-T-A *
9966108-G-A 10128499-G-A Y*
10771855-C-A *
10906233-G-C *
13566911-G-A 11411235-G-A *
56843631-C-A *
13488847-T-A 11333171-T-A *
10972970-C-T *
11001596-A-C *
10964145-G-T *
10964146-G-T *
13611188-C-A 11455512-C-A *
13489415-G-A 11333739-G-A *
13488579-C-T 11332903-C-T *
10999601-T-C *
13460470-G-T 11304794-G-T *
10950569-C-T *
10927901-T-C *
10954309-T-A *
13461360-C-T 11305684-C-T *
13461368-C-G 11305692-C-G *
10800342-T-C *
10999590-A-G *
13482621-G-T 11326945-G-T *
13482639-T-C 11326963-T-C *
10912824-G-C FT225516 *
13721034-A-G 11565358-A-G *
13712635-A-C 11556959-A-C *
13489810-G-A 11334134-G-A *
10950561-G-C *
13722055-G-C 11566379-G-C *
10093143-G-T 10255534-G-T FT427471 *
10771857-G-T *
10771877-A-G *
9930258-C-G 10092649-C-G Y*
10771907-A-T *
13453379-C-A 11297703-C-A *
7291082-CTT-C 7423041-CTT-C 13×T*
17604931-GTTTT-G 15493051-GTTTT-G 24×T*
10986788-A-T *
10767752-C-A *
13480431-C-A 11324755-C-A *
13465125-G-A 11309449-G-A *
10093159-C-G 10255550-C-G *
13478427-G-T 11322751-G-T *
10093160-G-T 10255551-G-T *
10093163-C-A 10255554-C-A *
10093185-A-ATAT 10255576-A-ATAT *
10093190-AAAAGAT-A 10255581-AAAAGAT-A *
10093200-T-TGTC 10255591-T-TGTC *
10093206-T-G 10255597-T-G *
10093207-T-A 10255598-T-A *
10093211-G-C 10255602-G-C *
13479628-C-G 11323952-C-G *
13480386-G-C 11324710-G-C *
13480396-A-T 11324720-A-T *
13478411-C-A 11322735-C-A *
10767724-T-G *
13487757-C-T 11332081-C-T *
11030419-T-G *
13279998-CAA-C 11124322-CAA-C 26×A*
28793772-T-C 26647625-T-C *
13483867-C-A 11328191-C-A *
13489633-CCA-C 11333957-CCA-C *
10827939-C-G *
17362452-AACAC-A 15250572-AACAC-A 11×AC*
13466262-GC-G 11310586-GC-G *
9952689-C-T 10115080-C-T Y*
13558135-G-A 11402459-G-A *
9952674-T-G 10115065-T-G Y*
13489698-T-A,G 11334022-T-A,G *
10774738-A-G *
13487782-C-G 11332106-C-G *
10950554-C-T *
13488721-T-A 11333045-T-A *
10900853-C-A *
13488932-G-C 11333256-G-C *
13461855-T-A 11306179-T-A *
13489006-C-A 11333330-C-A *
10925355-A-C *
14195790-G-A 12075084-G-A Y*
11034309-C-A *
10688249-C-A FT429075 *
10939304-C-T *
11030413-C-T *
13468079-G-T 11312403-G-T *
10952545-C-T *
13464428-C-T 11308752-C-T *
13487510-T-A 11331834-T-A *
14352416-G-T 12231711-G-T Y*
13697328-G-C 11541652-G-C *
9930338-T-G 10092729-T-G Y*
13730270-G-T 11574594-G-T *
13730271-A-T 11574595-A-T *
10927889-C-G *
11001563-C-G *
11025157-C-T *
10756094-C-T *
10930056-G-A *
13460476-C-A 11304800-C-A *
13726217-A-G 11570541-A-G *
10927881-T-C *
13499276-T-C 11343600-T-C *
10753614-AAATCC-A *
10820369-T-C *
10774754-T-C *
10841948-C-T *
10927891-T-C *
13461840-A-T 11306164-A-T *
13688238-A-AATGGT 11532562-A-AATGGT *
13462033-C-T 11306357-C-T *
13466326-A-C 11310650-A-C *
10827927-T-G *
10045560-G-A 10207951-G-A *
56886095-C-CAAAA 11×A*

In the table above, the meaning of the confidence field depends on whether the data comes from an FTDNA kit or an FGC kit. For FTDNA kits, + implies a "PASS" result with just one possible variant, * indicates a "PASS" but with multiple variants, ** indicates "REJECTED" with just a single variant, and *** indicates "REJECTED" with multiple possible variants. 'A*' are heterozygous variants not called by FTDNA, but still pulled from the VCF file. For FGC kits, + indicates over 99% likely genuine (95% for INDELs); * over 95% likely genuine (90% for INDELs); ** about 40% likely genuine; *** about 10% likely genuine. Manual entries read directly from a BAM file will be either + indicating positive, or * indicating that the data show a mixture of possible variants.

For the FTDNA kits, the BED data is encoded in the background color of the cells. Those cells with a white background have coverage, those with a grey background indicate no coverage in the BED file, and those with a pink background indicate the mutation is on the edge of a coverage region. These pink regions often indicate that the individual may be positive for a SNP even if there is no corresponding entry in the vcf file.

The combBED column indicates whether or not the mutation is a SNP and falls in the combBED region defined in Defining a New Rate Constant for Y-Chromosome SNPs based on Full Sequencing Data by Dmitry Adamov, Vladimir Guryanov, Sergey Karzhavin, Vladimir Tagankin, Vadim Urasin.

The McDonald BED column indicates whether or not the mutation is a SNP and falls in the BED region used by Dr. Iain McDonald in the age analysis he does for R-U106 men.

Age Analysis Information (work in progress)

AllMcDonaldYFull
Kit: 9883b7c8-7e1e-416556830103834408400397
Used in age calculations16556830103834408400397
Counts of SNPs43793
Variant counts last updated 2022-01-18 04:14:18.



Big Tree Main Page