Tree Position

R-P312/S116 > Z290 > L21/S145 > S552 > DF13 > DF21/S192 > Z30233 > FGC3903/S5201 > S5199 > Z246 > DF25 > DF5 > ZZ32 > CTS3655 > Z16539 > Z16540 > Z29571 > BY2690

Unique Mutations

The mutations unique to this man are summarized in the table below. Those with a '+' or '*' confidence level are considered by FamilyTreeDNA or FullGenomesCorp to be high quality SNPs/INDELs. For completeness, all other mutations of lesser confidence are included as well. These additional mutations may be useful for distinguishing between very closely related men.

Occasionally, some of the mutations listed here will be thought to be shared with other men in which case they might appear in upstream blocks on the tree. When this happens, the 'Blocks' field will indicate what block they appear in. Such a situation might arise with BigY men if the BED data suggests another man may be positive for a SNP, even though it doesn't appear in his VCF data. It might also happen if Chromo2 testing or Sanger sequencing of other men not on the tree show the SNP to be shared.

POS-REF-ALT (hg19) POS-REF-ALT (hg38) Blocks Names Region McDonald BED combBED STRBigY3
B783684
9509107-A-G 9671498-A-G A+
26045454-A-G 23899307-A-G P1_Y1 A*
19577267-G-GT 17465387-G-GT P5_Prx A*
19942826-A-T 17830946-A-T P5_Prx A*
19966477-T-G 17854597-T-G P5_Prx A*
20055577-C-T 17943697-C-T P5_Prx A*
6212144-G-A 6344103-G-A IR3_Dst A*
17481185-A-C 15369305-A-C YYA*
17994148-T-G 15882268-T-G P7_Prx YA*
25532381-G-T 23386234-G-T P1_gr1 A*
26057928-C-T 23911781-C-T P1_Y1 A*
59023602-G-A 56877455-G-A A*
26075212-G-T 23929065-G-T P1_Y1 A*
58992643-T-C 56846496-T-C A*
58988339-T-C 56842192-T-C A*
26288856-G-T 24142709-G-T P1_Y1 A*
26338079-G-A 24191932-G-A P1_Y1 A*
5932088-A-G 6064047-A-G A*
5378471-A-G 5510430-A-G A*
26467929-A-T 24321782-A-T P1_Y1 A*
9982503-C-T 10144894-C-T Y+
14295953-G-T 12175247-G-T FTB39936 YY+
14402826-G-T 12282123-G-T FT130821 YY+
15533802-A-G 13421922-A-G FT130985 YY+
16194025-T-C 14082145-T-C FTB40173 YY+
9146920-T-C 9309311-T-C M9051 Y+
21393732-T-G 19231846-T-G FTB40705 Y+
16204566-A-T 14092686-A-T FTB40174 YY+
16403492-T-C 14291612-T-C YY+
17578558-C-G 15466678-C-G FT131340 YY+
18820712-C-G 16708832-C-G FTB40518 YY+
22514074-G-A 20352188-G-A FT331954 Y+
23251193-C-T 21089307-C-T BY21979 YY+
23853744-A-G 21691858-A-G FTB40961 Y+
9146921-G-C 9309312-G-C BY38843M9052 Y+
7599537-A-C 7731496-A-C FTB39647 YY+
5252752-C-G 5384711-C-G +
5862539-C-CAT 5994498-C-CAT *
15799353-T-TTC 13687473-T-TTC 15×TC*
9429470-T-C 9591861-T-C Y*
56876113-A-G *
59018379-A-G 56872232-A-G *
13488643-A-T 11332967-A-T *
13535806-G-A 11380130-G-A *
23532817-A-ATG 21370931-A-ATG 10×TG*
25887320-G-T 23741173-G-T P1_Y1 **
3930563-G-GTA 4062522-G-GTA 21×TA**
22458740-A-T 20296854-A-T DYZ19 **
22437967-C-G 20276081-C-G DYZ19 **
20707140-C-A 18545254-C-A P4_Prx **
13222982-A-C 11067306-A-C **
25887313-G-T 23741166-G-T P1_Y1 **
25887253-C-A 23741106-C-A P1_Y1 **
14565187-C-T 12453387-C-T FT346370 **
26244879-C-A 24098732-C-A P1_Y1 **
28491072-T-C 26344925-T-C **
7174665-T-G 7306624-T-G ***
3428687-GATATATATAT-G 3560646-GATATATATAT-G 22×AT***
10992962-ACCATTCCATTCCATTCCATTCCATTCCATTCCATTCCATT-A ***
6024915-C-T 6156874-C-T ***
9640933-GTA-G,GTG 9803324-GTA-G,GTG IR3_Prx ***
10066135-CA-C,CAA 10228526-CA-C,CAA 11×A***
59026130-C-T 56879983-C-T ***
13452380-TCCATTCCATTCCATTCAAATACACTCCTTG-T,TCCATTCCATTCCAGTCAAATCCACTCCATT 11296704-TCCATTCCATTCCATTCAAATACACTCCTTG-T,TCCATTCCATTCCAGTCAAATCCACTCCATT ***
18982585-AAG-A,AAA 16870705-AAG-A,AAA ***
19500150-GTAGATAGA-G,GTAGA 17388270-GTAGATAGA-G,GTAGA 14×TAGA***
13923553-AAAAAAATAT-A,AAT 11802847-AAAAAAATAT-A,AAT ***
23425343-CAAA-C 21263457-CAAA-C 14×A***
22507515-C-G 20345629-C-G DYZ19 ***
6024929-C-CAT 6156888-C-CAT ***
23415308-GTATG-G,GTA 21253422-GTATG-G,GTA ***
10965565-A-AATCCATTGCT ***
10764612-TTCCAC-T ***
3259035-CAA-C,CAAA 3390994-CAA-C,CAAA 22×A***

In the table above, the meaning of the confidence field depends on whether the data comes from an FTDNA kit or an FGC kit. For FTDNA kits, + implies a "PASS" result with just one possible variant, * indicates a "PASS" but with multiple variants, ** indicates "REJECTED" with just a single variant, and *** indicates "REJECTED" with multiple possible variants. 'A*' are heterozygous variants not called by FTDNA, but still pulled from the VCF file. For FGC kits, + indicates over 99% likely genuine (95% for INDELs); * over 95% likely genuine (90% for INDELs); ** about 40% likely genuine; *** about 10% likely genuine. Manual entries read directly from a BAM file will be either + indicating positive, or * indicating that the data show a mixture of possible variants.

For the FTDNA kits, the BED data is encoded in the background color of the cells. Those cells with a white background have coverage, those with a grey background indicate no coverage in the BED file, and those with a pink background indicate the mutation is on the edge of a coverage region. These pink regions often indicate that the individual may be positive for a SNP even if there is no corresponding entry in the vcf file.

The combBED column indicates whether or not the mutation is a SNP and falls in the combBED region defined in Defining a New Rate Constant for Y-Chromosome SNPs based on Full Sequencing Data by Dmitry Adamov, Vladimir Guryanov, Sergey Karzhavin, Vladimir Tagankin, Vadim Urasin.

The McDonald BED column indicates whether or not the mutation is a SNP and falls in the BED region used by Dr. Iain McDonald in the age analysis he does for R-U106 men.

Age Analysis Information (work in progress)

AllMcDonaldYFull
Kit: B7836841522498795532688412313
Used in age calculations1522498795532688412313
Counts of SNPs1614
Variant counts last updated 2022-04-21 03:18:09.



Big Tree Main Page