Tree Position

R-P312/S116 > Z290 > L21/S145 > S552 > DF13 > ZZ10 > Z255/S219 > Z16434 > Z18134 > BY582 > BY581 > Z18138 > Z18136

Unique Mutations

The mutations unique to this man are summarized in the table below. Those with a '+' or '*' confidence level are considered by FamilyTreeDNA or FullGenomesCorp to be high quality SNPs/INDELs. For completeness, all other mutations of lesser confidence are included as well. These additional mutations may be useful for distinguishing between very closely related men.

Occasionally, some of the mutations listed here will be thought to be shared with other men in which case they might appear in upstream blocks on the tree. When this happens, the 'Blocks' field will indicate what block they appear in. Such a situation might arise with BigY men if the BED data suggests another man may be positive for a SNP, even though it doesn't appear in his VCF data. It might also happen if Chromo2 testing or Sanger sequencing of other men not on the tree show the SNP to be shared.

POS-REF-ALT (hg19) POS-REF-ALT (hg38) Blocks Names Region McDonald BED combBED STRKane-BY3
406963
9429673-A-T 9592064-A-T **
22986421-G-T 20824535-G-T **
22439616-C-A 20277730-C-A DYZ19 **
23041198-G-GA 20879312-G-GA 34×A**
26544628-T-G 24398481-T-G P1_g2 **
23049705-A-T 20887819-A-T **
23049708-A-T 20887822-A-T **
24382686-T-C 22236539-T-C FT141279 **
27583023-G-T 25436876-G-T P1_Y2 **
7061400-G-A 7193359-G-A **
23786513-A-T 21624627-A-T FT141210 **
11028340-T-TTCACCATTCCATTG **
22463142-G-A 20301256-G-A FT458149 DYZ19 **
13469437-C-G 11313761-C-G **
18134848-T-C 16022968-T-C **
10763232-G-A **
16800165-C-T 14688285-C-T FT139268 **
10763233-T-C **
16976036-T-A 14864156-T-A **
28553992-C-CA 26407845-C-CA 28×A**
6510190-A-C 6642149-A-C FT137025 **
10626831-A-ACCACT **
13480604-G-C 11324928-G-C **
9429672-A-T 9592063-A-T **
13469008-C-T 11313332-C-T **
13480620-T-C 11324944-T-C **
16089683-C-G 13977803-C-G FT139021 **
22311668-G-A 20149782-G-A DYZ19 **
10809667-T-C **
7943692-A-G 8075651-A-G FT137519 **
7360934-C-T 7492893-C-T FT137325 **
28237969-T-C 26091822-T-C P1_b4 **
13480911-T-C 11325235-T-C **
13623188-C-T 11467512-C-T **
15163379-G-A 13051465-G-A FT138704 **
3205386-T-C 3337345-T-C **
3232552-T-C 3364511-T-C FT135439 **
13726589-C-CAA 11570913-C-CAA **
13480915-G-A 11325239-G-A **
13726590-T-TGGA 11570914-T-TGGA **
18672264-ATG-A 16560384-ATG-A **
18616811-TG-T 16504931-TG-T **
13480613-G-C 11324937-G-C **
15865946-C-CTTTTTTTTTTTTTTTT 13754066-C-CTTTTTTTTTTTTTTTT 37×T**
10944670-A-ACTCCT **
15893425-T-C 13781545-T-C **
22311666-G-A 20149780-G-A DYZ19 **
6605544-T-C 6737503-T-C ***
6597340-TA-T,TAA 6729299-TA-T,TAA 28×A***
6998339-A-G 7130298-A-G ***
6489371-C-CAAAA 6621330-C-CAAAA 25×A***
13485749-C-G 11330073-C-G ***
4839002-C-CTT 4970961-C-CTT 16×T***
5832455-T-TTA 5964414-T-TTA ***
3622966-TTGTGTG-T 3754925-TTGTGTG-T 17×TG***
2795559-GT-G,GTTTTTTTTTTTTTTTTTTTTTT 2927518-GT-G,GTTTTTTTTTTTTTTTTTTTTTT 24×T***
3015776-T-C 3147735-T-C ***
3128625-C-CAAA 3260584-C-CAAA 20×A***
3270917-A-T 3402876-A-T ***
3371923-A-G 3503882-A-G ***
3410302-T-G 3542261-T-G ***
3706640-T-C 3838599-T-C ***
5733183-AT-A 5865142-AT-A 10×T***
3740920-G-GA 3872879-G-GA 8×A***
4287356-G-A 4419315-G-A ***
5042249-T-A 5174208-T-A ***
5347990-C-T 5479949-C-T ***
5593105-T-C 5725064-T-C ***
5593106-G-A 5725065-G-A ***
7003083-T-C 7135042-T-C ***
9429447-A-C 9591838-A-C ***
7149339-G-T 7281298-G-T ***
13345932-T-G 11190256-T-G ***
11035871-ATTCC-A ***
13233319-G-GAAA 11077643-G-GAAA 17×A***
13239513-CTT-C,CT 11083837-CTT-C,CT 17×T***
13256882-A-C 11101206-A-C ***
13256884-A-C 11101208-A-C ***
13259786-AGGGTCAGGGGTTAG-A 11104110-AGGGTCAGGGGTTAG-A ***
13276189-G-A 11120513-G-A ***
13328911-A-G 11173235-A-G ***
13328912-C-G 11173236-C-G ***
13348795-CT-C 11193119-CT-C 9×T***
11035853-G-A ***
13351715-T-A 11196039-T-A ***
13378460-GA-G 11222784-GA-G ***
13448661-T-TTCCTCTCCACTCCACTCCACTCCATTCCATTCTACTCCATTCGATTCCATTCCACTCCAG 11292985-T-TTCCTCTCCACTCCACTCCACTCCATTCCATTCTACTCCATTCGATTCCATTCCACTCCAG ***
13449311-ATT-A 11293635-ATT-A ***
13449314-GCAT-G 11293638-GCAT-G ***
13451486-T-G 11295810-T-G ***
11297031-TCTCC- ***
11297036-ACTACTC- ***
13460530-T-A,A 11304854-T-A,A ***
11035860-C-A ***
11035852-T-A ***
7438018-T-C 7569977-T-C ***
10671800-TCGGCC-T ***
8154139-T-C 8286098-T-C ***
8892479-T- ***
8888375-CT-C,C 9020334-CT-C,C 25×T***
9056618-G-GTTTGTGTTCAACTATT ***
9360640-TG- ***
9211271-C-A 9373662-C-A ***
28803201-G-A 26657054-G-A ***
9507982-CTTTTT-C,CTTTT 9670373-CTTTTT-C,CTTTT 34×T***
9839545-CA-C,CAAA 10001936-CA-C,CAAA 23×A***
10671804-CCTCAT- ***
11024682-T-TCACTC ***
10673429-T-TTATAC ***
10694191-C-CGGGCTGGAGTTCGGTGGG ***
10756986-ACCCGAC-A ***
10756993-TCGACTCCACTCAAATCCACTCCAATCCAATCCACTCCACTCTAC-T ***
10763175-T-TC ***
10763204-TG-T ***
10763207-C-CATT ***
10763209-TGC-T ***
10860928-T-TTACACTCCAC ***
2730092-ATTTTT-A,ATTTTTT 2862051-ATTTTT-A,ATTTTTT 17×T***
11294087-CTATT- ***
13488582-A-AAGAT 11332906-A-AAGAT ***
7002963-G-A 7134922-G-A ***
56826515-A-C ***
10661349-TCCCAG-T ***
13468543-G-T 11312867-G-T ***
13468550-A-T 11312874-A-T ***
13471102-G-T 11315426-G-T ***
13489234-T-G 11333558-T-G ***
17301238-CAAA-C,CAA 15189358-CAAA-C,CAA 23×A***
19513143-CTT-C,CTTT 17401263-CTT-C,CTTT 20×T***
13461914-G-C 11306238-G-C ***
13487935-G-A 11332259-G-A ***
13479129-G-A 11323453-G-A ***
13489765-TAC-T 11334089-TAC-T ***
13489768-C-CGT 11334092-C-CGT ***
13508327-ACT-A 11352651-ACT-A 8×CT***
22486541-G-C 20324655-G-C DYZ19 ***
10914608-A-T ***
13477189-C-T 11321513-C-T ***
9429669-A-G 9592060-A-G ***
13390081-T-C 11234405-T-C ***
13479102-T-C 11323426-T-C ***
13487755-AACCCCC-A 11332079-AACCCCC-A ***
13487353-CGCAT-C 11331677-CGCAT-C ***
13478996-C-A 11323320-C-A ***
56886108-G-A ***
56886109-AGCT-A ***
13474700-T-A 11319024-T-A ***
13474776-A-C 11319100-A-C ***
13478976-G-A 11323300-G-A ***
13478981-T-A 11323305-T-A ***
13478987-C-T 11323311-C-T ***
13478993-T-A 11323317-T-A ***
13479031-C-G 11323355-C-G ***
13484140-G-T 11328464-G-T ***
13479044-C-A 11323368-C-A ***
13480769-C-T 11325093-C-T ***
13485920-A-C 11330244-A-C ***
13507691-A-G 11352015-A-G ***
56832357-C-CCACTCCTTTCCATTCCACTCCTTTCCACTCCACTCCCCTCCAA ***
56871655-A-AT ***
13450100-TCCACTCCACTCCACCCCATC-T 11294424-TCCACTCCACTCCACCCCATC-T ***
13462146-A-T 11306470-A-T ***
13470166-C-G 11314490-C-G ***
13469145-T-G 11313469-T-G ***
13487364-A-T 11331688-A-T ***
13487993-T-A 11332317-T-A ***
10671795-TCCA-T ***
10677324-CCCATT- ***
11113912-CAAAA- ***
13449752-TCAAC-T 11294076-TCAAC-T ***
13479177-C-T 11323501-C-T ***
9964767-T-C 10127158-T-C ***
9964772-T-C 10127163-T-C ***
13335016-T-A 11179340-T-A ***
13720143-T-C 11564467-T-C ***
13461858-AAGT-A 11306182-AAGT-A ***
22508002-G-C 20346116-G-C DYZ19 ***
28818288-A-G 26672141-A-G ***
13474695-A-T 11319019-A-T ***
13475282-G-C 11319606-G-C ***
13476644-G-A 11320968-G-A ***
5523917-CTT-C,CTTT 5655876-CTT-C,CTTT 24×T***
10989152-C-CATTCAACTCCACACCATTCCACTCCATTCCTCTCA,CATTCAACTCCACACCATTCCACTCCATTCCTCTCA ***
11333951-CACCA- ***
56833341-T- ***
13484920-G-A 11329244-G-A ***
22508014-T-G 20346128-T-G DYZ19 ***
22503088-ATTTTTCCTTCAGATGTGTCCAGGGTTTCTGTCTTCTGGCAGGTTCATGGTCTTGCTCACTTCCAGAATGAAGCTGCAGACTTTAGTGGTGAGTGTTACAGCACTTAAAGTTGTTATGTCCAGAGT-A 20341202-ATTTTTCCTTCAGATGTGTCCAGGGTTTCTGTCTTCTGGCAGGTTCATGGTCTTGCTCACTTCCAGAATGAAGCTGCAGACTTTAGTGGTGAGTGTTACAGCACTTAAAGTTGTTATGTCCAGAGT-A DYZ19 ***
9996046-A-G 10158437-A-G ***
5227087-CAAA-C,CAA 5359046-CAAA-C,CAA 21×A***
13489703-GCA-G 11334027-GCA-G ***
22438024-A-AC 20276138-A-AC DYZ19 ***
13252070-A-G 11096394-A-G ***
13252077-A-C 11096401-A-C ***
22490469-G-T 20328583-G-T DYZ19 ***
13461879-C-T 11306203-C-T ***
13469382-C-T 11313706-C-T ***
13641025-A-T 11485349-A-T ***
16768468-C-CA 14656588-C-CA 8×A***
10025246-C-A 10187637-C-A ***
13470635-G-C 11314959-G-C ***
10988586-ATTCCATT-A ***
11291461-CATTCCATTCCATTCCATTCT- ***
11333958-C- ***
56827687-T-C,TGCCATCCGATTC ***
13451897-T-TTC 11296221-T-TTC ***
13465101-C-T 11309425-C-T ***
19438002-G-T 17326122-G-T ***
19438007-G-A 17326127-G-A ***
56831844-A- ***
13461852-GGGT-G 11306176-GGGT-G ***
13463809-GA-G 11308133-GA-G ***
13461971-A-C 11306295-A-C ***
22240578-A-G 20078692-A-G DYZ19 ***
18801015-T-C 16689135-T-C ***
19126436-C-CAAAAAAAAA,CAAAAAAAAA 17014556-C-CAAAAAAAAA,CAAAAAAAAA 25×A***
19253578-C-T 17141698-C-T ***
19438178-G-A 17326298-G-A ***
21012277-A-G 18850391-A-G P4_Dst ***
21435117-A-AG 19273231-A-AG ***
21665471-C-T 19503585-C-T ***
21762486-T-C 19600600-T-C ***
22258027-T-G 20096141-T-G DYZ19 ***
18688500-C-CA,CA 16576620-C-CA,CA 20×A***
22263488-C-A 20101602-C-A DYZ19 ***
22272066-T-C 20110180-T-C DYZ19 ***
22303510-T-TTGTG 20141624-T-TTGTG DYZ19 ***
22303512-C-CCAGAGTTTCTTTCTTCTGGCAGGTTCATGGTCTTGCTCACTTCAAGAATGAAACTGCAGACATTTATGGTGCTTGTTACAGCACTTAAAGGTATTATGTCCAGAGTTTGTTCCTTCAGATG,G 20141626-C-CCAGAGTTTCTTTCTTCTGGCAGGTTCATGGTCTTGCTCACTTCAAGAATGAAACTGCAGACATTTATGGTGCTTGTTACAGCACTTAAAGGTATTATGTCCAGAGTTTGTTCCTTCAGATG,G DYZ19 ***
22448758-T-G 20286872-T-G DYZ19 ***
22475020-C-T 20313134-C-T DYZ19 ***
22475052-G-A 20313166-G-A BY48004 DYZ19 ***
22475063-A-C 20313177-A-C DYZ19 ***
22479427-A-C 20317541-A-C DYZ19 ***
18709353-A-G 16597473-A-G ***
18679925-CAAA-C,CAAAA 16568045-CAAA-C,CAAAA 25×A***
22486360-CCAGAGTTTATTCCTTCTTGCAGGTTCGTGGTCTTGCTCACTTCCTTAATGAAGCTGCAGACCTTACCGGTGAGTGTTATAGCACTTAAAGGTGTTATGTCCAGAGTTTGTTCCCTCAGATGTGT-C 20324474-CCAGAGTTTATTCCTTCTTGCAGGTTCGTGGTCTTGCTCACTTCCTTAATGAAGCTGCAGACCTTACCGGTGAGTGTTATAGCACTTAAAGGTGTTATGTCCAGAGTTTGTTCCCTCAGATGTGT-C DYZ19 ***
16545414-C-CA,CA 14433534-C-CA,CA 24×A***
15566817-G-GA,GA 13454937-G-GA,GA 22×A***
15733879-CAA-C,CAAA 13621999-CAA-C,CAAA 25×A***
15752638-C-CCTTCTTCTT,CCTTCTTCTTCTT 13640758-C-CCTTCTTCTT,CCTTCTTCTTCTT 25×CTT***
15810963-GT-G 13699083-GT-G ***
16293539-A-ATTT 14181659-A-ATTT 16×T***
16308486-CT-C,CTTT 14196606-CT-C,CTTT 25×T***
16503539-C-T 14391659-C-T ***
16535053-CT-C,CTTTT 14423173-CT-C,CTTTT 35×T***
16612658-A-G 14500778-A-G ***
18134881-G-A 16023001-G-A ***
16624936-C-A 14513056-C-A ***
16834791-ATAGCATTTCCAGAAACAG-A 14722911-ATAGCATTTCCAGAAACAG-A ***
17181762-A-G 15069882-A-G ***
17322459-G-A 15210579-G-A ***
17604931-GTT-G,GTTTT 15493051-GTT-G,GTTTT 24×T***
17625277-A-C 15513397-A-C ***
17802166-TA-T,TAA 15690286-TA-T,TAA 30×A***
18019832-CTTT-C,CTT 15907952-CTTT-C,CTT 22×T***
18109358-TA-T,T 15997478-TA-T,T 23×A***
22485164-C-G 20323278-C-G DYZ19 ***
22486841-T-C 20324955-T-C DYZ19 ***
15288898-T-C 13176997-T-C ***
56763605-T-C ***
26661129-GATTGGAGTGGAATGGAGTGCAATGGACTGGAGTGGAGTGGAATGGATTGGAGTGGAGTGGAGTGGATCGGAGAGGAGTGCCGTGGAGTGGACTAGAGTGGGGTGGAGTGGAGTGC- ***
28811159-A-C 26665012-A-C ***
56685507-A-C ***
56685692-A-T ***
56706947-T-A ***
56706984-C-CAATGA 5×AATGG***
56706995-A-AATGTT ***
56715385-A-C ***
56763606-C-T ***
28744215-CAA-C 26598068-CAA-C 12×A***
56827763-CCA- ***
56827766-GTCCATTCCATTCGAGTCCATTCCATTCCATTCT- ***
56827914-C-CAATCCATTCCATTCCATTCCATTAAATTCG,CAATCCATTCCATTCCATTCTATTCCATTCCATTAAATTCG ***
56829138-C-T ***
56830805-CA- ***
56830807-CTCCACTCCA- ***
56833358-C- ***
56839453-A-G ***
56876124-CAAAAAAAAAAAAAAAAAAAAAAAA-C 50×A***
28803155-T-C 26657008-T-C FT462236 ***
28686447-G-T 26540300-G-T ***
22487929-G-T 20326043-G-T DYZ19 ***
22510714-T-A 20348828-T-A DYZ19 ***
22502948-GTGTTATGTCCAGAGTTTGTTCCTTCAGATGTGTCCAGAGTGTCTTTCTTCTGGCAGGTTCATGGTCTTGCTCACTTCAAGAATGAAGCTGCAGACCTTACTGGTGAGTGTTACAGCACTTAAAGGTGTTATGTCCAGAGATTTTTCCTTCAGATGTGTCCAGGGTTTCTGTCTTCTGGCAGGTTCATGGTCTTGCTCACTTCCAGAATGAAGCTGCAGACTTTAGTGGTGAGTGTTACAGCACTTAAAGT-G 20341062-GTGTTATGTCCAGAGTTTGTTCCTTCAGATGTGTCCAGAGTGTCTTTCTTCTGGCAGGTTCATGGTCTTGCTCACTTCAAGAATGAAGCTGCAGACCTTACTGGTGAGTGTTACAGCACTTAAAGGTGTTATGTCCAGAGATTTTTCCTTCAGATGTGTCCAGGGTTTCTGTCTTCTGGCAGGTTCATGGTCTTGCTCACTTCCAGAATGAAGCTGCAGACTTTAGTGGTGAGTGTTACAGCACTTAAAGT-G DYZ19 ***
22507780-A-T 20345894-A-T DYZ19 ***
22508028-A-G 20346142-A-G DYZ19 ***
22508050-T-A 20346164-T-A DYZ19 ***
22508065-C-A 20346179-C-A DYZ19 ***
22509324-G-A 20347438-G-A DYZ19 ***
22509362-A-C 20347476-A-C DYZ19 ***
22509528-A-G 20347642-A-G DYZ19 ***
22509544-C-A 20347658-C-A DYZ19 ***
22510729-A-T 20348843-A-T DYZ19 ***
28240597-C-A 26094450-C-A P1_b4 ***
23025229-CAA-C,CA 20863343-CAA-C,CA 29×A***
24305272-CA-C,C 22159125-CA-C,C P3_t1 21×A***
24381444-T-G 22235297-T-G ***
26079202-C-T 23933055-C-T P1_Y1 ***
26391527-T-TACACAC 24245380-T-TACACAC P1_Y1 21×AC***
27078017-C-G,G 24931870-C-G,G P1_r4 ***
27636043-A-C 25489896-A-C P1_Y2 ***
27995584-T-G 25849437-T-G P1_Y2 ***
28008036-CAA-C,CAAA 25861889-CAA-C,CAAA P1_Y2 17×A***
15323782-A-G 13211900-A-G ***
15262458-CA-C,CAAA 13150542-CA-C,CAAA 30×A***
13462125-T-G 11306449-T-G ***
13470693-G-T 11315017-G-T ***
13469196-C-CA 11313520-C-CA ***
13469335-C-CTGCGG 11313659-C-CTGCGG ***
13469353-C-G 11313677-C-G ***
13469361-A-C 11313685-A-C ***
13469387-A-T 11313711-A-T ***
13469951-C-A 11314275-C-A ***
13470562-G-A 11314886-G-A ***
13470596-G-T 11314920-G-T ***
13470750-C-A 11315074-C-A ***
13469110-C-A 11313434-C-A ***
13474389-T-G 11318713-T-G ***
13474476-GC-G 11318800-GC-G ***
13474480-C-G 11318804-C-G ***
11318927-A- ***
13476597-T-C 11320921-T-C ***
13476679-C-CCG 11321003-C-CCG ***
13476695-G-C 11321019-G-C ***
13476720-G-A 11321044-G-A ***
13478259-G-GCT 11322583-G-GCT ***
13469115-A-G 11313439-A-G ***
11312468-G- ***
13478441-CCG-C 11322765-CCG-C ***
13463729-G-C 11308053-G-C ***
13462131-T-G 11306455-T-G ***
13462137-C-T 11306461-C-T ***
13462557-A-C 11306881-A-C ***
13462564-T-C 11306888-T-C ***
13462584-G-A 11306908-G-A ***
13462605-G-A 11306929-G-A ***
13463317-C-T 11307641-C-T ***
13463682-C-G 11308006-C-G ***
13463800-G-T 11308124-G-T ***
13468077-T-G 11312401-T-G ***
13484270-G-A 11328594-G-A ***
13463816-C-T 11308140-C-T ***
11308161-GTTTT- ***
13464780-C-G 11309104-C-G ***
13465032-GC-G 11309356-GC-G ***
13465077-T-A 11309401-T-A ***
13466340-G-T 11310664-G-T ***
13466401-C-T 11310725-C-T ***
13466419-C-T 11310743-C-T ***
13478260-TGG-T 11322584-TGG-T ***
13479103-C-T 11323427-C-T ***
15260684-CT-C,CTTTTTTTTT 13148768-CT-C,CTTTTTTTTT 25×T***
11538041-TGGAAC- ***
13524356-A-G 11368680-A-G ***
13540873-T-A 11385197-T-A ***
13545727-C-T 11390051-C-T ***
13554363-G-GA 11398687-G-GA ***
13554370-G-A 11398694-G-A BY86413 ***
13569650-G-A 11413974-G-A ***
13612591-TTATA-T 11456915-TTATA-T ***
13616427-T-TA,TAAA 11460751-T-TA,TAAA 28×A***
13712881-A-T 11557205-A-T ***
13515246-T-C 11359570-T-C ***
13716305-C-G 11560629-C-G ***
13728962-T-G 11573286-T-G ***
13963824-A-ATTTTTTTTTTT,ATTTTTTTTTTT 11843118-A-ATTTTTTTTTTT,ATTTTTTTTTTT 49×T***
14331131-C-CTT 12210425-C-CTT 25×T***
14656154-CAAAA-C,CAAAAAA 12544219-CAAAA-C,CAAAAAA 24×A***
12555882-CAA-C,CAAA 24×A***
14681983-A-G 12570049-A-G ***
14722668-C-CA 12610736-C-CA 9×A***
12865784-CT-C,C 15×T***
13523586-G-A 11367910-G-A ***
13504722-C-G 11349046-C-G ***
13479123-G-GACC 11323447-G-GACC ***
13487398-T-G 11331722-T-G ***
13479126-C-A 11323450-C-A ***
13479150-T-C 11323474-T-C ***
13480708-T-G 11325032-T-G ***
13480710-G-C 11325034-G-C ***
13482069-T-A 11326393-T-A ***
13484916-C-T 11329240-C-T ***
13487287-T-A 11331611-T-A ***
13487359-A-AACAC 11331683-A-AACAC ***
13487382-A-C 11331706-A-C ***
13487407-G-C 11331731-G-C ***
13500437-C-G 11344761-C-G ***
13489241-A-T 11333565-A-T ***
11333939-ACC- ***
11333956-C- ***
11333957-C- ***
11333959-ACC- ***
11334023-G- ***
11334025-CCG- ***
13489702-C-CCT 11334026-C-CCT ***
13500414-C-A 11344738-C-A ***
16818679-T-A,A 14706799-T-A,A ***
13476565-C-G 11320889-C-G ***
13480839-C-G 11325163-C-G ***
24573423-CTTT-C 22427276-CTTT-C P3_t2 21×T***
13531753-CAAAA-C 11376077-CAAAA-C 23×A***
59009226-A-AAACC 56863079-A-AAACC ***
58905172-A-T 56685699-T-A ***
13698997-G-C 11543321-G-C ***
13464679-A-C 11309003-A-C ***
9996031-C-T 10158422-C-T ***
13485716-C-T 11330040-C-T ***
28385926-T-TAC 26239779-T-TAC P1_gr2 20×AC***
5452626-CT-C 5584585-CT-C 11×T***
58883877-C-CCATTG 56706989-G-GAATGC ***
8468065-CAA-C,CA 8600024-CAA-C,CA 24×A***
10763227-C-T ***
13468075-C-A 11312399-C-A ***
2809540-AT-A,ATT 2941499-AT-A,ATT 18×T***
10673425-C-T ***
13474089-C-G 11318413-C-G ***
13712260-A-G 11556584-A-G ***
18134889-G-A 16023009-G-A ***
13469398-G-T 11313722-G-T ***
13334983-CACTT-C 11179307-CACTT-C ***
4270959-A-AAGAT,AAGATAGAT 4402918-A-AAGAT,AAGATAGAT 15×AGAT***
13478709-C-T 11323033-C-T ***
13462566-C-T 11306890-C-T FGC39802BY41740 ***
22489615-G-A 20327729-G-A DYZ19 ***
22509305-A-C 20347419-A-C BY174818BY174818 DYZ19 ***
13730144-G-T 11574468-G-T ***
4408904-GA-G 4540863-GA-G 13×A***
13712246-T-C 11556570-T-C ***
13718620-C-T 11562944-C-T ***
13468580-A-T 11312904-A-T ***
9977607-C-T 10139998-C-T ***
22422811-C-G 20260925-C-G DYZ19 ***
13701317-T-C 11545641-T-C ***
13449759-CATTCT-C 11294083-CATTCT-C ***
22486511-C-T 20324625-C-T DYZ19 ***
22486543-C-T 20324657-C-T DYZ19 ***
58998191-C-G 56852044-C-G A8825 ***
58858810-T-C 56732061-A-G ***
28809633-C-T 26663486-C-T BY12618 ***
22509342-G-T 20347456-G-T DYZ19 ***
13463310-G-C 11307634-G-C ***
13484279-C-A 11328603-C-A ***
13345159-T-A 11189483-T-A A3795 ***
13474102-A-C 11318426-A-C ***
13478718-G-T 11323042-G-T ***
13721929-C-G 11566253-C-G ***
13723047-C-G 11567371-C-G ***
13577890-T-C 11422214-T-C ***
13345944-G-C 11190268-G-C ***
13345946-C-A 11190270-C-A ***
22509555-A-T 20347669-A-T DYZ19 ***
13467984-C-A 11312308-C-A ***
21462353-A-AGTGT 19300467-A-AGTGT 16×GT***
2945859-T-C 3077818-T-C ***
9689078-G-T 9851469-G-T IR3_Prx 15×T***
24381882-A-ATT 22235735-A-ATT 11×T***
6398637-AACAC-A 6530596-AACAC-A 23×AC***
13330003-G-T 11174327-G-T ***
27861871-G-C 25715724-G-C P1_Y2 ***
21357496-GA-G 19195610-GA-G 9×A***
13480740-A-C 11325064-A-C ***
8333480-T-TTTCTTC,TTTCTTCTTC 8465439-T-TTTCTTC,TTTCTTCTTC 31×TTC***
22446669-A-ATT 20284783-A-ATT DYZ19 ***
56823786-G-T ***
16301002-G-GAA 14189122-G-GAA 18×A***
21992963-TAAA-T,TAA 19831077-TAAA-T,TAA 23×A***
11035825-C-A ***
14392171-G-GAA 12271467-G-GAA 16×A***
10954325-C-A ***
4661690-T-TA 4793649-T-TA 10×A***
13498306-C-T 11342630-C-T ***
10937449-C-T ***
13488576-TCCCA-T 11332900-TCCCA-T ***
17690104-G-GA 15578224-G-GA 9×A***
13480643-C-T 11324967-C-T ***
9806720-G-A 9969111-G-A ***
13466109-C-A 11310433-C-A ***
10763192-T-A ***
22359450-G-A 20197564-G-A DYZ19 ***
10023666-TTCTC-T 10186057-TTCTC-T ***
22359465-A-C 20197579-A-C DYZ19 ***
6494382-TA-T 6626341-TA-T 9×A***
19337633-CTT-C,CTTT 17225753-CTT-C,CTTT 22×T***
22903849-T-TAG 20741963-T-TAG 13×AG***
28766002-A-AT 26619855-A-AT 10×T***
13460517-C-A 11304841-C-A ***
13468012-A-T 11312336-A-T ***
10673381-C-A ***
10673393-A-T ***
10673412-C-A ***
2812392-G-GTT 2944351-G-GTT 12×T***
13489678-C-T 11334002-C-T ***
58982008-A-T 56835861-A-T ***
13480884-G-A 11325208-G-A ***
13277875-C-G 11122199-C-G ***
9973969-A-T 10136360-A-T ***
9973982-T-C 10136373-T-C ***
9974102-T-A 10136493-T-A ***
10043530-C-T 10205921-C-T ***
10048503-A-G 10210894-A-G ***
13252044-C-T 11096368-C-T ***
13254202-GC-G 11098526-GC-G ***
13270880-C-G 11115204-C-G ***
13275370-A-G 11119694-A-G ***
13277992-G-A 11122316-G-A ***
8470317-TTG-T 8602276-TTG-T ***
13279891-G-A 11124215-G-A ***
13291896-G-GGT 11136220-G-GGT ***
13346004-C-T 11190328-C-T ***
13368344-G-C 11212668-G-C ***
13469455-G-A 11313779-G-A ***
13500729-A-G 11345053-A-G ***
13500732-T-G 11345056-T-G ***
13538517-T-C 11382841-T-C Z11998 ***
13554730-A-G 11399054-A-G ***
9943530-T-C 10105921-T-C ***
6346315-CAT-C 6478274-CAT-C ***
13641018-A-G 11485342-A-G ***
28817910-C-T 26671763-C-T ***
22475030-G-T 20313144-G-T BY223268 DYZ19 ***
13349747-T-G 11194071-T-G ***
13448636-T-TTCCA 11292960-T-TTCCA ***
13717332-A-C 11561656-A-C ***
13253040-C-A 11097364-C-A ***
22962414-G-GTTTTT 20800528-G-GTTTTT 20×T***
9361025-T-A 9523416-T-A ***
13493079-C-G 11337403-C-G ***
22449545-G-A 20287659-G-A DYZ19 ***
28790623-ATGGAATGGAG-A 26644476-ATGGAATGGAG-A ***
5842532-A-C 5974491-A-C ***
26479590-C-CA 24333443-C-CA P1_Y1 16×A***
13554532-G-A 11398856-G-A FTA37654 ***
25508501-C-G 23362354-C-G P1_gr1 ***
21934221-G-GT 19772335-G-GT 9×T***
9943540-T-G 10105931-T-G ***
2945865-C-A 3077824-C-A ***
3089669-G-A 3221628-G-A ***
3742475-TTA-T 3874434-TTA-T ***
4632020-T-A 4763979-T-A FGC213 ***
13574524-T-C 11418848-T-C ***
17946919-G-GTTT 15835039-G-GTTT 24×T***
9789137-A-AT 9951528-A-AT 9×T***
13470543-C-T 11314867-C-T ***
13696768-C-G 11541092-C-G ***
19265637-GGA-G 17153757-GGA-G ***
22041035-C-CCA 19879149-C-CCA 10×CA***
22475053-T-G 20313167-T-G Z23635 DYZ19 ***
23070801-TGTA-T 20908915-TGTA-T ***
59009242-C-A 56863095-C-A 9×A***
59012211-G-A 56866064-G-A ***
13301305-T-C 11145629-T-C ***
13704544-G-T 11548868-G-T ***
13470546-G-A 11314870-G-A ***
13513709-C-T 11358033-C-T FT189831 ***
13470552-C-A 11314876-C-A ***
13726499-GGAATA-G 11570823-GGAATA-G ***
13720565-A-G 11564889-A-G ***
13345990-A-G 11190314-A-G FGC50080 ***
13489496-A-G 11333820-A-G ***
9962289-G-A 10124680-G-A ***
10043634-T-C 10206025-T-C ***
13443640-T-C 11287964-T-C ***
23391113-A-AT 21229227-A-AT 9×T***
13529319-C-G 11373643-C-G ***
13437012-A-T 11281336-A-T ***
22475865-T-A 20313979-T-A DYZ19 ***
22475014-T-G 20313128-T-G DYZ19 ***
28709245-G-T 26563098-G-T ***
28709481-A-G 26563334-A-G ***
59003980-C-T 56857833-C-T ***
13705110-T-A 11549434-T-A ***
5945467-CTTTTTT-C 6077426-CTTTTTT-C 25×T***
9931363-GTT-G 10093754-GTT-G 9×T***
3015610-A-ACACT 3147569-A-ACACT ***
13698978-A-T 11543302-A-T ***
13728980-A-G 11573304-A-G ***
22475023-C-A 20313137-C-A DYZ19 ***
13410306-C-T 11254630-C-T ***
5680402-G-A 5812361-G-A ***
6595242-TCTCA-T 6727201-TCTCA-T ***
9943574-A-C 10105965-A-C ***
9960918-C-T 10123309-C-T ***
9962099-T-A 10124490-T-A ***
10043608-A-C 10205999-A-C ***
13261454-G-A 11105778-G-A ***
13264889-G-T 11109213-G-T ***
13271447-A-G 11115771-A-G ***
17564912-GAA-G,GAAA 15453032-GAA-G,GAAA 16×A***
13351728-A-G 11196052-A-G ***
13468058-T-A 11312382-T-A ***
13480772-C-T 11325096-C-T ***
2918624-T-C 3050583-T-C ***
22040881-CA-C,CAA 19878995-CA-C,CAA 19×A***
7601435-AT-A 7733394-AT-A 10×T***
10039748-TA-T 10202139-TA-T ***
14604590-CT-C,CTTT 12492792-CT-C,CTTT 21×T***
4498179-AT-A,ATT 4630138-AT-A,ATT 23×T***
15468678-CAAAA-C,CAAA 13356798-CAAAA-C,CAAA 23×A***
13377552-T-C 11221876-T-C ***
13477232-C-G 11321556-C-G ***
24458760-CAAAA-C,CAAA 22312613-CAAAA-C,CAAA 18×A***
13477259-G-T 11321583-G-T ***
15421470-CA-C 13309590-CA-C 10×A***
17632570-GTT-G,GTTTT 15520690-GTT-G,GTTTT 22×T***
5581973-CT-C 5713932-CT-C 10×T***
22475883-T-A 20313997-T-A DYZ19 ***
3271838-T-C 3403797-T-C ***
9942789-T-A 10105180-T-A ***
13252001-T-A 11096325-T-A ***
13252012-G-A 11096336-G-A ***
13965269-CAAA-C,CAA 11844563-CAAA-C,CAA 21×A***
13474489-G-A 11318813-G-A ***
10043651-GT-G 10206042-GT-G ***
22508763-G-A 20346877-G-A DYZ19 ***
9942724-G-T 10105115-G-T ***
9942731-T-A 10105122-T-A ***
9942758-G-C 10105149-G-C ***
13420927-G-C 11265251-G-C ***
16598984-CAA-C,CA 14487104-CAA-C,CA 25×A***
13688579-T-G 11532903-T-G ***
19042179-CA-C,CAA 16930299-CA-C,CAA 17×A***
21980001-CAAA-C,CAA 19818115-CAAA-C,CAA 27×A***
5243395-AT-A 5375354-AT-A 12×T***
9996036-G-T 10158427-G-T ***
56886107-C-A ***
28803020-A-G 26656873-A-G ***
13335007-T-C 11179331-T-C ***
13484905-A-C 11329229-A-C ***
22475895-C-T 20314009-C-T BY47356 DYZ19 ***
18401199-CAA-C,CA 16289319-CAA-C,CA P6_Gap 30×A***
13728938-A-G 11573262-A-G ***
14312418-T-A 12191712-T-A ***
13638223-T-A 11482547-T-A ***
15991806-GT-G,GTTT 13879926-GT-G,GTTT 24×T***
9320548-AACACACACACAC-A,AAC 9482939-AACACACACACAC-A,AAC 20×AC***
13449774-T-C,TCATTCAATTCCATCAC 11294098-T-C,TCATTCAATTCCATCAC ***
9806705-T-C 9969096-T-C ***
13549607-G-GA 11393931-G-GA ***
10678993-ATT-A ***
10678996-CCACTCCAG-C ***
13469086-G-T 11313410-G-T ***
13469106-A-C 11313430-A-C ***
13473491-G-A 11317815-G-A ***
13487305-C-G 11331629-C-G ***
22446666-CTG-C 20284780-CTG-C DYZ19 ***
10944682-T-A ***
10944685-A-ATTCCGTT ***
56835866-TG-T ***
9974074-C-G 10136465-C-G ***
13464743-T-G 11309067-T-G ***
13349644-G-A 11193968-G-A ***
13476585-G-C 11320909-G-C ***
13476601-G-C 11320925-G-C ***
13489639-C-CCCAT 11333963-C-CCCAT ***
13726488-AAGAAT-A 11570812-AAGAAT-A ***
56838244-A-C ***
13479185-C-T 11323509-C-T ***
21156831-GTT-G,GTTT 18994945-GTT-G,GTTT 19×T***
10678942-C-CATTCCACTCCATTTCATTCCATTCCATACT ***
9960427-G-A 10122818-G-A ***
13470621-G-T 11314945-G-T ***
13476660-A-G 11320984-A-G ***
13730734-G-T 11575058-G-T ***
13730735-A-C 11575059-A-C ***
20835475-G-C 18673589-G-C P4_Gap ***
13252462-C-G 11096786-C-G ***
13464745-G-T 11309069-G-T ***
13464750-G-T 11309074-G-T ***
13465117-C-G 11309441-C-G ***
13469366-A-T 11313690-A-T ***
13469372-A-T 11313696-A-T ***
56884636-C-CA ***
28807266-GAGTGAAGTGGATTGGAGTGGAATGGAGTGCAATGGACTGGAGTGGAGTGGAATGGAT-G 26661119-GAGTGAAGTGGATTGGAGTGGAATGGAGTGCAATGGACTGGAGTGGAGTGGAATGGAT-G ***
13421099-A-T 11265423-A-T ***
13470214-G-C 11314538-G-C ***
13475296-T-A 11319620-T-A ***
13477248-A-T 11321572-A-T ***
13478795-C-CCG 11323119-C-CCG ***
13478796-TAG-T 11323120-TAG-T ***
13478813-C-T 11323137-C-T BY210361 ***
13488712-C-CAT 11333036-C-CAT ***
13722964-CATGGA-C 11567288-CATGGA-C 5×ATGGA***
9942712-C-G 10105103-C-G ***
9806701-T-C 9969092-T-C BY44835 ***
24381443-T-G 22235296-T-G ***
13696773-T-A 11541097-T-A ***
13466323-C-T 11310647-C-T ***
10763194-A-T ***
13531768-AAAAAAAAAC-A 11376092-AAAAAAAAAC-A ***
13461814-TC-T 11306138-TC-T ***
13463836-CGTT-C 11308160-CGTT-C ***
22359466-C-A 20197580-C-A DYZ19 ***
13739971-T-A 11584295-T-A ***
8020527-TA-T,TAA 8152486-TA-T,TAA 20×A***
5096093-C-CT 5228052-C-CT 11×T***
13477255-G-C 11321579-G-C ***
56685516-T-G ***
13470645-G-A 11314969-G-A ***
13478720-C-A 11323044-C-A ***
13470179-A-T 11314503-A-T ***
26079209-T-A 23933062-T-A P1_Y1 ***
3270914-G-T 3402873-G-T ***
6401115-T-C 6533074-T-C ***
9941581-C-A 10103972-C-A ***
10039790-C-T 10202181-C-T ***
11035840-A-C ***
21816649-A-AT 19654763-A-AT 9×T***
10677329-T-C ***
13251678-C-T 11096002-C-T ***
13471161-G-T 11315485-G-T ***
13474740-T-C 11319064-T-C ***
9349188-T-C 9511579-T-C FGC80729 ***
58905216-C-A 56685655-G-T ***
22566860-G-GA 20404974-G-GA 9×A***
11030260-G-A ***
4416886-T-C 4548845-T-C ***
18134878-A-G 16022998-A-G ***
13463746-G-T 11308070-G-T ***
19187446-C-CTTT 17075566-C-CTTT 34×T***
13471169-A-T 11315493-A-T ***
28818177-G-C 26672030-G-C ***
13471171-A-C 11315495-A-C ***
13468082-T-C 11312406-T-C ***
10673419-C-T ***
13486450-A-C 11330774-A-C ***
13638357-T-C 11482681-T-C ***
13474494-T-A 11318818-T-A ***
56685525-G-T ***
12376050-C-CTT ***
22485156-T-G 20323270-T-G DYZ19 ***
11035846-A-G ***
13436968-G-T 11281292-G-T ***
13420904-C-T 11265228-C-T ***
13628212-G-A 11472536-G-A ***
7002960-G-A 7134919-G-A ***
18636612-CT-C,CTT 16524732-CT-C,CTT 17×T***
13931739-CTTT-C,CTT 11811033-CTTT-C,CTT 22×T***
13726424-A-G,T 11570748-A-G,T ***
11029523-T-G ***
9960784-G-A 10123175-G-A ***
10677319-TCCTTC-T ***
13356237-T-C 11200561-T-C ***
13598054-A-T 11442378-A-T ***
4376142-CAA-C,CA 4508101-CAA-C,CA 26×A***
19609664-A-T 17497784-A-T P5_Prx ***
17136931-CT-C,CTT 15025051-CT-C,CTT 18×T***
28761417-G-T 26615270-G-T ***
9965212-T-C 10127603-T-C ***
13269581-ACAAAAAC-A 11113905-ACAAAAAC-A ***
13395279-G-T 11239603-G-T ***
13395280-C-T 11239604-C-T ***
56707109-G-C ***
13463834-A-C 11308158-A-C ***
13353898-A-T 11198222-A-T ***
15499049-TA-T 13387169-TA-T 10×A***
13500089-G-A 11344413-G-A ***
13533827-A-T 11378151-A-T ***
13705116-G-T 11549440-G-T ***
13534935-A-G 11379259-A-G ***
22509559-T-A 20347673-T-A DYZ19 ***
28817882-GATTGT-G 26671735-GATTGT-G ***
10039718-G-T 10202109-G-T ***
13253057-C-T 11097381-C-T ***
13335026-G-A 11179350-G-A ***
13437029-G-T 11281353-G-T ***
13495992-C-G 11340316-C-G ***
13539590-G-T 11383914-G-T ***
13706180-A-C 11550504-A-C ***
13484935-A-G 11329259-A-G ***
13706182-T-G 11550506-T-G ***
22448735-G-C 20286849-G-C DYZ19 ***
56863749-G-A ***
13543382-T-G 11387706-T-G ***
13557751-G-A 11402075-G-A ***
56859636-G-A ***
56862117-T-A ***
11029507-G-A FT440141 ***
11029508-T-C ***
56881665-C-T ***

In the table above, the meaning of the confidence field depends on whether the data comes from an FTDNA kit or an FGC kit. For FTDNA kits, + implies a "PASS" result with just one possible variant, * indicates a "PASS" but with multiple variants, ** indicates "REJECTED" with just a single variant, and *** indicates "REJECTED" with multiple possible variants. 'A*' are heterozygous variants not called by FTDNA, but still pulled from the VCF file. For FGC kits, + indicates over 99% likely genuine (95% for INDELs); * over 95% likely genuine (90% for INDELs); ** about 40% likely genuine; *** about 10% likely genuine. Manual entries read directly from a BAM file will be either + indicating positive, or * indicating that the data show a mixture of possible variants.

For the FTDNA kits, the BED data is encoded in the background color of the cells. Those cells with a white background have coverage, those with a grey background indicate no coverage in the BED file, and those with a pink background indicate the mutation is on the edge of a coverage region. These pink regions often indicate that the individual may be positive for a SNP even if there is no corresponding entry in the vcf file.

The combBED column indicates whether or not the mutation is a SNP and falls in the combBED region defined in Defining a New Rate Constant for Y-Chromosome SNPs based on Full Sequencing Data by Dmitry Adamov, Vladimir Guryanov, Sergey Karzhavin, Vladimir Tagankin, Vadim Urasin.

The McDonald BED column indicates whether or not the mutation is a SNP and falls in the BED region used by Dr. Iain McDonald in the age analysis he does for R-U106 men.

Age Analysis Information (work in progress)

AllMcDonaldYFull
Kit: 4069631590592394824258344979
Used in age calculations1590592394824258344979
Counts of SNPs00
Variant counts last updated 2021-12-29 19:39:58.



Big Tree Main Page