Tree Position

R-P312/S116 > Z290 > L21/S145 > S552 > DF13 > Z39589 > L1335/S530 > L1065 > Z16325 > S744 > S764 > ZZ28 > FT48497 > A6129

Unique Mutations

The mutations unique to this man are summarized in the table below. Those with a '+' or '*' confidence level are considered by FamilyTreeDNA or FullGenomesCorp to be high quality SNPs/INDELs. For completeness, all other mutations of lesser confidence are included as well. These additional mutations may be useful for distinguishing between very closely related men.

Occasionally, some of the mutations listed here will be thought to be shared with other men in which case they might appear in upstream blocks on the tree. When this happens, the 'Blocks' field will indicate what block they appear in. Such a situation might arise with BigY men if the BED data suggests another man may be positive for a SNP, even though it doesn't appear in his VCF data. It might also happen if Chromo2 testing or Sanger sequencing of other men not on the tree show the SNP to be shared.

POS-REF-ALT (hg19) POS-REF-ALT (hg38) Blocks Names Region McDonald BED combBED STRKane-BY3
463921
26455304-G-T 24309157-G-T P1_Y1 +
13516442-A-T 11360766-A-T +
14324894-C-CT 12204188-C-CT 26×T+
11021478-A-ATTCCATTCCATTCTACTCCACTCCATTCCACTCCACTCCACTCCGTTCCCTTATACTCCACTCCACTCCATTCCCGTCGACTCCACACAACTCCACTCCATTCAATTCCT +
10985416-T-TTCCATTCCATTCCCTTCCAATCCACTCTATTCCATTCCACTCCACTCCATTCCACTCCACTCCTCTCCATTCCACTCCACTCCTCTCCATTCCACTCCACTCCAGTCAAC +
23695835-C-G 21533949-C-G +
56699595-T-A +
9987933-C-T 10150324-C-T FT373810 Y+
27699915-TAC-T 25553768-TAC-T P1_Y2 21×AC+
13416557-G-A 11260881-G-A +
9360665-T-TC 9523056-T-TC +
13516655-T-C 11360979-T-C +
13516638-T-C 11360962-T-C +
22536446-T-C 20374560-T-C Y+
23226182-G-A 21064296-G-A Y+
23801733-CA-C 21639847-CA-C 31×A+
24365167-TAGATAGAGAAAGAGATAGAGATAGAGATAG-T 22219020-TAGATAGAGAAAGAGATAGAGATAGAGATAG-T +
13726488-AAGAAT-A 11570812-AAGAAT-A +
58891295-C-A 56699576-G-T +
13465281-A-G 11309605-A-G +
9360667-G-T 9523058-G-T Y8×T+
13481247-G-C 11325571-G-C +
13516633-T-G 11360957-T-G +
13515549-T-A 11359873-T-A +
13516632-C-T 11360956-C-T +
21125142-G-A 18963256-G-A Y+
13726484-G-T 11570808-G-T +
13484211-C-G 11328535-C-G +
13515516-T-C 11359840-T-C +
13516616-A-G 11360940-A-G +
13467013-T-G 11311337-T-G +
15189026-A-G 13077112-A-G Y+
13515526-T-C 11359850-T-C +
13515485-C-A 11359809-C-A +
10937365-AATTCC-A +
10512423-GT-G +
28804478-AAAAT-A 26658331-AAAAT-A +
13466074-C-A 11310398-C-A +
13467012-A-G 11311336-A-G +
2745255-C-T 2877214-C-T Y+
21754204-T-TAC +
21754198-CGTGT-C +
13726499-GGAATA-G 11570823-GGAATA-G +
9806714-A-G 9969105-A-G FGC10522 YY+
3148840-A-T 3280799-A-T FT200260 +
28804487-T-G 26658340-T-G +
13461753-G-A 11306077-G-A FGC42178 +
22503291-G-C 20341405-G-C DYZ19 +
22319290-GTCC-G 20157404-GTCC-G DYZ19 +
21940037-C-CATATATAT 19778151-C-CATATATAT 22×AT+
13516574-G-A 11360898-G-A FGC12985 +
13472110-T-C 11316434-T-C *
5507713-ATTTT-A,ATTT 5639672-ATTTT-A,ATTT 24×T*
9108182-A-ATG *
13475303-T-C 11319627-T-C *
9307403-TG-T 9469794-TG-T *
9307405-TGTG-T 9469796-TGTG-T *
13472033-G-GAA 11316357-G-GAA *
9932076-CAGTTT-C 10094467-CAGTTT-C *
13472027-CAT-C 11316351-CAT-C *
13465380-T-A 11309704-T-A *
13465003-G-T 11309327-G-T *
13478339-G-GCTC 11322663-G-GCTC *
13463852-AGC-A 11308176-AGC-A *
9932082-T-C 10094473-T-C Y*
13463849-AG-A 11308173-AG-A *
13463839-T-C 11308163-T-C *
13463835-CCG-C 11308159-CCG-C *
13463833-TA-T 11308157-TA-T *
13462334-C-CCA 11306658-C-CCA *
13462131-T-C 11306455-T-C *
56885333-A-G *
9964135-G-A 10126526-G-A Y*
13478345-TGCA-T 11322669-TGCA-T *
13489293-G-A 11333617-G-A *
13497023-TTA-T 11341347-TTA-T *
13496205-TG-T 11340529-TG-T *
13243652-A-G 11087976-A-G *
13243655-C-A 11087979-C-A *
13489779-G-GC 11334103-G-GC *
13489771-G-GCCCAC 11334095-G-GCCCAC *
13489764-GT-G 11334088-GT-G *
13489758-G-A 11334082-G-A *
13489729-C-CCAG 11334053-C-CCAG *
13489538-G-A 11333862-G-A *
13489514-C-G 11333838-C-G *
13335598-G-A 11179922-G-A *
13489135-GC-G 11333459-GC-G *
13483210-CGGAGA-C 11327534-CGGAGA-C *
13439940-G-T 11284264-G-T *
13488958-G-GTC 11333282-G-GTC *
13487914-G-C 11332238-G-C *
13487881-C-G 11332205-C-G *
28587865-G-A 26441718-G-A *
13487867-A-G 11332191-A-G *
13487859-G-C 11332183-G-C *
13485672-A-AGT 11329996-A-AGT *
13485667-CAG-C 11329991-CAG-C *
13483375-G-A 11327699-G-A *
13483216-TACTTCACAATACCCCCTGTAGTTGGAGCCTACACAAGAGTTACATCTCCTGGGTGATCAGTGCA-T 11327540-TACTTCACAATACCCCCTGTAGTTGGAGCCTACACAAGAGTTACATCTCCTGGGTGATCAGTGCA-T *
13462124-G-A 11306448-G-A *
56885327-G-A *
13449747-TCC-T 11294071-TCC-T *
13462108-C-G 11306432-C-G *
9965753-A-G 10128144-A-G Y*
9941724-G-A 10104115-G-A Y*
10632717-G-C,C *
10632714-CA-C,C *
9941725-G-A 10104116-G-A Y*
10632709-A-C,C *
9985162-G-T 10147553-G-T Y*
9967240-T-C 10129631-T-C Y*
9967238-A-C 10129629-A-C Y*
9967146-T-C 10129537-T-C Y*
9967017-A-G 10129408-A-G Y*
9965755-G-C 10128146-G-C Y*
9965095-C-G 10127486-C-G Y*
10632765-CAACTG-C,C *
9965066-A-AGT 10127457-A-AGT *
9960721-G-A 10123112-G-A Y*
9962672-C-T 10125063-C-T Y*
9965064-A-AG 10127455-A-AG *
9962678-G-A 10125069-G-A FT369810 Y*
9963991-A-C 10126382-A-C Y*
9964566-A-C 10126957-A-C Y*
9964371-C-T 10126762-C-T Y*
9964165-C-T 10126556-C-T Y*
9964164-TCA-T 10126555-TCA-T *
9964000-T-A 10126391-T-A Y*
9964089-T-C 10126480-T-C Y*
10632738-ATTCCATCCATATCATTCCATTCCC-A,A *
10632777-ACTCCTGTCCTCTTCT-A,A *
13449774-T-C,TCATTCAATTCCATCAC 11294098-T-C,TCATTCAATTCCATCAC *
13265203-A-G 11109527-A-G *
13449750-ATTC-A 11294074-ATTC-A *
9964142-A-G 10126533-A-G Y*
13449729-CATT-C 11294053-CATT-C *
9932085-TTTTA-T 10094476-TTTTA-T *
13449727-T-TAAA 11294051-T-TAAA *
13449082-GCACTCCACTCCATTCCACTC-G 11293406-GCACTCCACTCCATTCCACTC-G *
13449068-CACTT-C 11293392-CACTT-C *
13449066-TG-T 11293390-TG-T *
13448030-CCACTCCA-C 11292354-CCACTCCA-C *
13448026-CAT-C 11292350-CAT-C *
13447897-G-GTGCATTCCA 11292221-G-GTGCATTCCA *
13446323-G-T 11290647-G-T *
13250599-T-C 11094923-T-C *
10632799-TC-T,T *
13250598-G-T 11094922-G-T *
13247753-T-C 11092077-T-C *
13247752-C-T 11092076-C-T *
9932160-A-C 10094551-A-C Y*
13501422-A-G 11345746-A-G *
10693054-TTCA-T *
10677167-C-CACT *
10670972-TTTCCACTCCATTCCATTCTTTTCCACTCCATTCCATTCCATTCCATTCCA-T *
10670971-CTTTCCACTCCATTCCATTCT-C *
9936518-CT-C 10098909-CT-C *
10661491-TTTCAC-T *
9936520-G-C 10098911-G-C Y*
10910876-A-G *
13694705-T-A 11539029-T-A *
13501426-G-C 11345750-G-C *
10055491-T-C 10217882-T-C *
13478610-C-G 11322934-C-G *
13469194-T-A 11313518-T-A *
13469190-A-C 11313514-A-C *
13469166-G-A 11313490-G-A BY42184 *
13469154-G-A 11313478-G-A *
13463778-G-T 11308102-G-T *
13461936-G-A 11306260-G-A *
13461927-G-T 11306251-G-T *
10693383-C-CACTCCACTCCACTCCAT *
10678045-TC-T *
10678040-TCCAC-T *
10669556-T-C *
10055492-G-A 10217883-G-A *
9958039-G-A 10120430-G-A Y*
13478619-T-C 11322943-T-C *
9958035-T-A 10120426-T-A Y*
9943805-T-TAAC 10106196-T-TAAC *
9943800-AATC-A 10106191-AATC-A *
9941753-T-C 10104144-T-C Y*
9941728-C-A 10104119-C-A Y*
56884424-T-TA *
56877854-CAAAAAA-C,CA 18×A*
56869970-T-TGAG *
56869966-CAG-C *
56869964-A-ACT *
56869959-TCTC-T *
56861298-T-TTA *
56860115-G-GA,GA *
13478616-G-C 11322940-G-C *
13480389-TTA-T 11324713-TTA-T *
56839003-ACATTGTGACATATCTCTGCACTGATCACCCAGGTGATGCAACTCTTCTCTATGCTCTGCCTACAAACGG-A *
56830602-T-C *
9992572-C-T 10154963-C-T Y*
9992568-TTC-T 10154959-TTC-T *
9985171-G-T 10147562-G-T Y*
9985170-G-T 10147561-G-T Y*
9985163-C-T 10147554-C-T Y*
9984323-G-A 10146714-G-A Y*
9959873-TAATAATAATAA-T 10122264-TAATAATAATAA-T *
9941682-T-C 10104073-T-C Y*
56860676-A-ACAC *
56831671-CACTAAACTCG-C *
56831657-AGTC-A *
56831654-TCC-T *
56831650-C-G *
56830593-T-C *
13482235-C-G 11326559-C-G *
56830585-T-TTCCACTCCACTCCACTCCACAAC *
56830580-CATT-C *
28791426-TGGAATGTAAG-T 26645279-TGGAATGTAAG-T *
22509922-T-C 20348036-T-C DYZ19 *
22509037-C-T 20347151-C-T DYZ19 *
22508629-A-G 20346743-A-G DYZ19 *
13748441-TGGAATGGAA-T 11592765-TGGAATGGAA-T *
13748439-AC-A 11592763-AC-A *
13693717-TGGAAC-T 11538041-TGGAAC-T *
13693685-CCTAGAATGGAATGAA-C 11538009-CCTAGAATGGAATGAA-C *
13510267-GACAA-G 11354591-GACAA-G *
13489600-C-T 11333924-C-T *
13487853-G-T 11332177-G-T *
13482241-T-A 11326565-T-A *
56845056-AGGCTCTGCCTATAGTGGCATTGTGACATATCTCTGCACTGATCACCCATGTGATATAACTCTTGTCTG-A *
56835939-C-CACTCCACTCAATTCT *
13533289-A-AC 11377613-A-AC *
13705335-GGAATA-G 11549659-GGAATA-G *
13730735-A-C 11575059-A-C *
13730734-G-T 11575058-G-T *
13730520-A-C 11574844-A-C *
13730508-C-T 11574832-C-T *
13726024-TGGAATGGAA-T 11570348-TGGAATGGAA-T *
13726022-AC-A 11570346-AC-A *
13722336-TTCGAATGGAATGGAA-T 11566660-TTCGAATGGAATGGAA-T *
13721459-A-G 11565783-A-G *
13718301-AAATGGAATGGAAACG-A 11562625-AAATGGAATGGAAACG-A *
13711812-T-C 11556136-T-C *
13709577-A-T 11553901-A-T *
13705504-TGGAATGGAATGGAATGGAA-T 11549828-TGGAATGGAATGGAATGGAA-T *
13705496-GA-G 11549820-GA-G *
13705314-TGAAATGGCATGTAA-T 11549638-TGAAATGGCATGTAA-T *
13734768-CTGGAGTGGAATGGATTCAAATGGAATGGCAAGGAATGGAATGGAATGGAATGGAAAGCAAAGGAATCTACTGGAATAGAATCGAACGGAACAGAAAGGAATGGAATGGAA-C 11579092-CTGGAGTGGAATGGATTCAAATGGAATGGCAAGGAATGGAATGGAATGGAATGGAAAGCAAAGGAATCTACTGGAATAGAATCGAACGGAACAGAAAGGAATGGAATGGAA-C *
13704115-T-TGGA 11548439-T-TGGA *
13704114-C-CAA 11548438-C-CAA *
13696618-A-T 11540942-A-T *
10043363-A-G 10205754-A-G *
13694359-CTGGAGTGGAATGGATTTAAATGGAATGGAAAGGAATGTAATGTAAAGGAAGTGAAAGCAAAGGAATCTACTGGAATAGAATCGAACGGAACAGAAAGGAATGGAAAGGAA-C 11538683-CTGGAGTGGAATGGATTTAAATGGAATGGAAAGGAATGTAATGTAAAGGAAGTGAAAGCAAAGGAATCTACTGGAATAGAATCGAACGGAACAGAAAGGAATGGAAAGGAA-C *
13693626-A-G,T 11537950-A-G,T *
13693068-T-A 11537392-T-A *
13692007-T-TAATGGAATGAAATGG 11536331-T-TAATGGAATGAAATGG 5×AATGG*
13607821-ATT-A 11452145-ATT-A 10×T*
13551332-TAA-T 11395656-TAA-T *
13551328-A-AGG 11395652-A-AGG *
13538862-C-CA 11383186-C-CA *
13533290-T-TG 11377614-T-TG *
13734169-A-T 11578493-A-T *
13740151-A-G 11584475-A-G *
56835906-C-CTCCACTCCACTCAAT *
28810531-G-GGA 26664384-G-GGA *
56834817-C-CTCCACTCCACTCCACTCCAT *
56834192-T-TA *
56834188-TTA-T *
56833363-C-CTCCATTCCATTCCATTCTACTCCATTCCAT,T *
56833283-C-CTCCTTTCCATTCCATTCCACTCCACTCCATTCCACTCCACTCCATTCCACTCTACTCCCCTCCACTCCACTCCAT *
56832331-A-ACTCCTCTACATTCCC *
56832312-T-TTCAAC *
56832303-C-CCATT,T *
56830803-T-TCCGC *
56830265-CTCCATTCCTCTCCATTCCAT-C *
56827687-T-C,TGCCATCCGATTGCATGCCATCCGATTC *
28814691-AGGG-A 26668544-AGGG-A *
28810534-GCA-G 26664387-GCA-G *
28805240-AATGGAATGGAATG-A 26659093-AATGGAATGGAATG-A *
22249773-T-C 20087887-T-C DYZ19 *
28805236-ATGG-A 26659089-ATGG-A *
28805233-G-GAATGGAATGGAATA 26659086-G-GAATGGAATGGAATA *
28805232-T-TC 26659085-T-TC *
28803164-GTAAAAAGT-G 26657017-GTAAAAAGT-G *
28803161-GTA-G 26657014-GTA-G *
28797893-CGGTG-C 26651746-CGGTG-C *
28795411-GCA-G 26649264-GCA-G *
28795408-G-GGA 26649261-G-GGA *
28793510-GGAA-G 26647363-GGAA-G *
28793507-AAT-A 26647360-AAT-A *
22299719-CACTTAAAGTTGTTATGTCCAGAGTTTGTTCTTTCAGATGTGTCCAGAGTTTCTTTCTACTGGCAGGTTCATGGTCTTGCTCACTTCAATAATGAAGCTCCAGTCCGTTACGGTGAGTGTTACAGT-C 20137833-CACTTAAAGTTGTTATGTCCAGAGTTTGTTCTTTCAGATGTGTCCAGAGTTTCTTTCTACTGGCAGGTTCATGGTCTTGCTCACTTCAATAATGAAGCTCCAGTCCGTTACGGTGAGTGTTACAGT-C DYZ19 *
22279664-T-TGG 20117778-T-TGG DYZ19 *
22279658-CTT-C 20117772-CTT-C DYZ19 *
22249776-C-T 20087890-C-T DYZ19 *
13243650-C-A 11087974-C-A *
56832324-C-CCAATG *
9961054-C-A 10123445-C-A Y*
4336695-ATTTTT-A 4468654-ATTTTT-A 30×T*
13429218-G-T 11273542-G-T *
13429183-A-C 11273507-A-C *
13420038-C-T 11264362-C-T *
17592345-CTTTTTTTT-C 15480465-CTTTTTTTT-C 24×T*
13734378-A-T 11578702-A-T *
13709953-T-TTAATA 11554277-T-TTAATA 4×GAATG*
13510304-G-A 11354628-G-A *
13378555-T-C 11222879-T-C *
13725866-T-A,C 11570190-T-A,C *
13712422-G-T 11556746-G-T *
13448203-T-TCCATC,TCCATTCCATTCCATC 11292527-T-TCCATC,TCCATTCCATTCCATC *
13395933-A-C 11240257-A-C *
13395042-C-T 11239366-C-T *
6586786-CTTTTT-C 6718745-CTTTTT-C 22×T*
13440024-C-A 11284348-C-A *
3186741-CAA-C 3318700-CAA-C 15×A*
3755401-ATT-A 3887360-ATT-A 14×T*
3910070-TAA-T 4042029-TAA-T 12×A*
17604931-GT-G,GTT 15493051-GT-G,GTT 24×T*
12730473-AT-A,ATT 21×T*
2995859-TTG-T 3127818-TTG-T 8×TG*
13476533-A-T 11320857-A-T *
13606336-C-T 11450660-C-T *
13464536-T-C 11308860-T-C *
13734208-A-T 11578532-A-T *
13490777-TAAAAG-T 11335101-TAAAAG-T *
13435726-TA-T 11280050-TA-T *
13375669-T-TAA 11219993-T-TAA *
13439544-T-G 11283868-T-G *
13445284-T-TG 11289608-T-TG *
13690138-T-A 11534462-T-A *
28794143-G-T 26647996-G-T *
13470514-A-C 11314838-A-C *
13470490-T-A 11314814-T-A *
13469158-C-T 11313482-C-T *
13538867-T-G 11383191-T-G *
3796333-CTATA-C 3928292-CTATA-C 9×TA*
20819998-CTT-C,CT 18658112-CTT-C,CT P4_Gap 21×T*
13464027-G-T 11308351-G-T *
13464020-C-T 11308344-C-T *
13464018-C-T 11308342-C-T *
13458750-C-G 11303074-C-G *
21753670-A-G *
56724919-G-A *
28811013-C-T 26664866-C-T *
22447488-G-T 20285602-G-T DYZ19 *
13446271-A-G 11290595-A-G *
22447444-G-C 20285558-G-C DYZ19 *
22447434-G-A 20285548-G-A DYZ19 *
13977176-T-C 11856470-T-C Y*
13721666-A-C 11565990-A-C *
13712462-G-T 11556786-G-T *
13711806-A-T 11556130-A-T *
13694712-AAATGG-A 11539036-AAATGG-A *
13590731-A-G 11435055-A-G *
13590730-C-T 11435054-C-T *
13590702-C-T 11435026-C-T *
13590701-G-A 11435025-G-A *
13587178-T-A 11431502-T-A *
13556428-G-T 11400752-G-T *
13556425-G-C 11400749-G-C *
13497335-G-A,C 11341659-G-A,C *
56848633-CT-C *
13532889-GA-G 11377213-GA-G 10×A*
13706130-A-C 11550454-A-C *
56863936-A-G *
56863894-T-C *
28811050-A-T 26664903-A-T *
28807233-C-A 26661086-C-A *
28807218-A-T 26661071-A-T *
28585743-C-T 26439596-C-T *
22509312-C-A 20347426-C-A DYZ19 *
22270509-C-G 20108623-C-G BY215007 DYZ19 *
13739898-T-C 11584222-T-C *
13730719-T-C 11575043-T-C *
13730083-C-G 11574407-C-G *
13709418-C-T 11553742-C-T *
13709417-A-G 11553741-A-G *
13701392-A-C 11545716-A-C *
9961067-A-T 10123458-A-T Y*
13701389-G-T 11545713-G-T *
13687993-A-T 11532317-A-T *
13687985-T-C 11532309-T-C FT448439 *
13611331-C-G 11455655-C-G *
13611330-C-CT 11455654-C-CT *
13598385-T-C 11442709-T-C *
13563699-G-A 11408023-G-A *
13558741-G-T 11403065-G-T *
13558401-A-C 11402725-A-C *
13558394-T-C 11402718-T-C *
13558367-G-A 11402691-G-A *
13558345-T-G 11402669-T-G *
13558165-G-C 11402489-G-C *
13558127-T-A 11402451-T-A *
9960735-A-T 10123126-A-T Y*
10057160-A-G 10219551-A-G *
13689050-GGAAGA-G 11533374-GGAAGA-G *
13587161-C-T 11431485-C-T *
13553266-C-CAGAA 11397590-C-CAGAA *
13245065-G-GTCTTGCTC 11089389-G-GTCTTGCTC *
56878341-C-T *
56878340-T-C *
56875554-T-A *
56865466-C-A,T *
28585356-G-A 26439209-G-A *
13702205-A-G 11546529-A-G *
13694211-T-A 11538535-T-A *
13690155-A-C 11534479-A-C *
13606401-A-C 11450725-A-C *
13598478-A-G 11442802-A-G FGC81996 *
13598437-A-T 11442761-A-T *
13586770-C-T 11431094-C-T *
10057171-G-T 10219562-G-T *
13551381-G-A 11395705-G-A *
13532842-TA-T 11377166-TA-T 9×A*
13524078-G-A 11368402-G-A *
13522317-G-A 11366641-G-A *
13514284-G-T 11358608-G-T *
13506614-A-T 11350938-A-T *
13489228-G-T 11333552-G-T *
13489203-C-T 11333527-C-T *
13484120-C-T 11328444-C-T *
13482312-G-A 11326636-G-A *
13482205-C-A 11326529-C-A *
13252415-A-C 11096739-A-C *
13245130-G-T 11089454-G-T *
10908302-G-A *
6059545-CAA-C 6191504-CAA-C 12×A*
4381152-G-GT 4513111-G-GT 10×T*
59024019-A-G 56877872-A-G *
13607532-A-G 11451856-A-G *
13515252-G-C 11359576-G-C *
13244129-G-A 11088453-G-A *
5744767-C-CT 5876726-C-CT 10×T*
18804525-AGC-A 16692645-AGC-A *
4376142-CAAA-C,CAAAA 4508101-CAAA-C,CAAAA 26×A*
13728938-A-G 11573262-A-G *
22510762-G-C 20348876-G-C DYZ19 *
10692434-T-TTACAA *
9934802-G-T 10097193-G-T Y*
56884762-C-T *
28549514-G-A 26403367-G-A *
14646262-C-G 12534326-C-G YY*
14646203-G-T 12534267-G-T YY*
13607516-T-C 11451840-T-C *
13488450-G-T 11332774-G-T *
13487898-C-T 11332222-C-T *
13372572-C-T 11216896-C-T *
9944114-C-T 10106505-C-T Y*
22509907-T-A 20348021-T-A DYZ19 *
13638451-A-G 11482775-A-G *
13611506-T-C 11455830-T-C *
13563578-A-T 11407902-A-T *
13556437-A-T 11400761-A-T *
13501431-CTTA-C 11345755-CTTA-C *
13482242-T-C 11326566-T-C *
13435916-A-AT 11280240-A-AT *
13435132-G-T 11279456-G-T *
13417416-T-C 11261740-T-C *
13404453-G-A 11248777-G-A *
13461892-T-G 11306216-T-G *
17143891-ATT-A,AT 15032011-ATT-A,AT 35×T*
10054175-A-AC 10216566-A-AC *
10693720-A-T *
13475301-C-T 11319625-C-T *
17143169-T-TA 15031289-T-TA 10×A*
56856103-CAAAA-C,CAA 14×A*
13690745-C-G 11535069-C-G *
13607493-C-T 11451817-C-T *
13607490-T-C 11451814-T-C *
6133266-A-G 6265225-A-G *
13464532-G-A 11308856-G-A *
4044605-A-G 4176564-A-G *
13462394-G-A 11306718-G-A BY85613 *
13577962-G-A 11422286-G-A *
13390333-A-G 11234657-A-G *
3181857-CAA-C,CA 3313816-CAA-C,CA 20×A*
13490161-T-C 11334485-T-C *
5022053-C-T 5154012-C-T *
4880709-GTT-G,GTTT 5012668-GTT-G,GTTT 22×T*
56884016-CA-C 8×A*
14747961-C-CTTT 12636030-C-CTTT 22×T*
13464058-G-A 11308382-G-A *
15321328-GTT-G,GTTT 13209446-GTT-G,GTTT 25×T*
13476689-G-C 11321013-G-C *
13476656-G-C 11320980-G-C *
5400468-CTTTT-C 5532427-CTTTT-C 19×T*
22508927-G-T 20347041-G-T DYZ19 *
19753693-CTT-C,CT 17641813-CTT-C,CT P5_Prx 25×T*
28564242-AG-A 26418095-AG-A *
28564241-G-C 26418094-G-C FTB34670 *
17158968-CT-C,CTT 15047088-CT-C,CTT 26×T*
13464549-C-T 11308873-C-T *
13243633-C-T 11087957-C-T *
10022550-G-A 10184941-G-A Y*
4890660-CA-C,CAA 5022619-CA-C,CAA 18×A*
13244812-G-A 11089136-G-A *
10935579-C-CTCCAT,T *
13466968-C-G 11311292-C-G *
56875781-G-GT,GTTTT 9×T*
28580057-G-A 26433910-G-A *
28579995-G-A 26433848-G-A *
13607590-C-T 11451914-C-T FT354037 *
13475283-A-T 11319607-A-T *
13470574-A-C 11314898-A-C *
13465399-A-T 11309723-A-T *
13465314-G-A 11309638-G-A *
13440063-A-C 11284387-A-C *
13395026-A-G 11239350-A-G *
13351764-C-T 11196088-C-T *
9977044-T-C 10139435-T-C Y*
13716467-A-T 11560791-A-T *
13469659-A-G 11313983-A-G *
13466971-G-C 11311295-G-C *
3394337-CTTT-C,CTTTT 3526296-CTTT-C,CTTTT 21×T*
28564239-G-GC 26418092-G-GC *
13476567-C-A 11320891-C-A *
13462107-T-A 11306431-T-A *
4505414-ATT-A,AT 4637373-ATT-A,AT 22×T*
13466961-G-A 11311285-G-A *
13466954-A-G 11311278-A-G *
13466939-C-G 11311263-C-G *
22509006-G-A 20347120-G-A DYZ19 *
13492395-A-AG 11336719-A-AG *
13444949-C-T 11289273-C-T *
7310571-CT-C,CTT 7442530-CT-C,CTT 21×T*
22288244-C-A 20126358-C-A DYZ19 *
9965745-T-G 10128136-T-G Y*
10022522-G-C 10184913-G-C Y*
9980561-C-T 10142952-C-T Y*
9980654-C-T 10143045-C-T Y*
9980593-A-AT 10142984-A-AT *
9976830-C-A 10139221-C-A Y*
9943642-G-T 10106033-G-T Y*
28580052-A-G 26433905-A-G *
13641612-AT-A 11485936-AT-A 9×T*
13502628-AC-A 11346952-AC-A *
13501413-C-T 11345737-C-T *
13464055-C-T 11308379-C-T *
13432941-G-A 11277265-G-A *
13372413-A-T 11216737-A-T *
13348767-T-C 11193091-T-C *
10055448-A-G 10217839-A-G *
9977058-G-A 10139449-G-A Y*
13465313-A-C 11309637-A-C *
9965880-G-A 10128271-G-A Y*
9964722-C-T 10127113-C-T Y*
9964117-G-T 10126508-G-T Y*
9964105-C-T 10126496-C-T Y*
13501398-A-G 11345722-A-G *
13372435-T-C 11216759-T-C *
13372426-A-C 11216750-A-C *
13247759-T-C 11092083-T-C *
13244201-G-A 11088525-G-A *
9967347-A-G 10129738-A-G Y*
2925592-CTT-C 3057551-CTT-C 15×T*
28586795-T-C 26440648-T-C *
5380518-CA-C,CAA 5512477-CA-C,CAA 16×A*
13479233-T-A 11323557-T-A *
9992575-A-ATG 10154966-A-ATG *
5492465-G-T 5624424-G-T FT364677 *
13267907-TACAGGC-T 11112231-TACAGGC-T *
13464535-C-G 11308859-C-G *
11314950-A- *
13470625-CACT-C 11314949-CACT-C *
13470605-C-G 11314929-C-G *
13469201-A-G 11313525-A-G *
13469200-C-CTT 11313524-C-CTT *
13469196-CCT-C 11313520-CCT-C *
13469186-T-C 11313510-T-C BY85809 *
13465099-C-G 11309423-C-G *
13465072-G-T 11309396-G-T *
13465043-C-G 11309367-C-G *
13464983-A-T 11309307-A-T *
13464560-A-T 11308884-A-T *
13464548-C-A 11308872-C-A *
13464523-C-G 11308847-C-G *
13472008-TAGG-T 11316332-TAGG-T *
13464518-A-G 11308842-A-G *
13463339-G-T 11307663-G-T *
13461929-G-T 11306253-G-T *
13461862-CT-C 11306186-CT-C *
13461859-AGT-A 11306183-AGT-A *
13461258-A-C 11305582-A-C *
13460999-A-C 11305323-A-C *
13458771-C-A 11303095-C-A *
13458768-T-A 11303092-T-A *
11296314-CTGCTCTCCAATCCACTCCAATCCAT- *
13449960-T-TTCCATACCATTCCATTCCATTGCATTCCACTCCATTCCACTCCACTCCAATCAACTCCACTCCACTCCACTTCACTCCAATCCACTCCAC,TTCCATTCCATACCATTCCATTCCATTGCATTCCACTCCATTCCACTCCACTCCAATCAACTCCACTCCACTCCACTTCACTCCAATCCACTCCAC 11294284-T-TTCCATACCATTCCATTCCATTGCATTCCACTCCATTCCACTCCACTCCAATCAACTCCACTCCACTCCACTTCACTCCAATCCACTCCAC,TTCCATTCCATACCATTCCATTCCATTGCATTCCACTCCATTCCACTCCACTCCAATCAACTCCACTCCACTCCACTTCACTCCAATCCACTCCAC *
13448853-A-ACTTCATTCCATTCCACTCCACTC 11293177-A-ACTTCATTCCATTCCACTCCACTC *
13448852-T-TCC 11293176-T-TCC *
13470630-C-CATA 11314954-C-CATA *
13472014-C-CCCGG 11316338-C-CCCGG *
13448777-TCTAC-T 11293101-TCTAC-T *
13484141-A-G 11328465-A-G *
13566151-G-A 11410475-G-A *
13551712-C-T 11396036-C-T *
13536358-G-A 11380682-G-A *
13524112-G-C 11368436-G-C *
13489846-T-C 11334170-T-C *
11334057-C- *
11333954-CA- *
11333952-AC- *
11333951-CACCA- *
13489311-G-A 11333635-G-A *
13488716-A-ATGCTG 11333040-A-ATGCTG *
13487458-G-C 11331782-G-C *
13485723-T-TAAGTGATCAGTGAA 11330047-T-TAAGTGATCAGTGAA *
13482099-A-C 11326423-A-C *
13472016-GTA-G 11316340-GTA-G *
13482091-A-G 11326415-A-G *
13479161-A-C 11323485-A-C *
13479151-G-T 11323475-G-T *
13479098-G-A 11323422-G-A *
13479095-C-A 11323419-C-A *
13478995-G-C 11323319-G-C *
13478970-T-G 11323294-T-G *
13478448-G-C 11322772-G-C *
13478403-A-AACGGAGTCCCCTGGGGAGCAGGAGGTCTTGAAAGAGGCCGCCTC 11322727-A-AACGGAGTCCCCTGGGGAGCAGGAGGTCTTGAAAGAGGCCGCCTC *
13476736-G-C 11321060-G-C *
13476715-C-G 11321039-C-G *
13476672-C-A 11320996-C-A *
13476534-T-A 11320858-T-A *
13474775-G-C 11319099-G-C *
13448836-CTCCATTCCATTCCACTACAGTCCAT-C 11293160-CTCCATTCCATTCCACTACAGTCCAT-C *
13448775-AC-A 11293099-AC-A *
13687047-T-C,C 11531371-T-C,C 5×GAATG*
6374210-A-T 6506169-A-T *
8172691-T-TC 8304650-T-TC *
7784426-T-C 7916385-T-C YY*
7415624-T-TGATA,TGATAGATA 7547583-T-TGATA,TGATAGATA 10×GATA*
7387396-A-ATT,ATTT 7519355-A-ATT,ATTT 22×T*
7364287-TACAA-T 7496246-TACAA-T *
7217158-T-G 7349117-T-G YY*
7196066-AG-A 7328025-AG-A *
7179734-GT-G,GTTT 7311693-GT-G,GTTT 25×T*
7135152-C-G 7267111-C-G Y*
7131982-T-C 7263941-T-C YY*
7131974-CGACAGG-C 7263933-CGACAGG-C *
7141150-T- *
6792660-G-T 6924619-G-T YY*
6118585-A-C 6250544-A-C *
8224136-T-A 8356095-T-A YY*
5827399-A-G 5959358-A-G *
5548870-T-C 5680829-T-C *
5523917-CTT-C,CTTT 5655876-CTT-C,CTTT 24×T*
5519905-T-TAA 5651864-T-TAA 13×A*
5492439-C-CT,CTT 5624398-C-CT,CTT 18×T*
5491261-CAAAAA-C 5623220-CAAAAA-C 18×A*
5456039-C-G 5587998-C-G *
5430834-G-T 5562793-G-T *
5553434-CCTCCCT- *
5421472-ATCCC-A 5553431-ATCCC-A 4×TCCC*
5388183-T-C 5520142-T-C FT253222 *
5270664-G-T 5402623-G-T *
5102621-A-G 5234580-A-G *
5078160-A-G 5210119-A-G *
8224134-G-GCCCC 8356093-G-GCCCC *
8224137-CGGGG-C 8356096-CGGGG-C *
13448751-C-G 11293075-C-G *
10956561-CTCCAT-C,C *
13437310-T-A 11281634-T-A *
13433638-CTTTTT-C 11277962-CTTTTT-C 11×T*
13428902-C-T 11273226-C-T *
13354869-A-AAT 11199193-A-AAT *
13272438-A-G 11116762-A-G *
13272416-C-T 11116740-C-T *
13267613-A-AAAAAAAAG 11111937-A-AAAAAAAAG *
13206784-C-CA,CAAAA 11051108-C-CA,CAAAA 14×A*
10989152-C-CATTCAACTCCACACCATTCCACTCCATTCCTCTCA,CATTCAACTCCACACCATTCCACTCCATTCCTCTCA *
10987306-T-G *
10987299-T-C *
10987283-T-A *
10958311-C-CTCCATTCCATTCCATTCCAT *
10693240-A- *
8224148-C-G 8356107-C-G YY*
10677518-T-TTCCATTCCATTCCTTTCCATTCCATTCCATTCCATTCCTTTCCATTCCATTCCATTCCATTCCGC *
9949836-T-C 10112227-T-C Y*
9887976-G-T 10050367-G-T Y*
9887973-TGG-T 10050364-TGG-T *
9887968-A-AATCC 10050359-A-AATCC *
9887967-G-C 10050358-G-C Y*
9887960-CTGGA-C 10050351-CTGGA-C *
9518594-TACAC-T,TAC 9680985-TACAC-T,TAC 14×AC*
9523585-A- *
9070171-T-C 9232562-T-C Y*
8705986-TTTTTC-T 8837945-TTTTTC-T *
8694916-A-G,G 8826875-A-G,G *
8281875-A-G 8413834-A-G YY*
8281863-A-G 8413822-A-G YY*
13611213-T-A 11455537-T-A *
13687052-G-T,T 11531376-G-T,T *
4764839-G-A 4896798-G-A *
22510806-G-T 20348920-G-T BY36790 DYZ19 *
28628197-A-ATTTGTTTTTTTG 26482050-A-ATTTGTTTTTTTG *
28586813-T-A 26440666-T-A *
28549444-G-A 26403297-G-A *
25511351-ATT-A 23365204-ATT-A P1_gr1 14×T*
25080655-CAA-C 22934508-CAA-C g1 13×A*
24573423-CTTTT-C,CTTT 22427276-CTTTT-C,CTTT P3_t2 21×T*
24522166-ATCTC-A,A 22376019-ATCTC-A,A 14×TC*
24512761-T-C 22366614-T-C *
24385963-T-C 22239816-T-C *
23825523-TGAGGCC-T 21663637-TGAGGCC-T *
22950508-A-G 20788622-A-G YY*
22510911-G-T 20349025-G-T DYZ19 *
22510853-T-A 20348967-T-A DYZ19 *
22509583-C-G 20347697-C-G DYZ19 *
28802570-AATT-A 26656423-AATT-A *
22509569-T-C 20347683-T-C DYZ19 *
22509568-T-A 20347682-T-A DYZ19 *
22489639-G-T 20327753-G-T DYZ19 *
22489630-C-T 20327744-C-T DYZ19 *
22489628-T-A 20327742-T-A DYZ19 *
22479339-G-T 20317453-G-T BY50108 DYZ19 *
22477470-T-C 20315584-T-C BY223814 DYZ19 *
22477056-G-A 20315170-G-A DYZ19 *
22476824-GT-G 20314938-GT-G DYZ19 *
22465933-T-A 20304047-T-A DYZ19 *
22463348-A-G 20301462-A-G DYZ19 *
22448723-C-G 20286837-C-G DYZ19 *
22359625-G-C 20197739-G-C DYZ19 *
22359608-A-T 20197722-A-T DYZ19 *
28628198-A-G 26482051-A-G *
26666030-ATGGAATGGAGTGGAATGGAGTGGATTGGAATGGAATGGAGTGCAGAGGAATGGAATGGAATGGTATAGAGTGGACAGGAATAGAG- *
22279145-A-C 20117259-A-C DYZ19 *
56826961-C- *
56876124-CAAAAAAAAAAAAAAAAAAAAAA-C 50×A*
56850900-T-C *
56844271-ACTGATCATCGAGGTGATGCAACTCTTGTCTGGGATCTGCCTACGGGTGGCATTGTGACATATCTCTGAC- *
56844266-A- *
56843830-T-TTGCCTACAGGGGACATTTTGACATAGCTCTGCACTGATCACCCGGGTGATGCAACTCTTCTCTATGTTC *
56834395-C-CTCCACTCCACTCCATTCCACTCCTATCCACTCCAT *
56833341-T- *
56833273-TTCCACTCCAC- *
56832539-C-CCAT,T *
56832492-CACCGCACTCCACTCCACTCCACTCA- *
56832059-ACTCCACCCCACT- *
56832054-ACTC- *
56827931-TTCTATTCCATTCCATTAAATTTGAATCCATTCCATTCCATTCCAGTCCATTCCTTTCAAGTCCATTCAATTCCATTCCGTTCGAATTCATTCCATTCCATTCCATTTGATTCCATTCCATGCCATTCCATTCAATTCAATTCCATTCGATTCCATTCCATTCAAATCAATTCCATTCCAATCCATTCCATTCCATTCTATTCCATTCCATTCCAC- *
56825990-GAGTTCATTCCATTCGAGTTCCTTCCATTCGAGTTCATTCCATTCGAGTTCATTCCATTCCAGTCCAATCCATTCGAGTCCATTCCATTCCAGTCCTGTATTCGATTCCATTCCATTCCATTCCACTCGATTCCATTCCACTCGATTCCATTCCACTCGATTCCATTCCATTTGATTCTATTCCATTCCATTCC- *
28818186-G-A 26672039-G-A *
56825911-A- *
56823565-G-A *
56822369-C-T *
56763571-GA-G *
56763436-T-C *
56763420-A-G *
56763419-A-C *
56763412-G-T *
56749835-G-T *
56715409-C-T *
56707045-A-T *
56707002-T-G *
56706993-G-GGAAT *
28818221-G-C 26672074-G-C *
22287577-T-C 20125691-T-C DYZ19 *
22279118-A-T 20117232-A-T DYZ19 *
13699187-C-G 11543511-C-G *
15002065-G-T 12890150-G-T YY*
16665419-A-G 14553539-A-G Y*
16627390-A-G 14515510-A-G YY*
16427954-T-TGC 14316074-T-TGC *
16427952-T-TTA 14316072-T-TTA *
16427946-A-G 14316066-A-G Y*
16427940-G-A 14316060-G-A Y*
16427937-T-C 14316057-T-C Y*
16427931-C-T 14316051-C-T Y*
16205522-G-T 14093642-G-T YY*
16185899-G-T 14074019-G-T Y*
15779891-TG-T 13668011-TG-T *
15752638-C-CCTT,CCTTCTT 13640758-C-CCTT,CCTTCTT 25×CTT*
15117050-A-G 13005137-A-G Y*
14969178-GCCA-G 12857253-GCCA-G *
17045915-A-G 14934035-A-G YY*
14969177-A-ATGT 12857252-A-ATGT *
14301917-G-A 12181211-G-A Y*
14031854-T-C 11911148-T-C YY*
13941693-A-ATTTT 11820987-A-ATTTT 15×T*
13909328-G-T 11788622-G-T YY*
13737092-G-T 11581416-G-T *
13730019-C-G 11574343-C-G *
11567292-G- *
11567289-A- *
13718223-A-G 11562547-A-G *
13711809-G-T 11556133-G-T *
13708360-GGAATGGAATGGACTCGAATGGAGAAGAGAC-G 11552684-GGAATGGAATGGACTCGAATGGAGAAGAGAC-G *
13702109-G-T 11546433-G-T *
13701956-C-CTCGAAAGGAATTGACTCGAAAGGAATGG,G 11546280-C-CTCGAAAGGAATTGACTCGAAAGGAATGG,G *
16865027-T-C 14753147-T-C YY*
17313273-C-CTGTAT,CTGTAT 15201393-C-CTGTAT,CTGTAT 11×TGTAT*
22279091-G-T 20117205-G-T DYZ19 *
21238639-C-T 19076753-C-T YY*
22278229-A-T 20116343-A-T DYZ19 *
22270553-T-C 20108667-T-C DYZ19 *
22270546-G-T 20108660-G-T DYZ19 *
22270468-C-T 20108582-C-T DYZ19 *
20108506-T- DYZ19 *
22267828-C-T 20105942-C-T DYZ19 *
22267188-T-A 20105302-T-A DYZ19 *
22266721-A-G 20104835-A-G DYZ19 *
22266685-C-A 20104799-C-A DYZ19 *
22240056-A-T 20078170-A-T DYZ19 *
22238340-GTCTGCAGCTTCATTCTTGAAGTGAGCAAGACCATGAACCTGCCAGAAGGAAGAAACTCTGAACACATCTGAAGGAACAAACTCTGGACATAACACCTTTAAGTGCTATGACACTCACCGTAAAGT-G,G 20076454-GTCTGCAGCTTCATTCTTGAAGTGAGCAAGACCATGAACCTGCCAGAAGGAAGAAACTCTGAACACATCTGAAGGAACAAACTCTGGACATAACACCTTTAAGTGCTATGACACTCACCGTAAAGT-G,G DYZ19 *
22237711-CA-C 20075825-CA-C DYZ19 *
22051762-CT-C 19889876-CT-C *
20105742-T-TTATCTATC,TTATCTATC 17993862-T-TTATCTATC,TTATCTATC P5_Dst 14×TATC*
17662010-ATG-A,A 15550130-ATG-A,A 21×TG*
19504040-A-G 17392160-A-G YY*
19500150-GTAGA-G,G 17388270-GTAGA-G,G 14×TAGA*
19050338-TG-T 16938458-TG-T *
18931754-G-A 16819874-G-A YY*
18931750-G-C 16819870-G-C YY*
18931749-G-C 16819869-G-C YY*
18931748-G-C 16819868-G-C YY*
18931744-T-C 16819864-T-C YY*
18756798-GTTTT-G,GTTT 16644918-GTTTT-G,GTTT 19×T*
18662265-T-G 16550385-T-G YY*
18539000-T-C 16427120-T-C Y*
18423845-A-G 16311965-A-G P6_Gap *
18124632-TA-T,T 16012752-TA-T,T 15×A*
17795312-C-A 15683432-C-A YY*
5028324-T-A 5160283-T-A *
4678058-GTTT-G 4810017-GTTT-G 15×T*
13267917-TGCCACCACACC-T 11112241-TGCCACCACACC-T *
13488706-CCG-C 11333030-CCG-C *
13463623-G-A 11307947-G-A *
13463618-C-T 11307942-C-T *
13479185-C-T 11323509-C-T *
5219359-G-A 5351318-G-A *
56848976-A-G,T *
56830805-C-CA *
28793494-TGG-T 26647347-TGG-T *
28588048-TAC-T 26441901-TAC-T *
28549880-GCCAGGGCCAGAGCCAGGGCCAGGGCCTGGGCAGGA-G 26403733-GCCAGGGCCAGAGCCAGGGCCAGGGCCTGGGCAGGA-G *
13722041-A-C 11566365-A-C *
13502682-T-C 11347006-T-C *
13488824-A-AGT 11333148-A-AGT *
13488740-C-G 11333064-C-G *
13476870-C-G 11321194-C-G *
13463919-A-T 11308243-A-T *
13476653-C-A 11320977-C-A *
13469149-C-G 11313473-C-G *
13465051-A-T 11309375-A-T *
13449947-C-CCT 11294271-C-CCT *
13255777-C-G 11100101-C-G *
56867476-T-A,TAA *
56827971-TTCCAGTCCATTCCTTTCAAGTCCATTCAATTCCATTCCGTTCGAATTCATTCCATTCCATTCCATTTGATTCCATTCCATGCCATTCCATTCAATTCAATTCCATTCGATTCCATTCCATTCAAATCAATTCCATTCCAATCCATTCCATTCCATTCTATTCCATTCCATTCCAC-T *
13483369-C-A 11327693-C-A *
13349189-T-G 11193513-T-G *
13269594-CAAA-C 11113918-CAAA-C *
13269588-CAAAA-C 11113912-CAAAA-C *
56855154-C-T *
56850025-A-G *
13463643-C-T 11307967-C-T BY85662 *
13463969-G-C 11308293-G-C *
22446666-CTG-C 20284780-CTG-C DYZ19 *
13479138-C-A 11323462-C-A *
13476651-T-C 11320975-T-C *
13476643-T-A 11320967-T-A *
13476598-C-A 11320922-C-A *
13469527-G-T 11313851-G-T *
13463949-T-TA 11308273-T-TA 8×C*
13462079-T-A 11306403-T-A *
13448871-CTTCATTCCATTCCACTCCACTCCAG-C 11293195-CTTCATTCCATTCCACTCCACTCCAG-C *
10978918-C-T *
22436387-TTTACAGCAATTAAAGGTGTTATGTCCAGAGTTTGTTCCTTCAGATGTGTCCAGAGTTTCTTCCTTCTGGCAGGTTCATGGGCTTGCTCACTTCAAGAATGAAGCTGCAGACCTTTACGGTGAGTG-T 20274501-TTTACAGCAATTAAAGGTGTTATGTCCAGAGTTTGTTCCTTCAGATGTGTCCAGAGTTTCTTCCTTCTGGCAGGTTCATGGGCTTGCTCACTTCAAGAATGAAGCTGCAGACCTTTACGGTGAGTG-T DYZ19 *
22238317-T-G,G 20076431-T-G,G DYZ19 *
13474778-T-G 11319102-T-G *
56835940-A-ACTCCACTCAATTCCACTCCACGCAATTCCACTCCACTCAATTCCACTCCACTCTG *
13707391-TAC-T 11551715-TAC-T *
13479097-T-C 11323421-T-C *
13463972-C-G 11308296-C-G *
13462411-A-G 11306735-A-G *
10859967-A-ATTCAGTGCCATTCTATTCCTTTCAATACCATTCAATTCCATTCCACTCCT *
10693238-CCA-C *
10693237-T-TTA *
13488845-C-A 11333169-C-A *
13487969-C-G 11332293-C-G *
13487946-G-T 11332270-G-T *
13479168-A-T 11323492-A-T *
13479153-C-G 11323477-C-G *
13479152-C-T 11323476-C-T *
13479068-G-C 11323392-G-C *
13476701-G-C 11321025-G-C *
13469497-A-G 11313821-A-G *
13463974-G-T 11308298-G-T *
56836297-C-CCATTG *
22237713-C-G 20075827-C-G DYZ19 *
13479109-G-A 11323433-G-A *
13722988-G-C 11567312-G-C *
13462386-G-C 11306710-G-C *
13449772-TC-T 11294096-TC-T *
13398348-GA-G 11242672-GA-G *
13398344-TAAA-T 11242668-TAAA-T *
13348781-A-AT 11193105-A-AT *
13348778-G-A 11193102-G-A *
13254680-C-T 11099004-C-T *
10661330-C-CCCATCCCATCCCATTCCATTCCATTCCATTCCATTCCATTCCATTCCATT *
56845015-ATATCACTGCACTGATCACCCATGTGATATAACTCTTGTCTAGGCTCTGCCTATAG-A *
56845005-TCATTGTG-GCATTGTG,T *
56844998-CCACGCG-C *
56831613-TTCCATTCCTCTCTATTTCAC-T *
22508270-TCACTTCAAGAATGAAGCTGCAGACATTACTGGTGAGTGTTACAGCACTTAAAGGTGTTATGTCCAGAGTTTGTTCCG-T 20346384-TCACTTCAAGAATGAAGCTGCAGACATTACTGGTGAGTGTTACAGCACTTAAAGGTGTTATGTCCAGAGTTTGTTCCG-T DYZ19 *
13722964-CATGGA-C 11567288-CATGGA-C 5×ATGGA*
13464033-T-A 11308357-T-A *
13543634-A-C 11387958-A-C *
13722920-A-T 11567244-A-T *
13489904-A-T 11334228-A-T *
13489862-C-T 11334186-C-T *
13488820-C-G 11333144-C-G *
13488410-A-G 11332734-A-G *
13479001-C-A 11323325-C-A *
13478431-T-G 11322755-T-G *
13486460-C-G 11330784-C-G *
13450790-TGG-CGG,T 11295114-TGG-CGG,T *
13450104-CTCCACTCCACCCCATCCCATCCCATTCTATTCCAT-C,TTCCACTCCACCCCATCCCATCCCATTCTATTCCAT 11294428-CTCCACTCCACCCCATCCCATCCCATTCTATTCCAT-C,TTCCACTCCACCCCATCCCATCCCATTCTATTCCAT *
13395387-G-C 11239711-G-C *
13372542-T-C 11216866-T-C *
13372539-T-C 11216863-T-C *
13464028-A-G 11308352-A-G *
13464036-C-A 11308360-C-A *
13692979-GGAATA-G 11537303-GGAATA-G *
56834769-G-GTATTCCATTCCAGTCCATTCCATTACATTCCA *
13599051-TGATGAGA-T 11443375-TGATGAGA-T *
13514494-G-A 11358818-G-A *
13484151-C-T 11328475-C-T BY177510 *
13476856-T-A 11321180-T-A *
13444667-G-T 11288991-G-T *
13433552-GAAAATTTTCTTTTTCTGTGTAATAGTTTATCAGCATGA-G 11277876-GAAAATTTTCTTTTTCTGTGTAATAGTTTATCAGCATGA-G *
13418481-T-C 11262805-T-C *
13267936-CATTTTTTTATTTTTAGTAGAGATAGGGTATCACCATGTTGGG-C 11112260-CATTTTTTTATTTTTAGTAGAGATAGGGTATCACCATGTTGGG-C *
9992725-G-A 10155116-G-A Y*
9992719-T-A 10155110-T-A Y*
9932259-C-T 10094650-C-T Y*
9932249-C-A 10094640-C-A Y*
56884425-T-TAA 8×TA*
56825979-GCATTCCATTCGAGTTCATTCCATTCGAGTTCCTTCCATTCGAGTTCATTCCATTCGAGTT-G *
13468187-C-A 11312511-C-A *
28810114-GAGTGAAGTGGATTGGAGTGGAATGGAGTGCAATGGACTGGAGTGGATTGGAATGGAT-G 26663967-GAGTGAAGTGGATTGGAGTGGAATGGAGTGCAATGGACTGGAGTGGATTGGAATGGAT-G *
28810102-TGGAGAGGA-T 26663955-TGGAGAGGA-T *
14646228-A-G 12534292-A-G YY*
14646227-C-T 12534291-C-T YY*
14646209-A-T 12534273-A-T YY*
14646187-A-G 12534251-A-G YY*
14646186-C-T 12534250-C-T YY*
13708042-G-C 11552366-G-C *
13489910-C-T 11334234-C-T *
13489900-A-C 11334224-A-C *
13489886-C-T 11334210-C-T *
13489854-C-A 11334178-C-A *
13469106-A-C 11313430-A-C *
13469086-G-T 11313410-G-T *
13478976-G-A 11323300-G-A *
13485974-G-T 11330298-G-T *
4524137-C-A 4656096-C-A *
28791481-T-A 26645334-T-A *
11333956-CCCA- *
13488711-ACG-A 11333035-ACG-A *
9965062-T-A 10127453-T-A Y*
26099825-T-G 23953678-T-G P1_Y1 *
11334058-C- *
13489270-C-T 11333594-C-T *
13479177-C-T 11323501-C-T *
13465100-G-T 11309424-G-T BY48388 *
10669563-C-G *
10669553-C-T *
10669543-CCGT-C *
10669540-ATT-A *
28791498-G-T 26645351-G-T *
13730084-A-G 11574408-A-G *
13461856-G-GATA 11306180-G-GATA *
13730073-T-C 11574397-T-C *
13707394-C-CGT 11551718-C-CGT *
13487476-G-T 11331800-G-T *
13487454-C-A 11331778-C-A *
26645284-TGTAAGGGA- *
26645281-GAA- *
13488827-G-GCTA 11333151-G-GCTA *
11294078-AACCCCATTCT- *
13445466-A-AGG 11289790-A-AGG *
56864091-A-T *
56724860-T-C *
26659082-G- *
28802537-G-GAAT 26656390-G-GAAT *
28802534-G-GA 26656387-G-GA *
16244792-GGTGT-G,G 14132912-GGTGT-G,G 16×GT*
13462433-A-G 11306757-A-G *
19125694-CA-C,CAA 17013814-CA-C,CAA 24×A*
3232033-C-T 3363992-C-T *
4276293-C-A 4408252-C-A *
4272743-C-T 4404702-C-T *
4263062-C-A 4395021-C-A *
4167434-C-T 4299393-C-T FT225756 *
4167428-A-G 4299387-A-G *
4167418-C-T 4299377-C-T FT362305 *
4067369-TA-AA,T 4199328-TA-AA,T 26×A*
3986296-GA-G 4118255-GA-G 8×A*
3980500-G-T 4112459-G-T *
3758881-T-C 3890840-T-C *
3528404-T-C 3660363-T-C *
3491351-C-G 3623310-C-G *
3389595-TA-T 3521554-TA-T *
3232027-A-G 3363986-A-G *
13697085-A-C 11541409-A-C *
3232022-C-G 3363981-C-G *
3232020-G-A 3363979-G-A *
3232015-GC-G 3363974-GC-G *
2827955-G-C 2959914-G-C YY*
2827954-T-C 2959913-T-C YY*
2827953-G-C 2959912-G-C YY*
2906623-T- *
2729648-CTTTT-C,CTTT 2861607-CTTTT-C,CTTT 25×T*
13476644-G-A 11320968-G-A *
9946068-A-C 10108459-A-C Y*
26487833-C-CA 24341686-C-CA P1_Y1 9×A*
22479444-A-T 20317558-A-T BY30205 DYZ19 *
11294087-CTATT- *
4103175-CT-C,C 4235134-CT-C,C 13×T*
28802528-GAGGT-G 26656381-GAGGT-G *
13740193-A-G 11584517-A-G *
13485977-T-A 11330301-T-A *
28797015-G-T 26650868-G-T *
13449758-C-CATTT 11294082-C-CATTT *
13447261-T-TC 11291585-T-TC *
13450122-CATCCCATTCT-C 11294446-CATCCCATTCT-C *
56834420-T-TCCAC *
22509214-T-A 20347328-T-A DYZ19 *
56834457-C-CCACTCCATTT *
56834419-A-AC *
18679925-CA-C,CAA 16568045-CA-C,CAA 25×A*
16809372-TGATA-T,T 14697492-TGATA-T,T 11×GATA*
13485996-C-G 11330320-C-G *
13340916-C-T 11185240-C-T *
10038879-C-T 10201270-C-T FT376758 *
28797016-G-T 26650869-G-T *
13737459-G-C 11581783-G-C *
23984811-A-ATT 21838664-A-ATT 11×T*
13563544-G-T 11407868-G-T *
13484140-G-T 11328464-G-T *
13474753-C-T 11319077-C-T *
13469480-G-T 11313804-G-T *
13462428-T-G 11306752-T-G *
13445461-GGCA-G 11289785-GGCA-G *
9967284-T-C 10129675-T-C Y*
22509358-C-T 20347472-C-T DYZ19 *
13737045-A-G 11581369-A-G *
13607564-A-C 11451888-A-C *
13607561-T-C 11451885-T-C *
13607558-G-C 11451882-G-C *
13490340-T-TGAACTCATCATTTTTTA 11334664-T-TGAACTCATCATTTTTTA *
13488844-G-GCA,GCC 11333168-G-GCA,GCC *
17641957-CT-C,CTT 15530077-CT-C,CTT 25×T*
8428944-CAA-C,CAAA 8560903-CAA-C,CAAA 25×A*
13718564-T-A 11562888-T-A *
13244139-G-T 11088463-G-T *
11550432-GGCATGGTATGGAATGGA- *
11550414-CGTGGA- *
13690756-C-G 11535080-C-G *
13690726-T-C 11535050-T-C *
13463669-C-A 11307993-C-A *
13463667-A-G 11307991-A-G *
13463647-G-T 11307971-G-T *
22510967-G-T 20349081-G-T DYZ19 *
13423388-C-T 11267712-C-T *
13239914-G-A 11084238-G-A *
13239912-T-C 11084236-T-C *
9980216-A-T 10142607-A-T Y*
9980213-AG-A 10142604-AG-A *
13463310-G-A 11307634-G-A *
13468870-C-G 11313194-C-G *
13463307-T-A 11307631-T-A *
13715153-A-G 11559477-A-G *
13483283-G-GGA 11327607-G-GGA *
13247723-C-T 11092047-C-T *
56826854-T-C *
18937647-GCAATA-G,G 16825767-GCAATA-G,G 13×CAATA*
13404362-C-G 11248686-C-G *
19504032-T-G 17392152-T-G BY129642 YY*
56830542-C-CAT *
28549924-G-A 26403777-G-A *
22510963-G-C 20349077-G-C DYZ19 *
22436903-G-C 20275017-G-C DYZ19 *
13489616-C-G 11333940-C-G *
13474484-AGGCAGAGCCTAGACAAGAGTCCCATCACCTGGGTGATCAGTGCAGAGTTATGTCACAATGCCGCCTTTT-A 11318808-AGGCAGAGCCTAGACAAGAGTCCCATCACCTGGGTGATCAGTGCAGAGTTATGTCACAATGCCGCCTTTT-A *
13558124-C-T 11402448-C-T *
22303306-T-C 20141420-T-C DYZ19 *
13536526-T-A 11380850-T-A *
9941837-C-G 10104228-C-G Y*
9965009-A-C 10127400-A-C Y*
9964698-A-T 10127089-A-T Y*
9964456-C-G 10126847-C-G Y*
9964416-A-T 10126807-A-T Y*
9964352-G-A 10126743-G-A Y*
9964319-C-T 10126710-C-T Y*
9964141-A-C 10126532-A-C Y*
9964086-TA-T 10126477-TA-T *
9963409-C-T 10125800-C-T Y*
9961157-G-A 10123548-G-A BY82206 Y*
9957928-GT-G 10120319-GT-G *
9956939-G-A 10119330-G-A Y*
9945357-T-C 10107748-T-C Y*
9939128-G-A 10101519-G-A Y*
9967088-C-T 10129479-C-T Y*
9939118-G-A 10101509-G-A Y*
9936397-CT-C 10098788-CT-C *
9936395-CA-C 10098786-CA-C *
5388207-A-C 5520166-A-C *
13701409-G-A 11545733-G-A BY89033 *
13701395-A-C 11545719-A-C *
22288235-G-A 20126349-G-A DYZ19 *
9958028-AT-A 10120419-AT-A *
22447649-G-C 20285763-G-C DYZ19 *
13466468-C-G 11310792-C-G *
22298327-C-G 20136441-C-G FT455398 DYZ19 *
13523628-AT-A 11367952-AT-A *
10043489-C-A 10205880-C-A *
9966996-G-T 10129387-G-T Y*
9967155-C-T 10129546-C-T Y*
13737067-G-C 11581391-G-C *
13260145-A-T 11104469-A-T *
13429243-A-C 11273567-A-C *
13429150-C-T 11273474-C-T *
13429060-C-T 11273384-C-T *
13362880-G-C 11207204-G-C *
13354834-C-T 11199158-C-T *
13349125-A-G 11193449-A-G *
13317207-A-G 11161531-A-G *
13292953-G-A 11137277-G-A *
13267472-G-GGT 11111796-G-GGT *
13265412-A-AT 11109736-A-AT *
13264717-G-T 11109041-G-T ZS7975 *
13261570-T-C 11105894-T-C *
13261085-G-A 11105409-G-A *
13259400-T-G 11103724-T-G *
9967258-A-G 10129649-A-G Y*
13244485-T-C 11088809-T-C *
10057109-T-C 10219500-T-C *
10055424-C-T 10217815-C-T *
10055401-T-C 10217792-T-C *
10055345-C-G 10217736-C-G *
9984147-T-C 10146538-T-C Y*
9980555-A-C 10142946-A-C Y*
9980550-C-CT 10142941-C-CT *
9980465-A-G 10142856-A-G Y*
9980246-G-GTA 10142637-G-GTA *
9977035-C-T 10139426-C-T Y*
9976930-A-C 10139321-A-C Y*
9976855-A-C 10139246-A-C Y*
9967359-T-A 10129750-T-A Y*
10043484-A-G 10205875-A-G *
9967306-C-T 10129697-C-T Y*
13432989-G-T 11277313-G-T *
13711253-T-A 11555577-T-A *
59009151-G-GA 56863004-G-GA *
58980544-C-CCA 56834397-C-CCA *
58978685-A-AAT 56832538-A-AAT *
58974481-C-CATTCTTTGCA 56828334-C-CATTCTTTGCA *
58971523-G-GAACA 56825376-G-GAACA *
28792976-GGAAT-G 26646829-GGAAT-G *
28549927-A-G 26403780-A-G *
24499638-TTA-T 22353491-TTA-T *
22436874-C-A 20274988-C-A DYZ19 *
22050672-CT-C 19888786-CT-C 9×T*
19247433-AAG-A 17135553-AAG-A *
18867339-C-CTT 16755459-C-CTT 24×T*
13711273-T-C 11555597-T-C *
13695154-G-GTGGAATCGAGTGGAT 11539478-G-GTGGAATCGAGTGGAT *
59018074-A-G 56871927-A-G *
13689095-G-A 11533419-G-A F18219 *
13641481-CT-C 11485805-CT-C 8×T*
13641177-T-C 11485501-T-C *
13641174-C-T 11485498-C-T FT189934 *
13636021-G-A 11480345-G-A *
13636016-C-T 11480340-C-T *
13612108-C-A 11456432-C-A *
13611492-C-T 11455816-C-T *
13556416-C-A 11400740-C-A *
13554844-C-T 11399168-C-T *
13549880-G-GTA 11394204-G-GTA *
13534759-G-A 11379083-G-A *
13534696-C-A 11379020-C-A FT444919 *
13532774-A-G 11377098-A-G *
59016025-G-GA 56869878-G-GA 9×A*
59022708-A-G 56876561-A-G *
13401390-C-T 11245714-C-T FT227841 *
58997022-C-A 56850875-C-A *
13488488-G-A 11332812-G-A *
13255687-C-T 11100011-C-T *
13255676-C-T 11100000-C-T *
13255665-C-T 11099989-C-T *
13463637-C-G 11307961-C-G *
13463995-G-A 11308319-G-A *
28802562-T-A 26656415-T-A *
28802561-A-G 26656414-A-G *
28802543-G-T 26656396-G-T *
28802541-T-A 26656394-T-A *
13737586-T-C 11581910-T-C *
13482122-G-C 11326446-G-C *
13472038-G-T 11316362-G-T *
28802556-A-G 26656409-A-G *
59022734-C-T 56876587-C-T *
28802553-T-G 26656406-T-G *
28588261-G-A 26442114-G-A FT307010 *
22253250-A-G 20091364-A-G FT453631 DYZ19 *
28814074-G-T 26667927-G-T *
28583314-A-G 26437167-A-G *
28583310-C-T 26437163-C-T *
22509515-C-G 20347629-C-G DYZ19 *
59031246-C-A 56885099-C-A *
59030172-GGT-G 56884025-GGT-G *
59026897-TTG-T 56880750-TTG-T *
59026811-GT-G 56880664-GT-G *
59025339-A-G 56879192-A-G *
59024394-CTG-C 56878247-CTG-C *
59024022-AG-A 56877875-AG-A *
13432987-A-G 11277311-A-G *
13439828-A-T 11284152-A-T *
13507721-A-G 11352045-A-G *
59017272-C-A 56871125-C-A *
59018689-C-A 56872542-C-A *
59018676-C-T 56872529-C-T *
59018652-C-T 56872505-C-T *
59018121-T-C 56871974-T-C *
59018069-G-A 56871922-G-A *
59017917-T-G 56871770-T-G *
59017912-A-T 56871765-A-T *
59017896-A-C 56871749-A-C *
59017854-C-T 56871707-C-T *
59017393-G-A 56871246-G-A *
59017392-T-C 56871245-T-C *
59017328-A-G 56871181-A-G *
59017324-A-T 56871177-A-T *
59017238-A-G 56871091-A-G *
59018716-G-A 56872569-G-A *
59016773-C-T 56870626-C-T *
59016510-A-C 56870363-A-C *
59016408-CT-C 56870261-CT-C *
59014682-AAT-A 56868535-AAT-A *
59013179-G-T 56867032-G-T *
59012382-G-C 56866235-G-C *
59012232-GTA-G 56866085-GTA-G *
59011821-A-T 56865674-A-T *
59011711-ACAAT-A 56865564-ACAAT-A *
59011617-TTATC-T 56865470-TTATC-T *
59011358-A-G 56865211-A-G *
59011347-A-C 56865200-A-C *
59011281-A-T 56865134-A-T *
59011266-C-CA 56865119-C-CA *
59018698-C-T 56872551-C-T *
59019670-T-C 56873523-T-C *
59010486-C-G 56864339-C-G *
13505051-T-TC 11349375-T-TC *
28802976-A-C 26656829-A-C *
22300724-A-T 20138838-A-T DYZ19 *
13470865-G-C 11315189-G-C *
9997296-T-G 10159687-T-G Y*
9296073-C-G 9458464-C-G Y*
9215995-G-T 9378386-G-T Y*
4035854-G-GAT 4167813-G-GAT *
6130157-AAC-A 6262116-AAC-A 18×AC*
58884084-A-G 56706787-T-C *
13396537-C-T 11240861-C-T *
13261324-A-G 11105648-A-G *
22474502-G-C 20312616-G-C SUR37 DYZ19 *
28793913-G-C 26647766-G-C *
13505048-GA-G 11349372-GA-G *
59020916-G-C 56874769-G-C *
22279914-G-T 20118028-G-T DYZ19 *
9940586-TAA-T 10102977-TAA-T *
13487771-G-T 11332095-G-T *
59031342-CA-C 56885195-CA-C *
59031248-T-A 56885101-T-A *
59028833-G-T 56882686-G-T *
59025134-A-G 56878987-A-G *
59024710-CTAAT-C 56878563-CTAAT-C *
59024628-A-T 56878481-A-T *
59024573-G-A 56878426-G-A *
59024563-T-C 56878416-T-C *
59024438-C-T 56878291-C-T *
59023541-A-T 56877394-A-T *
59020933-C-CT 56874786-C-CT 11×T*
59011099-T-C 56864952-T-C *
59010280-A-G 56864133-A-G FGC82657 *
13445309-C-A 11289633-C-A *
13550291-C-G 11394615-C-G *
13692828-C-T 11537152-C-T FT462856 *
13692321-C-A 11536645-C-A *
13692320-T-A 11536644-T-A *
13692175-T-C 11536499-T-C *
13690143-C-G 11534467-C-G *
13690118-T-C 11534442-T-C *
13688100-T-C 11532424-T-C *
13634898-C-CGT 11479222-C-CGT *
13634826-C-T 11479150-C-T *
13611375-T-C 11455699-T-C *
13587195-G-T 11431519-G-T *
13573538-CTGCTTTTTTGTTGTTGTTGTTGTTGAATGGTAGCTGTCCTT-C 11417862-CTGCTTTTTTGTTGTTGTTGTTGTTGAATGGTAGCTGTCCTT-C *
13558360-A-C 11402684-A-C *
13539506-T-C 11383830-T-C *
13694652-G-A 11538976-G-A *
13538934-T-C 11383258-T-C *
13538931-T-G 11383255-T-G *
13533430-G-A 11377754-G-A *
13509148-T-A 11353472-T-A *
13507703-T-C 11352027-T-C *
13501384-T-C 11345708-T-C *
13500139-C-T 11344463-C-T *
13500049-G-T 11344373-G-T *
13490563-G-A 11334887-G-A *
13487474-C-T 11331798-C-T *
13472080-G-A 11316404-G-A FT444078 *
13469157-A-T 11313481-A-T BY85807 *
13449197-GAAATC-G 11293521-GAAATC-G *
13446330-G-T 11290654-G-T *
13694209-A-G 11538533-A-G *
13706853-G-A 11551177-G-A *
59010007-T-C 56863860-T-C *
58971360-G-A 56825213-G-A *
59009845-A-ACCAG 56863698-A-ACCAG *
59009693-C-T 56863546-C-T *
59009672-G-A 56863525-G-A *
59009655-C-CA 56863508-C-CA *
59009514-GC-G 56863367-GC-G *
59009290-C-T 56863143-C-T *
59008434-A-T 56862287-A-T *
59008282-T-C 56862135-T-C *
59008226-T-G 56862079-T-G *
59001365-TATA-T 56855218-TATA-T *
59001114-C-T 56854967-C-T *
58982257-T-TCACTC 56836110-T-TCACTC 4×CACTC*
58971508-A-G 56825361-A-G *
58971316-G-A 56825169-G-A *
13706886-T-A 11551210-T-A *
58970507-T-A 56824360-T-A *
58970482-G-A 56824335-G-A *
28791875-G-C 26645728-G-C *
28586890-A-T 26440743-A-T *
22510752-G-A 20348866-G-A BY28873 DYZ19 *
22508065-C-T 20346179-C-T DYZ19 *
22466034-G-T 20304148-G-T DYZ19 *
22447521-T-A 20285635-T-A DYZ19 *
13722901-T-A 11567225-T-A *
13722716-A-T 11567040-A-T *
13722664-A-C 11566988-A-C *
13720804-A-G 11565128-A-G *
13712874-G-C 11557198-G-C *
13711674-G-C 11555998-G-C *
13521343-A-T 11365667-A-T *
13507536-A-C 11351860-A-C *
58974441-G-T 56828294-G-T *
58971026-T-C 56824879-T-C *
28549327-GC-G 26403180-GC-G *
6427695-T-TA 6559654-T-TA 10×A*
13464026-G-A 11308350-G-A FT285497 *
24207530-CT-C 22061383-CT-C P3_b1 14×T*
22339013-A-C 20177127-A-C DYZ19 *
17669700-C-CAT 15557820-C-CAT 15×AT*
59013647-T-A 56867500-T-A *
59025373-A-G 56879226-A-G *
10022507-A-C 10184898-A-C Y*
4564938-T-TA 4696897-T-TA 10×A*
10022318-A-AAATAAATG 10184709-A-AAATAAATG *
13488459-A-T 11332783-A-T *
13285359-G-A 11129683-G-A FT65527 *
28229322-T-TA 26083175-T-TA P1_b4 17×A*
13464014-A-G 11308338-A-G *
13487838-G-T 11332162-G-T *
13500110-CAAAAAA-C 11344434-CAAAAAA-C 16×A*
13734111-G-A 11578435-G-A *
13726449-T-C,G 11570773-T-C,G *
13720993-T-TATGGA 11565317-T-TATGGA *
7847574-G-GA 7979533-G-GA 10×A*
59008936-A-AT 56862789-A-AT 8×T*
13255692-C-G 11100016-C-G FGC49061 *
19753954-AT-A 17642074-AT-A P5_Prx 15×T*
13635945-TG-T 11480269-TG-T *
13474767-C-A 11319091-C-A *
28585643-GTTAT-G 26439496-GTTAT-G *
59009279-C-A 56863132-C-A *
13734327-G-A 11578651-G-A *
28549330-AAAGGGAGGGCAGGGCC-A 26403183-AAAGGGAGGGCAGGGCC-A *
13721441-C-G 11565765-C-G *
13739907-A-G 11584231-A-G *
22509487-T-G 20347601-T-G DYZ19 *
9964094-C-T 10126485-C-T FT426636 Y*
28588244-T-C 26442097-T-C FT292743 *
13708060-C-G 11552384-C-G *
13706560-A-G 11550884-A-G *
13532875-CAAAAA-C 11377199-CAAAAA-C 13×A*
13737573-C-G 11581897-C-G *
13558114-T-A 11402438-T-A *
13526375-T-G 11370699-T-G *
13514719-A-T 11359043-A-T *
13488372-C-A 11332696-C-A *
13256071-C-A 11100395-C-A *
13256061-T-C 11100385-T-C *
22509502-G-T 20347616-G-T DYZ19 *
28583432-A-G 26437285-A-G CTS12375 *
13748305-T-G 11592629-T-G *
28583431-A-T 26437284-A-T CTS12374 *
28805271-A-T 26659124-A-T *
58827280-C-T 56763591-G-A *
13463289-G-T 11307613-G-T *
13711678-G-T 11556002-G-T *
13445808-A-T 11290132-A-T *
13399371-C-A 11243695-C-A FGC41965 *
9972630-AT-A 10135021-AT-A *
8968608-C-CT 9130999-C-CT 12×T*
10038808-C-T 10201199-C-T *
28792319-C-G 26646172-C-G *
22249791-T-C 20087905-T-C DYZ19 *
13261680-G-T 11106004-G-T *
22447705-C-G 20285819-C-G DYZ19 *
58905269-CCCATTCCATT-C 56685561-CAATGGAATGG-C 8×CCATT*
28588206-T-C 26442059-T-C S26593 *
13554532-G-A 11398856-G-A FTA37654 *
28588215-G-C 26442068-G-C FT307007 *
13474430-C-G 11318754-C-G *
23966967-TTG-T 21820820-TTG-T 10×TG*
13688007-G-T 11532331-G-T BY153388 *
13722009-G-A 11566333-G-A *
22359616-G-T 20197730-G-T DYZ19 *
13740173-T-C 11584497-T-C *
13745304-AGAATG-A 11589628-AGAATG-A 7×GAATG*
13745292-A-C 11589616-A-C *
22505761-G-A 20343875-G-A DYZ19 *
13474396-A-T 11318720-A-T *
28588259-A-T 26442112-A-T FT307009 *
28588254-G-GC 26442107-G-GC *
28588249-A-T 26442102-A-T FT292744 *
22466030-A-G 20304144-A-G A6484BY46147 DYZ19 *
13694217-G-A 11538541-G-A *
13702068-A-G 11546392-A-G *
13729039-G-C 11573363-G-C *
28580027-T-A 26433880-T-A CTS12341 *
6117096-TTG-T 6249055-TTG-T 12×TG*
13450189-T-TTCCTC 11294513-T-TTCCTC *
13711497-T-C 11555821-T-C BY89433 *
13722073-T-A 11566397-T-A *
13720002-G-A 11564326-G-A *
22448727-C-G 20286841-C-G DYZ19 *
22437997-C-G 20276111-C-G DYZ19 *
14637685-AGT-A 12525754-AGT-A 11×GT*
9992607-A-G 10154998-A-G Y*
13704489-G-A 11548813-G-A FT449078 *
23990455-GCA-G 21844308-GCA-G 9×CA*
13730182-A-G 11574506-A-G *
27087810-G-C 24941663-G-C P1_r4 *
22427044-C-G 20265158-C-G DYZ19 *
10022511-G-C 10184902-G-C Y*
13474752-T-C 11319076-T-C *
13505284-T-A 11349608-T-A *
13748373-G-A 11592697-G-A *
13706546-T-C 11550870-T-C *
28810780-A-G 26664633-A-G *
28810098-T-A 26663951-T-A BY48977 *
13726352-CTCCAATGGAATGGAG-C 11570676-CTCCAATGGAATGGAG-C *
13712330-C-A 11556654-C-A *
13693513-C-T 11537837-C-T *
28586633-T-G 26440486-T-G CTS12426 *
13710042-TG-T 11554366-TG-T *
28805869-A-G 26659722-A-G *
22448606-A-C 20286720-A-C DYZ19 *
6961474-AAT-A 7093433-AAT-A *
13691289-G-T 11535613-G-T *
8702810-GTTTT-G 8834769-GTTTT-G 21×T*
58983152-G-C,GCACTC 56837005-G-C,GCACTC *
22508779-G-C 20346893-G-C DYZ19 *
28794142-G-T 26647995-G-T *
13712039-A-C 11556363-A-C *
13737444-G-C 11581768-G-C *
13254675-A-C 11098999-A-C *
22479385-G-T 20317499-G-T DYZ19 *
13474780-A-G 11319104-A-G *
13474405-A-C 11318729-A-C *
13713155-AATGGC-A 11557479-AATGGC-A *
13713139-GACTGGAATCA-G 11557463-GACTGGAATCA-G *
9958256-G-A 10120647-G-A Y*
13691291-A-T 11535615-A-T *
9965844-A-T 10128235-A-T Y*
4044971-A-T 4176930-A-T FGC81652 *
13499987-A-C 11344311-A-C *
9980608-A-T 10142999-A-T Y*
13261247-T-C 11105571-T-C *
13261243-G-C 11105567-G-C *
13260296-T-G 11104620-T-G *
13259580-G-A 11103904-G-A *
13258252-AC-A 11102576-AC-A *
13252588-T-G 11096912-T-G *
13252395-T-G 11096719-T-G *
10055473-T-A 10217864-T-A *
10054208-T-C 10216599-T-C *
10054185-T-A 10216576-T-A *
10047900-T-C 10210291-T-C FT63764 *
10047859-C-A 10210250-C-A *
10047855-A-C 10210246-A-C *
9980602-C-T 10142993-C-T Y*
13264729-T-A 11109053-T-A Z37138 *
9977021-T-C 10139412-T-C Y*
9976896-G-A 10139287-G-A Y*
9967050-G-A 10129441-G-A FGC81026 Y*
9965929-A-G 10128320-A-G Y*
9965864-C-A 10128255-C-A Y*
9965852-A-G 10128243-A-G Y*
9965784-G-C 10128175-G-C Y*
9964760-G-A 10127151-G-A Y*
9964758-G-T 10127149-G-T Y*
9964498-C-A 10126889-C-A Y*
9964072-A-G 10126463-A-G Y*
9964011-A-T 10126402-A-T Y*
9957011-TA-T 10119402-TA-T *
9956706-A-T 10119097-A-T Y*
13261638-G-A 11105962-G-A *
13265152-G-A 11109476-G-A *
9944533-T-G 10106924-T-G Y*
13339885-C-T 11184209-C-T *
13448904-C-CACTCA 11293228-C-CACTCA *
13448734-C-CATTCG 11293058-C-CATTCG *
13447260-T-TCCAC 11291584-T-TCCAC *
13445375-A-G 11289699-A-G *
13437719-G-A 11282043-G-A *
13431879-C-A 11276203-C-A *
13428987-A-G 11273311-A-G *
13399167-A-G 11243491-A-G *
13372558-A-G 11216882-A-G *
13372540-G-A 11216864-G-A *
13349184-T-C 11193508-T-C *
13346776-C-CAA 11191100-C-CAA 13×A*
13346634-A-G 11190958-A-G *
13305017-C-T 11149341-C-T *
13267608-AGG-A 11111932-AGG-A *
13304280-CAAAT-C 11148604-CAAAT-C *
13295949-T-A 11140273-T-A *
13295933-T-A 11140257-T-A *
13291889-T-TGG 11136213-T-TGG *
13285380-A-G 11129704-A-G *
13285335-C-T 11129659-C-T *
13285306-C-T 11129630-C-T *
13284153-A-G 11128477-A-G *
13282244-T-G 11126568-T-G *
13277992-G-A 11122316-G-A *
13275211-A-G 11119535-A-G *
13270998-GCC-G 11115322-GCC-G *
13269581-AC-A 11113905-AC-A *
13267977-G-GC 11112301-G-GC *
9956705-G-C 10119096-G-C Y*
9941865-A-G 10104256-A-G Y*
21717473-T-TA 19555587-T-TA 10×A*
13375609-G-A 11219933-G-A *
13737575-A-G 11581899-A-G *
13507041-T-A 11351365-T-A *
13507038-AGG-A 11351362-AGG-A *
22255472-G-T 20093586-G-T DYZ19 *
13461865-G-A 11306189-G-A *
13446281-A-T 11290605-A-T *
9943775-G-GAGA 10106166-G-GAGA *
13725750-T-C 11570074-T-C *
10038881-T-C 10201272-T-C *
58884112-C-A 56706759-G-T *
28802525-G-A 26656378-G-A *
28802524-C-G 26656377-C-G S835 *
26479590-CA-C 24333443-CA-C P1_Y1 16×A*
13634695-T-C 11479019-T-C *
5919330-C-CT 6051289-C-CT 10×T*
13258549-T-C 11102873-T-C *
16196502-G-GA 14084622-G-GA FGC15726 10×A*
13558622-A-T 11402946-A-T *
13701229-T-C 11545553-T-C *
13256143-C-T 11100467-C-T *
13256139-C-G 11100463-C-G *
13256242-A-T 11100566-A-T *
20425803-CA-C 18263917-CA-C P5_Dst 15×A*
13437785-A-T 11282109-A-T *
13542627-G-C 11386951-G-C *
58976896-T-TTATTC 56830749-T-TTATTC *
28786406-C-A 26640259-C-A *
10038855-G-A 10201246-G-A *
22845012-T-TA 20683126-T-TA 10×A*
22509039-G-T 20347153-G-T BY3989BY196744 DYZ19 *
13472071-A-C 11316395-A-C *
9941532-CT-C 10103923-CT-C *
4327337-G-A 4459296-G-A FT7421 *
9509573-T-A 9671964-T-A *
9509568-C-T 9671959-C-T *
6419459-CTA-C 6551418-CTA-C *
6402301-A-C 6534260-A-C *
6126064-A-C 6258023-A-C *
5824050-GGA-G 5956009-GGA-G 10×GA*
5548849-T-G 5680808-T-G *
5381372-C-A 5513331-C-A *
5377938-T-C 5509897-T-C *
5377803-G-A 5509762-G-A *
5277858-G-C 5409817-G-C *
4870623-CGT-C 5002582-CGT-C 8×GT*
4870602-CTG-C 5002561-CTG-C 8×TG*
4096709-A-G 4228668-A-G *
13255722-A-G 11100046-A-G *
4011305-C-T 4143264-C-T *
3997518-T-C 4129477-T-C *
3567565-GCA-G 3699524-GCA-G *
3072721-C-T 3204680-C-T *
13339812-G-A 11184136-G-A *
58971628-C-G 56825481-C-G *
28791530-T-A 26645383-T-A *
13252573-T-G 11096897-T-G *
9316663-A-T 9479054-A-T Y*
13711410-G-A 11555734-G-A A10857BY211258 *
13711398-T-C 11555722-T-C *
13734175-T-C 11578499-T-C *
13709195-AGAATG-A 11553519-AGAATG-A 8×GAATG*
13471840-AC-A 11316164-AC-A *
9963318-T-A 10125709-T-A Y*
28802565-G-A 26656418-G-A *
13533793-A-G 11378117-A-G *
13515301-C-A 11359625-C-A *
13688951-G-A 11533275-G-A *
22674121-CAA-C,CA 20512235-CAA-C,CA 14×A*
56861293-T-TA *
23205806-T-G 21043920-T-G Y*
22241903-A-C 20080017-A-C BY45767 DYZ19 *
13488752-G-A 11333076-G-A *
58884147-C-A 56706724-G-T *
28810293-C-G 26664146-C-G *
13469185-A-G 11313509-A-G *
13469165-T-A 11313489-T-A *
13469163-C-G 11313487-C-G *
13469142-G-C 11313466-G-C *
13515313-A-G 11359637-A-G *
10910866-G-C *
19512035-G-A 17400155-G-A YY*
17881538-AT-A 15769658-AT-A 8×T*
13354872-AC-A 11199196-AC-A *
4273491-AT-A 4405450-AT-A 9×T*
56763569-A-G *
13463827-G-C 11308151-G-C *
13306194-T-C 11150518-T-C *
13306192-G-T 11150516-G-T *
13262836-C-A 11107160-C-A *
3402559-A-T 3534518-A-T *
4390006-GA-G 4521965-GA-G 10×A*
13726226-G-C 11570550-G-C *
5219361-G-A 5351320-G-A *
13977178-A-G 11856472-A-G Y*
13721146-G-A 11565470-G-A *
28754051-TAA-T 26607904-TAA-T 12×A*
13718409-T-G 11562733-T-G *
13712698-G-A 11557022-G-A *
10987252-A-T *
13450014-C-T 11294338-C-T *
5643449-T-TA 5775408-T-TA 12×A*
7131972-A-C 7263931-A-C YY*
28614844-CTTT-C 26468697-CTTT-C 13×T*
5270693-CTTTTTTT-C 5402652-CTTTTTTT-C 22×T*
13438425-T-A 11282749-T-A *
13351728-A-G 11196052-A-G *
59024009-A-C 56877862-A-C *
28796104-G-T 26649957-G-T *
28794799-T-G 26648652-T-G *
28794794-T-G 26648647-T-G *
22510141-T-A 20348255-T-A DYZ19 *
13689085-G-A 11533409-G-A *
23391496-AT-A,ATT 21229610-AT-A,ATT 20×T*
13689079-T-C 11533403-T-C *
13475484-A-G 11319808-A-G *
13475483-C-G 11319807-C-G *
13347687-G-A 11192011-G-A *
6403276-A-C 6535235-A-C *
13465381-A-T 11309705-A-T *
9941043-A-G 10103434-A-G Y*
13482144-T-G 11326468-T-G *
13482125-A-T 11326449-A-T *
13700582-A-T 11544906-A-T *
13489319-C-A 11333643-C-A *
22446669-A-ATT 20284783-A-ATT DYZ19 *
13478602-C-A 11322926-C-A *
13489130-T-A 11333454-T-A *
13977174-T-C 11856468-T-C Y*
13718407-A-G 11562731-A-G *
13489529-C-G 11333853-C-G *
10893571-T-A *
4425396-CT-C 4557355-CT-C *
13502674-C-A 11346998-C-A *
13558138-C-A 11402462-C-A *
56763531-G-A *
13465446-A-G 11309770-A-G *
23196627-T-TAA 21034741-T-TAA 17×A*
13445869-G-C 11290193-G-C *
13469077-T-A 11313401-T-A *
13468316-CT-C 11312640-CT-C *
21172514-G-GA 19010628-G-GA 9×A*
4020761-T-TA 4152720-T-TA 12×A*
28812467-T-G 26666320-T-G *
10987221-C-G *
10669559-A-T *
59018472-G-A,T 56872325-G-A,T *
13992191-CAAA-C,CAA 11871485-CAAA-C,CAA 22×A*
7780918-C-CA 7912877-C-CA 9×A*
13478159-G-T 11322483-G-T *
13489598-C-T 11333922-C-T *
13472046-A-G 11316370-A-G FT444075 *
5379787-G-GA 5511746-G-GA 10×A*
13488823-C-T 11333147-C-T *
13447896-C-CA 11292220-C-CA *
28586711-T-A 26440564-T-A *
9956761-T-A 10119152-T-A Y*
9956752-T-C 10119143-T-C Y*
9956746-C-T 10119137-C-T Y*
9956726-G-A 10119117-G-A Y*
13462247-C-G 11306571-C-G *
13472169-C-G 11316493-C-G *
13463767-G-A 11308091-G-A *
13715164-T-C 11559488-T-C *
9984372-A-C 10146763-A-C Y*
13709114-C-G 11553438-C-G *
13489546-C-G 11333870-C-G *
13482328-A-G 11326652-A-G *
13474386-C-T 11318710-C-T *
13374277-GA-G 11218601-GA-G 13×A*
5760628-G-C 5892587-G-C *
13711701-A-C 11556025-A-C *
13711695-A-T 11556019-A-T *
13474446-T-C 11318770-T-C *
13474345-C-T 11318669-C-T *
13474297-A-G 11318621-A-G *
9985135-G-A 10147526-G-A Y*
9984384-A-C 10146775-A-C Y*
7567753-CTT-C,CTTT 7699712-CTT-C,CTTT 25×T*
13489179-G-T 11333503-G-T *
5492458-G-T 5624417-G-T *
28611428-G-T 26465281-G-T *
13489763-C-A 11334087-C-A *
13269622-A-G 11113946-A-G *
13488961-CCA-C 11333285-CCA-C *
10818731-CGTTCT-C *
22508710-A-T 20346824-A-T DYZ19 *
9964517-C-A 10126908-C-A Y*
22510795-C-T 20348909-C-T DYZ19 *
13636850-T-TA 11481174-T-TA 10×A*
13474301-T-C 11318625-T-C *
13474274-C-A 11318598-C-A *
13398261-G-A 11242585-G-A *
4084268-GA-G 4216227-GA-G 11×A*
13482355-T-C 11326679-T-C *
13719311-A-C 11563635-A-C *
22509160-A-C 20347274-A-C DYZ19 *
13573607-CT-C 11417931-CT-C *
4790634-GA-G 4922593-GA-G 14×A*
13462434-A-G 11306758-A-G *
13465374-T-C 11309698-T-C *
13484154-C-T 11328478-C-T *
28586714-T-A 26440567-T-A *
10692439-A-G *
59006822-A-AC 56860675-A-AC *
28814688-TGGA-T 26668541-TGGA-T *
28792974-AT-A 26646827-AT-A *
13713762-GAA-G 11558086-GAA-G *
13713761-G-GTT 11558085-G-GTT *
13691798-T-TGGA 11536122-T-TGGA *
13691797-C-CAA 11536121-C-CAA *
13573602-CA-C 11417926-CA-C *
13478611-A-G 11322935-A-G *
13523622-C-CAAA 11367946-C-CAAA *
13497033-A-AACCT 11341357-A-AACCT *
13488703-GT-G 11333027-GT-G *
13463840-T-TGGC 11308164-T-TGGC *
13415978-CACAT-C 11260302-CACAT-C *
13267932-CTAA-C 11112256-CTAA-C *
13246480-GA-G 11090804-GA-G *
9980235-GCC-G 10142626-GCC-G *
9967189-T-TGC 10129580-T-TGC *
9967186-ACT-A 10129577-ACT-A *
9932161-G-GC 10094552-G-GC *
9932155-TC-T 10094546-TC-T *
13468081-T-A 11312405-T-A *
13464022-C-G 11308346-C-G *
10894208-C-G *
13463875-C-G 11308199-C-G *
13463861-A-T 11308185-A-T *
13482199-A-C 11326523-A-C *
13528200-C-T 11372524-C-T *
13510315-C-T 11354639-C-T *
13508326-A-AGC 11352650-A-AGC *
13504705-G-C 11349029-G-C *
13504702-C-T 11349026-C-T *
13497035-G-C 11341359-G-C *
13497026-CTTGTA-C 11341350-CTTGTA-C *
13491845-T-G 11336169-T-G *
13489441-A-G 11333765-A-G *
13489299-G-C 11333623-G-C *
13489194-G-T 11333518-G-T *
7320994-GAC-G 7452953-GAC-G 9×AC*
13482219-G-T 11326543-G-T *
13468880-A-C 11313204-A-C *
13252511-C-A 11096835-C-A *
13445827-T-A 11290151-T-A *
13439340-C-T 11283664-C-T *
13436968-G-T 11281292-G-T *
13429264-A-C 11273588-A-C *
13429093-C-A 11273417-C-A *
13398529-T-C 11242853-T-C *
13398353-C-T 11242677-C-T *
13398317-G-A 11242641-G-A *
13252380-C-A 11096704-C-A *
13241730-A-G 11086054-A-G *
10054214-C-G 10216605-C-G *
9958594-C-G 10120985-C-G Y*
9945360-G-A 10107751-G-A FTA6486 Y*
9945339-G-C 10107730-G-C Y*
13463869-T-C 11308193-T-C *
9980244-C-G 10142635-C-G Y*
58990345-T-C 56844198-T-C *
13470563-T-C 11314887-T-C *
5220159-CTTTTT-C 5352118-CTTTTT-C 21×T*
13488865-G-T 11333189-G-T *
13611464-TTCAA-T 11455788-TTCAA-T *
56831661-G-A *
13705501-GA-G 11549825-GA-G *
10043720-G-A 10206111-G-A *
10043719-T-C 10206110-T-C *
10043713-T-A 10206104-T-A *
13464032-C-A 11308356-C-A *
9964001-C-A 10126392-C-A Y*
56685633-C-G *
8097251-A-AT 8229210-A-AT 10×T*
9980575-G-T 10142966-G-T Y*
13711298-T-G 11555622-T-G *
10945216-A-G *
13468123-G-C 11312447-G-C *
13693639-C-T 11537963-C-T *
13489314-G-T 11333638-G-T *
13468288-T-A 11312612-T-A *
24671182-G-A 22525035-G-A P3_b2 *
8628361-GA-G 8760320-GA-G 10×A*
7461747-C-A 7593706-C-A IR1_L *
10676874-T-G *
9962676-C-T 10125067-C-T Y*
4035474-T-TACA 4167433-T-TACA *
4262884-A-AT 4394843-A-AT 10×T*
13474616-C-G 11318940-C-G *
13479009-G-A 11323333-G-A *
9932055-T-G 10094446-T-G Y*
20810696-CT-C,CTT 18648810-CT-C,CTT P4_Gap 16×T*
10945217-A-G *
9967195-C-T 10129586-C-T Y*
24886464-CAAA-C 22740317-CAAA-C g1 13×A*
13482053-C-T 11326377-C-T *
13478145-C-T 11322469-C-T *
13478142-G-C 11322466-G-C *
13478136-AC-A 11322460-AC-A *
56845502-A-T *
13721639-G-A 11565963-G-A *
13721616-C-T 11565940-C-T 4×ATGGA*
56763547-T-A *
19261541-G-GA 17149661-G-GA 9×A*
13462378-C-T 11306702-C-T *
13699005-T-A 11543329-T-A *
13489579-T-C 11333903-T-C *
10669548-C-G *
8622199-GACAC-G 8754158-GACAC-G 12×AC*
9964316-C-T 10126707-C-T FT369837 Y*
13566453-C-A 11410777-C-A *
13566439-G-C 11410763-G-C *
13462234-G-C 11306558-G-C *
13488808-G-A 11333132-G-A *
13488407-C-T 11332731-C-T *
13463315-C-A 11307639-C-A *
13489560-G-A 11333884-G-A *
26631899-A-AT 24485752-A-AT P1_g2 20×T*
13558588-T-A 11402912-T-A *
5219357-G-A 5351316-G-A *
28811021-A-G 26664874-A-G *
28811020-A-T 26664873-A-T *
13487956-G-A 11332280-G-A *
13489731-GGCC-G 11334055-GGCC-G *
13710221-A-G 11554545-A-G *
7210235-CA-C 7342194-CA-C 10×A*
28802569-T-C 26656422-T-C *
18019832-CTTTTTT-C 15907952-CTTTTTT-C 22×T*
13255769-G-A 11100093-G-A *
13702187-T-A 11546511-T-A *
9967226-C-T 10129617-C-T FT369898 Y*
13480862-A-T 11325186-A-T *
22510890-G-C 20349004-G-C DYZ19 *
13476667-A-G 11320991-A-G *
13701978-G-A 11546302-G-A *
13479116-G-A 11323440-G-A *
13474361-G-A 11318685-G-A *
13446099-A-T 11290423-A-T *
13628169-C-T 11472493-C-T *
19365232-CT-C 17253352-CT-C 10×T*
13702153-G-T 11546477-G-T *
13480840-C-A 11325164-C-A *
13501212-A-G 11345536-A-G FGC82890 *
13478310-G-C 11322634-G-C *
16767153-CTTTTT-C 14655273-CTTTTT-C 17×T*
13464552-C-T 11308876-C-T *
9997063-A-C 10159454-A-C A11740 Y*
13730527-C-G 11574851-C-G *
13730502-T-C 11574826-T-C *
13729013-T-A 11573337-T-A *
13723127-G-A 11567451-G-A *
13723119-A-G 11567443-A-G *
13715145-T-C 11559469-T-C *
13712550-T-A 11556874-T-A *
13709602-A-G 11553926-A-G *
13707001-T-A 11551325-T-A *
9619836-C-CTG 9782227-C-CTG IR3_Prx 8×TG*
13255772-C-T 11100096-C-T *
13464017-C-T 11308341-C-T *
59016101-GC-G 56869954-GC-G *
27482837-AT-A 25336690-AT-A P1_Y2 16×T*
13279998-CA-C 11124322-CA-C 26×A*
28810823-T-G 26664676-T-G *
22448711-A-C 20286825-A-C DYZ19 *
22303329-T-A 20141443-T-A DYZ19 *
3446607-C-CA 3578566-C-CA 25×A*
59011368-G-A 56865221-G-A *
22303453-C-T 20141567-C-T BY22933 DYZ19 *
13461266-A-C,T 11305590-A-C,T *
13480842-G-T 11325166-G-T *
13480838-C-T 11325162-C-T *
58992808-G-A 56846661-G-A *
13464004-C-T 11308328-C-T *
13463987-G-C 11308311-G-C *
13478260-T-TCCC 11322584-T-TCCC *
13611374-C-T 11455698-C-T *
13462232-C-G 11306556-C-G *
13463771-C-CT 11308095-C-CT *
13737096-T-G 11581420-T-G *
10025580-G-A 10187971-G-A Y*
10025577-A-G 10187968-A-G Y*
10025572-G-A 10187963-G-A Y*
22279074-C-A 20117188-C-A DYZ19 *
13340734-G-C 11185058-G-C *
22288255-G-T 20126369-G-T DYZ19 *
13461045-A-G 11305369-A-G *
9964391-G-GA 10126782-G-GA *
13598260-A-G 11442584-A-G *
13532016-G-A 11376340-G-A *
13532013-T-C 11376337-T-C *
59016121-A-AG 56869974-A-AG *
13468154-C-A 11312478-C-A *
22489623-C-T 20327737-C-T DYZ19 *
9939106-C-T 10101497-C-T Y*
13349496-C-T 11193820-C-T FGC5222 *
13472035-A-G 11316359-A-G *
13462350-C-A 11306674-C-A *
13462341-C-A 11306665-C-A *
59026969-T-TTA 56880822-T-TTA *
59026959-GATC-G 56880812-GATC-G *
58970175-A-T 56824028-A-T *
18640859-T-TA 16528979-T-TA 10×A*
13470573-A-T 11314897-A-T F18175 *
13445528-C-G 11289852-C-G *
13445510-T-C 11289834-T-C *
9965905-G-A 10128296-G-A Y*
9965900-C-G 10128291-C-G Y*
13513955-A-G,T 11358279-A-G,T *
13349508-AGG-A 11193832-AGG-A *
13462215-G-T 11306539-G-T *
13462214-G-C 11306538-G-C *
22263424-G-A 20101538-G-A BY35272 FGC4899 DYZ19 *
13489801-G-A 11334125-G-A *
28810832-A-C 26664685-A-C *
13737093-T-C 11581417-T-C *
9964564-G-C 10126955-G-C Y*
24425365-A-ATG 22279218-A-ATG 8×TG*
13301571-ATT-A 11145895-ATT-A 10×T*
13255774-T-C 11100098-T-C *
9963287-T-A 10125678-T-A Y*
9963286-T-A 10125677-T-A Y*
13489496-A-G 11333820-A-G *
6515573-A-AT 6647532-A-AT 10×T*
13478963-G-A 11323287-G-A *
9984141-C-G 10146532-C-G Y*
13468148-G-A 11312472-G-A *
13319936-A-G 11164260-A-G *
15984459-T-TG 13872579-T-TG 10×G*
13258558-C-CTT 11102882-C-CTT 20×T*
13730144-G-T 11574468-G-T *
22476669-T-A 20314783-T-A FT459896 DYZ19 *
23850755-TA-T 21688869-TA-T 10×A*
22489615-G-A 20327729-G-A DYZ19 *
13531752-C-T 11376076-C-T *
4953820-TTG-T 5085779-TTG-T 16×TG*
13256236-C-T 11100560-C-T *
28794152-G-T 26648005-G-T *
9295886-C-A 9458277-C-A Y*
13428945-G-C 11273269-G-C *
13428864-C-T 11273188-C-T *
59020952-C-CAG 56874805-C-CAG *
9984155-C-T 10146546-C-T Y*
13489273-T-C 11333597-T-C *
15558431-GAGATAGATAGAT-G,GAGAT 13446551-GAGATAGATAGAT-G,GAGAT 17×AGAT*
13706867-T-A,G 11551191-T-A,G *
13484085-T-A,C 11328409-T-A,C *
10025566-G-C 10187957-G-C Y*
13716422-C-T 11560746-C-T *
13465445-A-T 11309769-A-T *
13445784-T-C 11290108-T-C *
13445754-TTTTA-T 11290078-TTTTA-T *
13722069-G-A 11566393-G-A *
28803154-A-C 26657007-A-C *
13717982-G-T 11562306-G-T *
9984160-C-G 10146551-C-G Y*
9984159-T-C 10146550-T-C Y*
25624529-G-GT 23478382-G-GT P1_b3 12×T*
13487375-G-T 11331699-G-T *
14730418-T-A 12618486-T-A YY*
13448914-C-G 11293238-C-G *
5409728-TTTTCTTTCTTTC-T,TTTTC 5541687-TTTTCTTTCTTTC-T,TTTTC 18×TTTC*
13558135-G-A 11402459-G-A *
56828304-C-CGTTTG *
56828284-A-AATTCCTATCC *
13476853-C-G 11321177-C-G *
9962669-T-C 10125060-T-C Y*
10994189-T-A *
13257475-T-C 11101799-T-C *
13257472-G-A 11101796-G-A *
2752725-C-CAA 2884684-C-CAA 18×A*
10893614-C-A *
10893567-G-C *
16579376-CA-C 14467496-CA-C 9×A*
22722112-G-GA 20560226-G-GA 10×A*
56885321-A-G *
10673734-A-C *
13389962-ATGTG-A 11234286-ATGTG-A 13×TG*
13480376-G-C 11324700-G-C A17122 *
21700595-G-GAA 19538709-G-GAA 17×A*
14992933-T-TCA 12881018-T-TCA 11×CA*
13468246-C-T 11312570-C-T *
3916934-CAAAA-C 4048893-CAAAA-C 20×A*
20816924-CA-C,CAA 18655038-CA-C,CAA P4_Gap 22×A*
7194626-GTTT-G 7326585-GTTT-G 17×T*
13474457-T-G 11318781-T-G *
14008963-T-TA 11888257-T-TA 10×A*
13721034-A-G 11565358-A-G *
15173782-CAA-C 13061868-CAA-C 13×A*
22617232-G-GTT 20455346-G-GTT 15×T*
58979456-G-A 56833309-G-A *
13468283-G-A 11312607-G-A *
56833323-C-CTCCATTCCAG *
14745420-C-CTT 12633489-C-CTT 12×T*
13448793-C-G 11293117-C-G *
13488778-C-A 11333102-C-A *
13487730-A-T 11332054-A-T *
21054379-C-CAA 18892493-C-CAA 18×A*
13472200-G-GAAA 11316524-G-GAAA *
13472083-C-A 11316407-C-A *
56861291-T-TA *
56861288-T-TATA *
9991637-CT-C,CTT 10154028-CT-C,CTT 20×T*
14280515-C-CT 12159809-C-CT 10×T*
13474050-C-T 11318374-C-T *
13725858-A-T 11570182-A-T *
13725838-T-A 11570162-T-A *
13472195-C-T 11316519-C-T BY54221 *
13487477-C-T 11331801-C-T *
13466295-C-G 11310619-C-G *
13466293-A-T 11310617-A-T *
10677498-C-CTCTAT *
18246277-C-A 16134397-C-A Y*
13710109-G-T 11554433-G-T *
13474477-C-T 11318801-C-T *
56875353-A-G *
10987227-C-T *
13712357-T-G 11556681-T-G *
13576637-CTTT-C 11420961-CTTT-C 14×T*
9958044-G-A 10120435-G-A Y*
10894557-C-CTTCCATTCCA *
10676875-C-A *
56830680-CATTCCACTCT-C *
18384490-CAAAA-C 16272610-CAAAA-C P6_Gap 19×A*
21086136-T-TAA 18924250-T-TAA 24×A*
13487394-C-T 11331718-C-T *
13707103-AAATGG-A 11551427-AAATGG-A 4×AATGG*
58866174-A-C 56724697-T-G *
58997067-A-T 56850920-A-T *
9984184-T-G 10146575-T-G Y*
9984183-T-C 10146574-T-C Y*
9944139-G-A 10106530-G-A Y*
9964551-C-A 10126942-C-A Y*
23454921-AT-A 21293035-AT-A 8×T*
8973278-G-GA 9135669-G-GA 11×A*
13616931-T-TA 11461255-T-TA 11×A*
13718399-T-G 11562723-T-G *
13482307-A-T 11326631-A-T *
9360939-G-A 9523330-G-A Y*
59022592-GAAAA-G,GA 56876445-GAAAA-G,GA 13×A*
13598387-TTAAATACA-T 11442711-TTAAATACA-T *
5904031-C-CA 6035990-C-CA 27×A*
13543628-ACAC-A 11387952-ACAC-A *
13447132-CATTCCATTCCATTCCATTCCATTCT-C 11291456-CATTCCATTCCATTCCATTCCATTCT-C *
13410351-AC-A 11254675-AC-A *
13396059-TTG-T 11240383-TTG-T *
13345111-AATTG-A 11189435-AATTG-A *
13515292-A-G 11359616-A-G FGC26054 *
9964582-C-A 10126973-C-A Y*
13272189-G-A 11116513-G-A *
10022219-A-G 10184610-A-G Y*
6118972-G-C 6250931-G-C *
5733183-A-AT 5865142-A-AT 10×T*
13487441-G-A 11331765-G-A *
13487408-G-C 11331732-G-C *
13487400-C-G 11331724-C-G *
13726384-A-G 11570708-A-G *
13484142-C-T 11328466-C-T *
56831638-C-G *
8214860-GTT-G,GTTT 8346819-GTT-G,GTTT 21×T*
13482178-G-T 11326502-G-T *
56847959-G-A *
13611188-C-A 11455512-C-A *
13269494-AG-A 11113818-AG-A *
8468065-CAA-C,CA 8600024-CAA-C,CA 24×A*
13891920-C-CA 11771214-C-CA 11×A*
16692117-C-CAA 14580237-C-CAA 28×A*
56845496-T-G *
13698826-T-A 11543150-T-A *
13698811-T-A 11543135-T-A *
21663278-GA-G 19501392-GA-G 10×A*
24890224-A-AT 22744077-A-AT g1 13×T*
13472203-CAGA-C 11316527-CAGA-C *
13488892-C-G 11333216-C-G *
13688984-T-A 11533308-T-A *
58980701-A-G 56834554-A-G *
13487766-C-G 11332090-C-G *
13487759-C-G 11332083-C-G *
23772489-TA-T 21610603-TA-T 10×A*
17353804-T-TA 15241924-T-TA 9×A*
13499358-T-TA 11343682-T-TA *
15374441-G-GTT 13262561-G-GTT 20×T*
23971898-C-CTG 21825751-C-CTG 8×TG*
8293846-T-TA 8425805-T-TA 8×A*
13468271-G-T 11312595-G-T *
13748517-G-T 11592841-G-T *
22303327-C-T 20141441-C-T DYZ19 *
8025155-CAAAA-C 8157114-CAAAA-C 14×A*
22489637-G-A 20327751-G-A DYZ19 *
13478418-G-C 11322742-G-C *

In the table above, the meaning of the confidence field depends on whether the data comes from an FTDNA kit or an FGC kit. For FTDNA kits, + implies a "PASS" result with just one possible variant, * indicates a "PASS" but with multiple variants, ** indicates "REJECTED" with just a single variant, and *** indicates "REJECTED" with multiple possible variants. 'A*' are heterozygous variants not called by FTDNA, but still pulled from the VCF file. For FGC kits, + indicates over 99% likely genuine (95% for INDELs); * over 95% likely genuine (90% for INDELs); ** about 40% likely genuine; *** about 10% likely genuine. Manual entries read directly from a BAM file will be either + indicating positive, or * indicating that the data show a mixture of possible variants.

For the FTDNA kits, the BED data is encoded in the background color of the cells. Those cells with a white background have coverage, those with a grey background indicate no coverage in the BED file, and those with a pink background indicate the mutation is on the edge of a coverage region. These pink regions often indicate that the individual may be positive for a SNP even if there is no corresponding entry in the vcf file.

The combBED column indicates whether or not the mutation is a SNP and falls in the combBED region defined in Defining a New Rate Constant for Y-Chromosome SNPs based on Full Sequencing Data by Dmitry Adamov, Vladimir Guryanov, Sergey Karzhavin, Vladimir Tagankin, Vadim Urasin.

The McDonald BED column indicates whether or not the mutation is a SNP and falls in the BED region used by Dr. Iain McDonald in the age analysis he does for R-U106 men.

Age Analysis Information (work in progress)

AllMcDonaldYFull
Kit: 4639211577911294080968291171
Used in age calculations1577911294080968291171
Counts of SNPs22542
Variant counts last updated 2022-04-21 03:36:11.



Big Tree Main Page