Tree Position

R-P312/S116 > DF19/S232 > Z302/S233 > FT11655

Unique Mutations

The mutations unique to this man are summarized in the table below. Those with a '+' or '*' confidence level are considered by FamilyTreeDNA or FullGenomesCorp to be high quality SNPs/INDELs. For completeness, all other mutations of lesser confidence are included as well. These additional mutations may be useful for distinguishing between very closely related men.

Occasionally, some of the mutations listed here will be thought to be shared with other men in which case they might appear in upstream blocks on the tree. When this happens, the 'Blocks' field will indicate what block they appear in. Such a situation might arise with BigY men if the BED data suggests another man may be positive for a SNP, even though it doesn't appear in his VCF data. It might also happen if Chromo2 testing or Sanger sequencing of other men not on the tree show the SNP to be shared.

POS-REF-ALT (hg19) POS-REF-ALT (hg38) Blocks Names Region McDonald BED combBED STRKane-BY3
B417826
22361004-GAGTTTGTTCCTTCAGATGTGTCCAGGGTTTCTGTCTTCTGGCAGGTTCATGGTCTTGCTCACTTCACTAAACGAAGCTGCAGACCTTACTGGTGAGTGTTACAGCACTTAAAGGTGTTATGTCCAC-G 20199118-GAGTTTGTTCCTTCAGATGTGTCCAGGGTTTCTGTCTTCTGGCAGGTTCATGGTCTTGCTCACTTCACTAAACGAAGCTGCAGACCTTACTGGTGAGTGTTACAGCACTTAAAGGTGTTATGTCCAC-G DYZ19 +
14175082-T-G 12054376-T-G FT168443 YY+
15866423-C-T 13754543-C-T FT209826 YY+
15606524-G-T 13494644-G-T FT209765 YY+
15385900-A-G 13274020-A-G FT209724 YY+
15321731-G-A 13209849-G-A BY100819 YY+
13425743-C-A 11270067-C-A +
13425807-G-A 11270131-G-A +
13881635-G-A 11760929-G-A FT83524 Y+
23115-A-G +
13819959-T-TGAATGGAATGGAATGGAATG 11699253-T-TGAATGGAATGGAATGGAATG 14×GAATG+
6027031-C-T 6158990-C-T FT166900 +
10888640-TTCCAC-T +
13608473-C-T 11452797-C-T +
25505124-CTTTTTTTTTTTTTTTT-C 23358977-CTTTTTTTTTTTTTTTT-C P1_gr1 39×T+
13554822-C-A 11399146-C-A FT92445 +
16836874-A-G 14724994-A-G YY+
23100-G-A +
10081975-C-G 10244366-C-G +
10934536-C-A FT92049 +
21335216-C-A 19173330-C-A Y+
21239753-G-C 19077867-G-C YY+
21212360-G-A 19050474-G-A FT210485 YY+
19221320-T-A 17109440-T-A YY+
19132779-A-T 17020899-A-T BY126582 YY+
18911586-GC-G 16799706-GC-G +
18885038-C-T 16773158-C-T YY+
23078-G-T FGC82936 +
19520793-G-A 17408913-G-A FT210451 YY+
17999117-G-A 15887237-G-A P7_Gap Y+
17612604-T-C 15500724-T-C BY116165 YY+
17570686-T-C 15458806-T-C YY+
17359057-A-C 15247177-A-C YY+
17358400-T-C 15246520-T-C YY+
23067-A-G +
13547531-T-C 11391855-T-C +
10081987-A-G 10244378-A-G +
22215086-G-C 20053200-G-C FT170981 Y+
4462836-G-T 4594795-G-T FT166101 +
7060671-T-C 7192630-T-C Y+
3569378-C-T 3701337-C-T FT11638 +
7020487-T-C 7152446-T-C Y+
6746156-C-T 6878115-C-T YY+
3882233-A-G 4014192-A-G FT11732 +
6595286-CA-C 6727245-CA-C +
4844663-G-T 4976622-G-T +
3288119-C-T 3420078-C-T FT165512 +
4904637-G-A 5036596-G-A FT208648 +
4914616-G-A 5046575-G-A +
5066442-G-A 5198401-G-A FT166381 +
5105493-G-A 5237452-G-A FT166399 +
5115861-A-G 5247820-A-G FT208682 +
5225706-C-T 5357665-C-T FT232858 +
5600568-C-T 5732527-C-T FT12241 +
7175786-G-A 7307745-G-A YY+
7349508-G-T 7481467-G-T YY+
10081988-A-T 10244379-A-T +
10610131-G-A +
10082008-C-A 10244399-C-A +
10048868-A-G 10211259-A-G FT376923 +
13425753-C-T 11270077-C-T +
10901139-C-T FT225514 +
10825466-A-AT +
10744898-G-T FT91589 +
9792327-T-C 9954718-T-C BY81035 Y+
7349884-G-C 7481843-G-C YY+
9438172-C-T 9600563-C-T YY+
9119387-G-A 9281778-G-A Y+
9107506-T-C 9269897-T-C Y+
9023275-T-C 9185666-T-C BY77445 Y+
8528584-G-C 8660543-G-C YY+
7985597-A-G 8117556-A-G Y+
7398824-C-A 7530783-C-A YY+
22185855-C-CTT 20023969-C-CTT 25×T+
6008815-A-C 6140774-A-C +
19397070-C-CAT 17285190-C-CAT ZP158 +
7265007-G-T 7396966-G-T CTS1201 Z35676 YY+
23611641-G-A 21449755-G-A BY146702 YY+
22479776-G-C 20317890-G-C DYZ19 +
23358195-A-T 21196309-A-T Y+
26928517-T-C 24782370-T-C P1_r3 +
27026939-C-T 24880792-C-T P1_r4 +
22366502-T-C 20204616-T-C DYZ19 +
28369379-CAA-C 26223232-CAA-C P1_gr2 18×A+
24375049-A-T 22228902-A-T +
4227214-T-C 4359173-T-C +
22446612-T-TGTGTTACAGCACTTAAAGGGGTTATGTCCACAGTTTGTTCCTTCATATGTGTCCATTGTGTCCTCGTTCTGGCAGGCTCATGGTCTTGCTCACTTCACTAATGAAGCTGCAGACCTTACTGGTGA 20284726-T-TGTGTTACAGCACTTAAAGGGGTTATGTCCACAGTTTGTTCCTTCATATGTGTCCATTGTGTCCTCGTTCTGGCAGGCTCATGGTCTTGCTCACTTCACTAATGAAGCTGCAGACCTTACTGGTGA DYZ19 +
23243334-T-C 21081448-T-C BY143998 YY+
23207754-C-A 21045868-C-A FT210834 Y+
28459848-T-C 26313701-T-C FT171550 +
7364473-G-A 7496432-G-A Z35679 YY+
28672991-A-C 26526844-A-C FT14248 +
22805670-C-T 20643784-C-T YY+
22366479-T-A 20204593-T-A DYZ19 +
23052564-G-A 20890678-G-A Y+
58843261-C-A 56747610-G-T +
17165312-C-T 15053432-C-T FT312900 YY+
13357060-G-A 11201384-G-A L1065S5266 +
3548481-C-A 3680440-C-A +
23695834-T-TGC,TTCCCCCCCCCC 21533948-T-TGC,TTCCCCCCCCCC *
13269207-G-T 11113531-G-T *
13464983-A-G 11309307-A-G *
11308848-C- *
13464444-A-G 11308768-A-G *
13292090-C-A 11136414-C-A *
13334385-A-G 11178709-A-G *
13351760-T-G 11196084-T-G *
13420208-C-T 11264532-C-T *
13460945-A-G 11305269-A-G *
13447603-G-A 11291927-G-A *
13464338-C-A 11308662-C-A *
13460927-A-T 11305251-A-T *
13464329-G-A 11308653-G-A *
13452075-C-CTCCAATCCAA 11296399-C-CTCCAATCCAA *
13460876-A-C 11305200-A-C *
13463147-G-T 11307471-G-T *
13463145-AC-A 11307469-AC-A *
13460921-T-A 11305245-T-A *
13462460-G-T 11306784-G-T *
13462018-A-T 11306342-A-T *
13452065-C-CTCCAT 11296389-C-CTCCAT *
22318455-A-C 20156569-A-C DYZ19 *
13465002-T-A 11309326-T-A *
13469814-G-C 11314138-G-C *
13475317-G-T 11319641-G-T *
13475309-G-T 11319633-G-T *
13475303-T-A 11319627-T-A *
13475282-G-C 11319606-G-C *
13474728-A-T 11319052-A-T *
13474695-A-T 11319019-A-T *
13473822-CCCATCACCT-C 11318146-CCCATCACCT-C *
13473795-C-T 11318119-C-T *
13472245-C-A 11316569-C-A *
11314331-G- *
13470005-ACG-A 11314329-ACG-A *
13470003-C-CAA 11314327-C-CAA *
13469846-G-T 11314170-G-T *
13469832-G-T 11314156-G-T *
13469355-A-AGG 11313679-A-AGG *
13465078-C-A 11309402-C-A *
23358103-G-A 21196217-G-A Y*
23358110-A-G 21196224-A-G Y*
23372214-A-G 21210328-A-G Y*
13469352-GCA-G 11313676-GCA-G *
13468560-T-C 11312884-T-C *
13468556-G-GTAATCC 11312880-G-GTAATCC *
13468349-T-G 11312673-T-G *
13468345-C-A 11312669-C-A *
13468026-G-A 11312350-G-A *
13466571-G-C,T 11310895-G-C,T *
13465155-G-T 11309479-G-T *
13465149-T-C 11309473-T-C *
13265206-G-A 11109530-G-A *
13465085-G-A 11309409-G-A *
13465138-CAG-C 11309462-CAG-C *
10945215-CAACTCCA-C *
13251431-T-C 11095755-T-C *
6489386-A-G 6621345-A-G *
56756885-G-C *
56763645-T-C *
7347448-T-A 7479407-T-A Y*
56763647-A-T *
56826158-C- *
56826622-C- *
56832002-G-GCACTC *
6694444-CT-C,CTTT 6826403-CT-C,CTTT 20×T*
56833028-T-C *
6688203-T-C 6820162-T-C Y*
6672077-T-C 6804036-T-C YY*
6603648-C-T 6735607-C-T *
56854700-T-C *
6436678-TTTC-T 6568637-TTTC-T *
56706946-A-C *
56856117-A-AG,G *
56862642-C-G *
56865991-A-G *
56875376-T-A *
56876124-CAAAAAAAAAAAAAAAAAAAAAAAAA- 50×A*
56879320-T-C *
6406231-T-A 6538190-T-A *
6406223-C-T 6538182-C-T *
6347796-A-G 6479755-A-G *
6347792-A-G 6479751-A-G *
6347780-AAG-A 6479739-AAG-A *
6179591-C-A 6311550-C-A IR3_Dst *
6089798-A-T 6221757-A-T *
56724631-C-G *
7534382-GTTTTTTTTTGTTTT-G 7666341-GTTTTTTTTTGTTTT-G 9×T*
13251426-A-C 11095750-A-C *
10691024-C-CTTCCA,CTTCCA *
13242241-CT-C,TT 11086565-CT-C,TT 21×T*
11021572-CACTCTACTCCATTCAACTCCATTCCAGTCCACTCCACTCCACTCGACTCCACTGCACTCT-C *
11021562-T-G *
11021391-CCTTTCCACTCCACTGCACTCCACTCCACTCCATTCCACCCCACTCAATTCCACACCACTCCACTCCATTCCACTCCACCCCACTCCATTCAATTCCATTCCACTCCACTCCTCCCTACTCCATTCCATTCCATTCCATTTCATTCTATTACATTACATTA-C *
10945225-CCACTCCAA-C *
10945224-T-G *
13475450-T-C 11319774-T-C *
23732244-A-AAT,AT 21570358-A-AAT,AT *
10860943-C-T *
10860928-T-TTACAC *
10860923-T-C *
10787902-T-TAATCC *
10787889-T-TTCCGC *
25356577-G-GAA 23210430-G-GAA P2_r2 11×A*
7567753-CT-C,CTTT 7699712-CT-C,CTTT 25×T*
9946068-A-C 10108459-A-C Y*
10102978-A- *
9779358-A-G 9941749-A-G Y*
9507982-CTT-C,CTTTT 9670373-CTT-C,CTTTT 34×T*
9311178-G-C 9473569-G-C Y*
9231698-AAC-A,AACACAC 9394089-AAC-A,AACACAC 22×AC*
9042594-T-C 9204985-T-C Y*
28492689-CAA-C,CAAA 26346542-CAA-C,CAAA 18×A*
8600009-CT-C,CTT 8731968-CT-C,CTT 13×T*
8599997-T-G 8731956-T-G YY*
8428944-C-CA,CA 8560903-C-CA,CA 25×A*
8006889-T-C 8138848-T-C Y*
56706885-A-G *
13475367-C-T 11319691-C-T *
13476601-G-A 11320925-G-A *
13475856-A-G 11320180-A-G *
22510574-G-T 20348688-G-T DYZ19 *
18712425-C-T 16600545-C-T YY*
18686928-AT-A 16575048-AT-A 10×T*
22477527-G-C 20315641-G-C BY48287 DYZ19 *
18625914-G-C 16514034-G-C Y*
18625899-C-CTCTT 16514019-C-CTCTT *
18539560-C-G 16427680-C-G Y*
18390057-G-A 16278177-G-A P6_Gap *
17925480-G-A 15813600-G-A YY*
17864271-T-C 15752391-T-C YY*
17829273-T-C 15717393-T-C Y*
22498583-C-T 20336697-C-T DYZ19 *
22508094-T-A 20346208-T-A DYZ19 *
22509521-C-G 20347635-C-G DYZ19 *
22510602-A-T 20348716-A-T DYZ19 *
18801013-T-C 16689133-T-C YY*
22510638-GTCTTGCTCACTTCAAGAATGAAGCTGCCGACCTTAGTGGTGAGTGTTACAGCACTTAAAGGTGTTATGTCCAGAGTTTTTTCCTTCAGATATGTCCAGCGTTTCTTCCTTCTGGCAGA-G 20348752-GTCTTGCTCACTTCAAGAATGAAGCTGCCGACCTTAGTGGTGAGTGTTACAGCACTTAAAGGTGTTATGTCCAGAGTTTTTTCCTTCAGATATGTCCAGCGTTTCTTCCTTCTGGCAGA-G DYZ19 *
16957754-CATATAT-C 14845874-CATATAT-C 10×AT*
16871165-GT-G 14759285-GT-G 9×T*
16854713-G-A 14742833-G-A YY*
22510746-C-A 20348860-C-A DYZ19 *
16814285-ATG-A 14702405-ATG-A *
16692117-C-CAAAA 14580237-C-CAAAA 28×A*
16574192-T-C 14462312-T-C Y*
16570464-T-TC 14458584-T-TC *
16570461-AG-A 14458581-AG-A *
16541098-G-A 14429218-G-A YY*
16531115-T-A 14419235-T-A YY*
16352456-CAA-C,CAAA 14240576-CAA-C,CAAA 21×A*
16308486-CTT-C,CTTT 14196606-CTT-C,CTTT 25×T*
18718886-ATATCTATC-A,A 16607006-ATATCTATC-A,A 13×TATC*
22442628-C-T 20280742-C-T DYZ19 *
22510761-T-C 20348875-T-C DYZ19 *
21601268-C-A 19439382-C-A Y*
22288097-G-A 20126211-G-A BY30174 DYZ19 *
22272852-G-T 20110966-G-T DYZ19 *
22272849-A-AGT 20110963-A-AGT DYZ19 *
22255985-ACT-A 20094099-ACT-A DYZ19 *
22254117-G-C 20092231-G-C DYZ19 *
22239102-T-C 20077216-T-C DYZ19 *
22239101-A-G 20077215-A-G DYZ19 *
22232716-A-T 20070830-A-T DYZ19 *
22225400-G-A 20063514-G-A DYZ19 *
22222072-G-T 20060186-G-T DYZ19 *
22319288-C-A,A 20157402-C-A,A DYZ19 *
21967344-A-G 19805458-A-G Y*
21966522-T-A 19804636-T-A Y*
22319363-T-A,A 20157477-T-A,A DYZ19 *
19358339-ATAGATAG- *
22437849-A-C 20275963-A-C BY43807 DYZ19 *
21520199-G-A 19358313-G-A YY*
21512429-T-C 19350543-T-C YY*
22345359-A-T 20183473-A-T DYZ19 *
22366462-G-A 20204576-G-A DYZ19 *
21227375-CTTTTTTT-C,CTTTTTT 19065489-CTTTTTTT-C,CTTTTTT 22×T*
21096906-A-T 18935020-A-T Y*
21056128-A-G 18894242-A-G Y*
20707662-T-C 18545776-T-C P4_Prx *
20350303-T-TA 18188417-T-TA P5_Dst *
20350299-C-T 18188413-C-T P5_Dst *
19266257-G-GAAA 17154377-G-GAAA 14×A*
19203864-A-G 17091984-A-G YY*
22423205-A-G 20261319-A-G DYZ19 *
19071466-A-G 16959586-A-G Y*
16029968-A-C 13918088-A-C Y*
15858296-T-C 13746416-T-C YY*
13475885-A-T 11320209-A-T *
13480860-A-C 11325184-A-C *
23111594-A-G 20949708-A-G YY*
13489885-C-T 11334209-C-T *
13489857-C-A 11334181-C-A *
11334089-TACCCGGCC- *
11334056-G- *
13487370-C-G 11331694-C-G *
13485945-G-T 11330269-G-T *
11330053-ATCAGTGCAGAGATATGTGACAAGGCCCCTTTAAGCAGAACCTAGACAATTGTTACATCACCTGAGTGATCAGTGCGGAGAACTGTCAAAATGCCCCTTTAGGCAGAGCTTAGATCAGAGTTACACCGCCTG- *
11330047-TGGGTG- *
11330044-ACCTGGGTGATCAGTGCAGAGATATGTGACAAGGCCCCTTTAAGCAGAACCTAGACAATTGTTACATCACCTGAGTGATCAGTGCGGAGAACTGTCAAAATGCCCCTTTAGGCAGAGCTTAGATCAGAGTTACACCG- *
13484249-G-T 11328573-G-T *
13483351-A-T 11327675-A-T *
13482184-T-G 11326508-T-G *
13480868-A-T 11325192-A-T *
13480826-A-G 11325150-A-G *
23092224-A-G 20930338-A-G Y*
13480367-G-T 11324691-G-T *
13479285-A-T 11323609-A-T *
13477270-G-A 11321594-G-A *
13477264-C-G 11321588-C-G *
13477250-C-CT 11321574-C-CT *
13477219-C-A 11321543-C-A *
13477203-G-C 11321527-G-C *
13476729-C-T 11321053-C-T *
13476700-G-C 11321024-G-C *
22294859-A-C 20132973-A-C DYZ19 *
13476454-ACTG-A 11320778-ACTG-A *
13476452-TG-T 11320776-TG-T *
13476333-G-A 11320657-G-A *
13475889-G-T 11320213-G-T *
13599495-AAATGAAATAATGAAAT-A 11443819-AAATGAAATAATGAAAT-A *
13692967-A-AAGGAATGGAATGAACTCGAATGGAATGTAC 11537291-A-AAGGAATGGAATGAACTCGAATGGAATGTAC *
15673454-T-A 13561574-T-A Y*
14377491-ATGCTTG-A 12256787-ATGCTTG-A *
15673424-C-A 13561544-C-A Y*
15673421-T-A 13561541-T-A Y*
15659109-A-G 13547229-A-G YY*
22510770-T-A 20348884-T-A DYZ19 *
15558499-T-TAGATAGATAGACAGAC,TAGATAGATAGACAGAC 13446619-T-TAGATAGATAGACAGAC,TAGATAGATAGACAGAC 5×AGAC*
15518736-T-C 13406856-T-C YY*
22510785-A-C 20348899-A-C DYZ19 *
15268834-T-A 13156923-T-A YY*
15208845-CAAA-C,CAA 13096931-CAAA-C,CAA 23×A*
15164634-A-G 13052720-A-G YY*
22527858-T-C 20365972-T-C Y*
22644931-G-A 20483045-G-A Y*
14594139-A-G 12482339-A-G YY*
14377501-A-G 12256797-A-G YY*
14291258-T-C 12170552-T-C Y*
13702393-G-A 11546717-G-A *
22644939-G-A 20483053-G-A Y*
14160535-A-T 12039829-A-T Y*
13936259-A-AGAAAGAAAGAAAGAAG 11815553-A-AGAAAGAAAGAAAGAAG *
22746097-A-ATT 20584211-A-ATT 13×T*
13730536-A-T 11574860-A-T *
13730532-T-C 11574856-T-C *
11567268-CATGGAATGGAATGGCATGGCATGGAATGGAATGGAATGGA- *
11567257-GAATTGAATGT- *
13718569-T-G 11562893-T-G *
23003019-A-G 20841133-A-G YY*
13716117-G-A 11560441-G-A *
13712859-G-T 11557183-G-T *
11550434-CATGGT- *
13702413-G-T 11546737-G-T *
13716188-G-A 11560512-G-A *
13464320-A-C 11308644-A-C *
6089795-TAA-T 6221754-TAA-T *
4799565-A-C 4931524-A-C FGC47851 *
8160178-CA-C,CAA 8292137-CA-C,CAA 20×A*
18625910-G-T 16514030-G-T Y*
7131955-C-T 7263914-C-T YY*
56707288-C-T *
14294297-TA-T 12173591-TA-T 8×A*
10860933-T-C *
26352380-C-CGTGT 24206233-C-CGTGT P1_Y1 23×GT*
13465026-C-A 11309350-C-A *
13474740-T-C 11319064-T-C *
13468922-G-A 11313246-G-A *
56830205-T-TTCCACTCCAC,TTCCACTCCACTCCAC *
9125447-CT-C,CTT *
13482355-T-C 11326679-T-C *
13482388-T-A 11326712-T-A *
13468049-A-T 11312373-A-T *
22270491-T-A 20108605-T-A BY33254BY48866 DYZ19 *
27506515-C-CA 25360368-C-CA P1_Y2 24×A*
13480395-C-T 11324719-C-T *
13464360-A-G 11308684-A-G *
4408904-G-GAA 4540863-G-GAA 13×A*
3796645-GTT-G 3928604-GTT-G 13×T*
23834228-A-AT,ATT 21672342-A-AT,ATT 14×T*
18343673-T-TA 16231793-T-TA P6_Prx 13×A*
7269610-CTTTTT-C,CTTTT 7401569-CTTTTT-C,CTTTT 22×T*
13460974-G-T 11305298-G-T *
10081962-C-A 10244353-C-A *
13464362-C-CA 11308686-C-CA *
14532369-G-C 12420570-G-C Y*
5894966-ATG-A 6026925-ATG-A *
10787894-T-C *
13473781-A-G 11318105-A-G *
13473797-C-T 11318121-C-T *
3456712-A-G 3588671-A-G *
3456714-C-A 3588673-C-A *
13721052-A-C 11565376-A-C *
56875367-G-A *
13263057-C-T 11107381-C-T *
8043374-G-A 8175333-G-A YY*
9964363-A-G 10126754-A-G Y*
28807910-T-C 26661763-T-C FT462461 *
56856588-C-T *
13475869-G-C 11320193-G-C *
13481405-G-C 11325729-G-C *
5507713-ATT-A,ATTT 5639672-ATT-A,ATTT 24×T*
13476639-C-G,T 11320963-C-G,T *
13469196-C-T 11313520-C-T *
13444902-C-T 11289226-C-T *
22508046-T-A 20346160-T-A DYZ19 *
13464967-C-A 11309291-C-A *
13464998-C-G 11309322-C-G *
13465001-C-A 11309325-C-A *
13465019-G-C 11309343-G-C *
6634259-GTT-G,GT 6766218-GTT-G,GT 15×T*
56724919-G-A *
19500150-GTAGATAGA-G,GTAGA 17388270-GTAGATAGA-G,GTAGA 14×TAGA*
28807257-A-G 26661110-A-G *
13486038-C-G 11330362-C-G *
13475393-T-G 11319717-T-G *
11026257-T-C FGC80881 *
13342223-G-C 11186547-G-C *
5557238-C-CAAA 5689197-C-CAAA 23×A*
27714288-A-AT 25568141-A-AT P1_Y2 8×T*
13465298-T-TCC 11309622-T-TCC *
9184501-C-A 9346892-C-A Y*
4698301-GA-G 4830260-GA-G 10×A*
13476555-A-G 11320879-A-G *
13445720-T-C 11290044-T-C *
13486023-C-G 11330347-C-G *
13445770-C-A 11290094-C-A *
13472368-T-G 11316692-T-G *
13474343-C-G 11318667-C-G *
13540389-G-A 11384713-G-A FGC82307 *
13540422-T-C 11384746-T-C *
13264180-G-C 11108504-G-C *
13485975-C-T 11330299-C-T *
10914600-A-G *
13480816-C-A 11325140-C-A *
13481376-C-G 11325700-C-G *
22936288-C-CTT 20774402-C-CTT 25×T*
5632507-T-C 5764466-T-C *
5936094-A-G 6068053-A-G FT6673 *
6929160-A-T 7061119-A-T Y*
10014844-G-T 10177235-G-T Y*
10014859-A-G 10177250-A-G Y*
10014880-C-A 10177271-C-A Y*
21710391-CCT-C 19548505-CCT-C *
58971155-G-A 56825008-G-A *
58827246-A-G 56763625-T-C *
59029129-T-C 56882982-T-C *
59029315-A-G 56883168-A-G *
13363277-T-A 11207601-T-A *
24510701-T-TA 22364554-T-TA 10×A*
27618169-C-CT 25472022-C-CT P1_Y2 14×T*
59027650-A-T 56881503-A-T *
13487462-T-G 11331786-T-G *
3628360-AGT-A 3760319-AGT-A *
22503298-C-G 20341412-C-G DYZ19 *
23312950-AT-A 21151064-AT-A 10×T*
13745150-G-T 11589474-G-T *
22446447-G-C 20284561-G-C BY43867 DYZ19 *
13464336-C-T 11308660-C-T *
13711825-A-T 11556149-A-T *
58866157-G-C 56724714-C-G *
16715014-ATG-A 14603134-ATG-A 8×TG*
13463406-C-T 11307730-C-T *
13473737-A-C 11318061-A-C *
13745182-A-C 11589506-A-C *
13466468-C-G 11310792-C-G *
13384105-C-T 11228429-C-T *
13415942-A-T 11260266-A-T *
28810173-G-A 26664026-G-A *
5972747-G-C 6104706-G-C *
13363283-C-T 11207607-C-T *
13567254-A-C 11411578-A-C *
13466533-G-A 11310857-G-A *
6191320-C-A 6323279-C-A IR3_Dst *
13480984-C-T 11325308-C-T *
5300642-CT-C 5432601-CT-C 10×T*
10921998-T-C *
13461082-A-G 11305406-A-G *
2726116-CTT-C 2858075-CTT-C 11×T*
17707376-CAA-C,CAAA 15595496-CAA-C,CAAA 23×A*
18384490-CAA-C,CA 16272610-CAA-C,CA P6_Gap 19×A*
13460982-G-C 11305306-G-C *
19261128-CTTTTTT-C 17149248-CTTTTTT-C 21×T*
14812069-G-GAA 12700140-G-GAA 15×A*
17996127-TACAC-T,TAC 15884247-TACAC-T,TAC P7_Gap 20×AC*
4922309-CTT-C 5054268-CTT-C 14×T*
5961842-C-CA 6093801-C-CA 10×A*
10860920-G-C *
13476416-C-A 11320740-C-A *
10860924-G-T *
13487732-C-T 11332056-C-T *
11021564-C-A *
4350419-G-GA 4482378-G-GA 9×A*
22707685-C-CT 20545799-C-CT 10×T*
13480866-C-A 11325190-C-A *
22511854-T-A 20349968-T-A DYZ19 *
22486569-T-C 20324683-T-C DYZ19 *
22511856-T-G 20349970-T-G DYZ19 *
7154797-C-CA 7286756-C-CA 18×A*
13473767-T-C 11318091-T-C *
9880201-GT-G 10042592-GT-G BY11427 10×T*
13704446-A-G 11548770-A-G *
24070939-T-TA 21924792-T-TA P3_b1 13×A*
22486543-C-T 20324657-C-T DYZ19 *
13375563-A-G 11219887-A-G *
5956363-CT-C 6088322-CT-C 8×T*
22508082-T-C 20346196-T-C DYZ19 *
13474363-C-A 11318687-C-A *
13475265-C-A 11319589-C-A *
7002892-C-A 7134851-C-A Y*
13740321-T-G 11584645-T-G *
58866174-A-C 56724697-T-G *
59012825-C-G 56866678-C-G *
9965212-T-C 10127603-T-C Y*
28597843-CT-C,CTT 26451696-CT-C,CTT 15×T*
5945467-CTT-C,CTTT 6077426-CTT-C,CTTT 25×T*
13489883-A-G 11334207-A-G *
13464989-T-A 11309313-T-A *
13464991-G-A 11309315-G-A *
13464995-C-T 11309319-C-T *
13480855-A-G 11325179-A-G *
13489615-A-ACC 11333939-A-ACC *
13489815-C-G 11334139-C-G *
13489882-C-T 11334206-C-T *
13526498-T-C 11370822-T-C *
13464401-T-G 11308725-T-G *
23672293-T-TGCCCCCCCCCC 21510407-T-TGCCCCCCCCCC *
9986775-GAAGT-G 10149166-GAAGT-G *
13466570-G-A 11310894-G-A *
13473858-A-C 11318182-A-C *
13473908-C-G 11318232-C-G *
13489122-G-C 11333446-G-C *
22486541-G-C 20324655-G-C DYZ19 *
13464958-A-C 11309282-A-C *
13461055-GCA-G 11305379-GCA-G *
22486574-A-T 20324688-A-T DYZ19 *
10787882-G-C *
13620448-T-TAA 11464772-T-TAA 14×A*
13446804-GCCATTCCATTCCATTCCATTCCATTCCATTCCATTCCATT-G,GCCATTCCATTCCATTCCATTCCATTCCATT 11291128-GCCATTCCATTCCATTCCATTCCATTCCATTCCATTCCATT-G,GCCATTCCATTCCATTCCATTCCATTCCATT 12×CCATT*
13479580-T-A 11323904-T-A *
13480969-C-G 11325293-C-G *
10677518-T-TTCCATTCCATTCCTTTCCATTCCATTCCATTCCATTCCGC *
10787870-T-TCCAC *
10787880-T-A *
13334400-G-C 11178724-G-C *
13433617-ATTT-A 11277941-ATTT-A 8×T*
13464982-C-T 11309306-C-T *
13469527-G-T 11313851-G-T *
13474700-T-A 11319024-T-A *
13443491-C-A 11287815-C-A *
13469916-G-C 11314240-G-C *
13489873-C-T 11334197-C-T *
13516696-C-T 11361020-C-T *
22486566-C-T 20324680-C-T DYZ19 *
56706883-G-A *
13484091-G-T 11328415-G-T *
4293247-A-AT 4425206-A-AT 9×T*
3490388-T-C 3622347-T-C *
3579146-A-T 3711105-A-T *
3685069-C-T 3817028-C-T *
3712813-T-TGTGTGAGAGAGAGAGAGAGAGAGAGAGAGAGA 3844772-T-TGTGTGAGAGAGAGAGAGAGAGAGAGAGAGAGA *
3916934-CAAAA-C,CAA 4048893-CAAAA-C,CAA 20×A*
4260302-G-A 4392261-G-A *
4275434-T-C 4407393-T-C *
4426653-T-G 4558612-T-G *
3322767-T-TTC 3454726-T-TTC *
13464350-A-G 11308674-A-G *
5308851-A-G 5440810-A-G *
5430808-CAA-C,CAAAAA 5562767-CAA-C,CAAAAA 25×A*
5439034-T-C 5570993-T-C *
5899314-C-T 6031273-C-T *
5899317-C-T 6031276-C-T *
5899320-C-T 6031279-C-T *
3350457-G-A 3482416-G-A *
3037757-C-A 3169716-C-A *
56706889-C-T *
13251464-G-A 11095788-G-A *
56706890-A-C *
13460955-C-A 11305279-C-A *
9974070-A-C 10136461-A-C Y*
13473759-C-G 11318083-C-G *
10679706-T-TTTCAGAAGATCTCACTCTGTCACTCAGGTTGGAGTGCAGTCGCATAATCTCAGCTCACATTACA *
13692719-C-T 11537043-C-T *
56887139-GT- *
56823288-G- *
56706901-A-G *
13469821-G-C 11314145-G-C *
13469417-C-T 11313741-C-T *
13480952-A-G 11325276-A-G *
11578462-AATTGAATGTC- *
26672861-GAA- *
56706891-A-G *
56706899-G-C *
13477272-G-A 11321596-G-A *
4028769-A-AT 4160728-A-AT 9×T*
5611020-G-GA 5742979-G-GA 10×A*
19059747-CTTT-C,CTT 16947867-CTTT-C,CTT 25×T*
4505414-A-ATTT 4637373-A-ATTT 22×T*
10692391-A-C *
3037778-G-A 3169737-G-A *
13475838-C-A 11320162-C-A *
4523539-T-C 4655498-T-C *
10081965-C-A 10244356-C-A *
10081972-C-A 10244363-C-A *
13692931-A-C 11537255-A-C *
22509512-G-C 20347626-G-C DYZ19 *
13251200-A-G 11095524-A-G *
13304210-A-T 11148534-A-T *
28584050-C-A 26437903-C-A *
13465003-G-T 11309327-G-T *
13475874-T-C 11320198-T-C *
13479141-G-A 11323465-G-A *
13489325-T-A 11333649-T-A *
13476598-C-G 11320922-C-G *
13469473-G-A 11313797-G-A *
22249776-C-T 20087890-C-T DYZ19 *
56685818-A-G *
13484206-C-T 11328530-C-T *
13484218-T-A 11328542-T-A *
13500317-GT-G 11344641-GT-G *
13420904-C-T 11265228-C-T *
13481385-C-T 11325709-C-T *
13420927-G-C 11265251-G-C *
22509646-C-A 20347760-C-A DYZ19 *
19293800-G-T 17181920-G-T YY*
22488337-A-T 20326451-A-T DYZ19 *
13469153-A-T 11313477-A-T *
13553457-C-A 11397781-C-A *
13553465-A-G 11397789-A-G *
13462455-T-C 11306779-T-C *
13704352-TGAAATGGAATGGAATGGAATGGAAC-T 11548676-TGAAATGGAATGGAATGGAATGGAAC-T *
13468028-G-T 11312352-G-T *
26455900-CTTT-C 24309753-CTTT-C P1_Y1 22×T*
22249773-T-C 20087887-T-C DYZ19 *
28813877-C-T 26667730-C-T *
13693710-A-C 11538034-A-C *
13484089-T-G 11328413-T-G *
13242232-A-AT 11086556-A-AT *
13242234-CAGGA-C 11086558-CAGGA-C *
13378377-A-G 11222701-A-G *
22487871-T-C 20325985-T-C DYZ19 *
22487873-C-A 20325987-C-A DYZ19 *
56826920-T-TCC *
13480960-G-T 11325284-G-T *
13469126-T-A 11313450-T-A *
13463404-A-T 11307728-A-T *
14324894-CTTTT-C,CTTT 12204188-CTTTT-C,CTTT 26×T*
13443611-G-T 11287935-G-T *
13464569-C-CCA 11308893-C-CCA *
13464570-TGG-T 11308894-TGG-T *
13485991-A-T 11330315-A-T *
13489094-C-A 11333418-C-A *
13693679-AAATAGCCTAGAATGGAATGAAATGG-A 11538003-AAATAGCCTAGAATGGAATGAAATGG-A *
13465070-T-A 11309394-T-A *
13448836-C-CTCCATTCCATTCCATTCCATTCCATTCCACTCCATTCCAT 11293160-C-CTCCATTCCATTCCATTCCATTCCATTCCACTCCATTCCAT *
56874786-CT-C 11×T*
13474341-GC-G 11318665-GC-G *
10921985-CTCCAA-C *
11026250-C-G *
13469366-A-T 11313690-A-T *
13485995-C-A 11330319-C-A *
13688924-C-T,T 11533248-C-T,T *
13375857-G-C 11220181-G-C *
13460619-G-A 11304943-G-A *
13477246-AC-A 11321570-AC-A *
13373113-A-G 11217437-A-G *
13487375-G-A 11331699-G-A *
9960427-G-A 10122818-G-A Y*
9974074-C-G 10136465-C-G Y*
9994892-TA-T 10157283-TA-T *
13373097-C-T 11217421-C-T *
13373111-A-G 11217435-A-G *
13373112-C-T 11217436-C-T *
4426654-T-G 4558613-T-G *

In the table above, the meaning of the confidence field depends on whether the data comes from an FTDNA kit or an FGC kit. For FTDNA kits, + implies a "PASS" result with just one possible variant, * indicates a "PASS" but with multiple variants, ** indicates "REJECTED" with just a single variant, and *** indicates "REJECTED" with multiple possible variants. 'A*' are heterozygous variants not called by FTDNA, but still pulled from the VCF file. For FGC kits, + indicates over 99% likely genuine (95% for INDELs); * over 95% likely genuine (90% for INDELs); ** about 40% likely genuine; *** about 10% likely genuine. Manual entries read directly from a BAM file will be either + indicating positive, or * indicating that the data show a mixture of possible variants.

For the FTDNA kits, the BED data is encoded in the background color of the cells. Those cells with a white background have coverage, those with a grey background indicate no coverage in the BED file, and those with a pink background indicate the mutation is on the edge of a coverage region. These pink regions often indicate that the individual may be positive for a SNP even if there is no corresponding entry in the vcf file.

The combBED column indicates whether or not the mutation is a SNP and falls in the combBED region defined in Defining a New Rate Constant for Y-Chromosome SNPs based on Full Sequencing Data by Dmitry Adamov, Vladimir Guryanov, Sergey Karzhavin, Vladimir Tagankin, Vadim Urasin.

The McDonald BED column indicates whether or not the mutation is a SNP and falls in the BED region used by Dr. Iain McDonald in the age analysis he does for R-U106 men.

Age Analysis Information (work in progress)

AllMcDonaldYFull
Kit: B4178261575148794275518298583
Used in age calculations1575148794275518298583
Counts of SNPs10657
Variant counts last updated 2022-09-26 03:09:16.



Big Tree Main Page