Tree Position

R-P312/S116 > Z290 > L21/S145 > S552 > DF13 > DF21/S192 > Z30233 > FGC3903/S5201 > S5199 > Z246 > DF25 > DF5 > ZZ32 > CTS3655 > Z16539

Unique Mutations

The mutations unique to this man are summarized in the table below. Those with a '+' or '*' confidence level are considered by FamilyTreeDNA or FullGenomesCorp to be high quality SNPs/INDELs. For completeness, all other mutations of lesser confidence are included as well. These additional mutations may be useful for distinguishing between very closely related men.

Occasionally, some of the mutations listed here will be thought to be shared with other men in which case they might appear in upstream blocks on the tree. When this happens, the 'Blocks' field will indicate what block they appear in. Such a situation might arise with BigY men if the BED data suggests another man may be positive for a SNP, even though it doesn't appear in his VCF data. It might also happen if Chromo2 testing or Sanger sequencing of other men not on the tree show the SNP to be shared.

POS-REF-ALT (hg19) POS-REF-ALT (hg38) Blocks Names Region McDonald BED combBED STRBigY3
935007
10628564-C-G A+
6238272-G-C 6370231-G-C FT382233 IR3_Dst A+
16107471-T-C 13995591-T-C P8_Prx A*
20705774-C-A 18543888-C-A P4_Prx A*
16120440-C-T 14008560-C-T P8_Prx A*
19811361-G-A 17699481-G-A P5_Prx A*
19699860-G-A 17587980-G-A P5_Prx A*
26446261-A-G 24300114-A-G P1_Y1 A*
26095397-A-G 23949250-A-G P1_Y1 A*
16097382-G-C 13985502-G-C A*
24298409-G-T 22152262-G-T P3_t1 A*
56846809-C-T A*
14630324-TTCTC-T 12518393-TTCTC-T +
15448466-C-T 13336586-C-T FTB36558 YY+
15426513-C-A 13314633-C-A FT125099 YY+
21415509-C-T 19253623-C-T FTB38130 YY+
11662391-G-C +
13658908-A-T 11503232-A-T +
13622509-G-T 11466833-G-T +
10647006-C-G FT265185 +
9056817-C-T 9219208-C-T FT125000 Y+
24270917-A-ATT 22124770-A-ATT P3_b1 19×T+
16670836-G-T 14558956-G-T FT125137 YY+
15621507-C-T 13509627-C-T FT246131 YY+
16654593-A-G 14542713-A-G FTB36967 YY+
8588023-T-C 8719982-T-C FTB24456 YY+
17327701-G-A 15215821-G-A FT125164 YY+
17411466-A-G 15299586-A-G FTB37225 YY+
17437515-T-A 15325635-T-A FT125173 YY+
18198341-CT-C 16086461-CT-C +
18830952-A-G 16719072-A-G FTB37677 YY+
19240575-A-G 17128695-A-G YY+
19253315-C-T 17141435-C-T FT125233 Y+
19340988-C-T 17229108-C-T FTB37878 YY+
19997887-A-G 17886007-A-G P5_Prx +
9122068-A-ATGGC +
7604454-C-G 7736413-C-G FT124957 YY+
13946178-G-A 11825472-G-A FTB36018 YY+
5402657-T-C 5534616-T-C FT124864 +
23114505-C-T 20952619-C-T FTB38634 YY+
5617658-G-T 5749617-G-T FT404784 +
7376932-G-A 7508891-G-A FTB35395 YY+
22519349-C-T 20357463-C-T FT125301 Y+
2843515-C-A 2975474-C-A FTB35120 YY+
3993507-G-T 4125466-G-T FTB47181 +
14199532-T-G 12078826-T-G BY93780 YY+
4139355-C-T 4271314-C-T +
5694557-AAGACGC-A 5826516-AAGACGC-A +
5762847-C-T 5894806-C-T FTB47345 +
28644667-C-T 26498520-C-T FTB38973 +
7110164-T-G 7242123-T-G FTB35314 YY+
7184227-AT-A 7316186-AT-A +
21515006-G-A 19353120-G-A JFS0202FGC14703 ZS1824 YY+
13455231-T-TTTCCA 11299555-T-TTTCCA 5×TTCCA*
10684004-T-TATTCC *
10889296-T-G *
6614532-A-ATG 6746491-A-ATG 13×TG*
19667829-T-G 17555949-T-G P5_Prx **
22442200-C-A 20280314-C-A DYZ19 **
14730197-AAATACTAATACT-A 12618265-AAATACTAATACT-A 8×AATACT**
22229216-G-T 20067330-G-T BY213348 DYZ19 **
24293033-A-C 22146886-A-C P3_t1 **
16115193-G-GTATT 14003313-G-GTATT P8_Prx 7×TATT**
16159018-A-AG 14047138-A-AG P8_Dst **
22463090-G-A 20301204-G-A FT458140 DYZ19 **
22438757-T-G 20276871-T-G DYZ19 **
22302530-G-T 20140644-G-T DYZ19 **
9173537-T-C 9335928-T-C **
13336877-C-G 11181201-C-G **
28596698-GTTTTTT-G,GTTT 26450551-GTTTTTT-G,GTTT 24×T***
22288192-C-G 20126306-C-G DYZ19 ***
22345315-G-T 20183429-G-T DYZ19 ***
22422404-G-T 20260518-G-T BY174744 DYZ19 ***
18017108-GAT-G 15905228-GAT-G 22×AT***
22288183-A-T 20126297-A-T DYZ19 ***
14938143-A-G 12826218-A-G ***
11036128-T-C ***
10889246-TCCATGCCATGCCATGCCATG-T,TCCATGCCATGCCATGCCATT ***
7223194-CAAA-C,CAA 7355153-CAAA-C,CAA 22×A***
4269806-G-T 4401765-G-T ***
13257268-GATAT-G,GAT 11101592-GATAT-G,GAT 11×AT***
8276195-T-G 8408154-T-G ***
7107009-CTC-C,CTA 7238968-CTC-C,CTA ***
10965578-C-G,T ***
9040208-T-TA 9202599-T-TA ***
10889301-T-G ***
10673439-C-A ***
22254210-G-T 20092324-G-T DYZ19 ***
7554786-AAC-A 7686745-AAC-A 22×AC***
19056-G-C ***

In the table above, the meaning of the confidence field depends on whether the data comes from an FTDNA kit or an FGC kit. For FTDNA kits, + implies a "PASS" result with just one possible variant, * indicates a "PASS" but with multiple variants, ** indicates "REJECTED" with just a single variant, and *** indicates "REJECTED" with multiple possible variants. 'A*' are heterozygous variants not called by FTDNA, but still pulled from the VCF file. For FGC kits, + indicates over 99% likely genuine (95% for INDELs); * over 95% likely genuine (90% for INDELs); ** about 40% likely genuine; *** about 10% likely genuine. Manual entries read directly from a BAM file will be either + indicating positive, or * indicating that the data show a mixture of possible variants.

For the FTDNA kits, the BED data is encoded in the background color of the cells. Those cells with a white background have coverage, those with a grey background indicate no coverage in the BED file, and those with a pink background indicate the mutation is on the edge of a coverage region. These pink regions often indicate that the individual may be positive for a SNP even if there is no corresponding entry in the vcf file.

The combBED column indicates whether or not the mutation is a SNP and falls in the combBED region defined in Defining a New Rate Constant for Y-Chromosome SNPs based on Full Sequencing Data by Dmitry Adamov, Vladimir Guryanov, Sergey Karzhavin, Vladimir Tagankin, Vadim Urasin.

The McDonald BED column indicates whether or not the mutation is a SNP and falls in the BED region used by Dr. Iain McDonald in the age analysis he does for R-U106 men.

Age Analysis Information (work in progress)

AllMcDonaldYFull
Kit: 9350071517310095286058408764
Used in age calculations1517310095286058408764
Counts of SNPs2322
Variant counts last updated 2022-04-15 03:11:11.



Big Tree Main Page