Tree Position

R-P312/S116 > Z290 > L21/S145 > S552 > DF13 > Z39589 > S1026 > Z16886 > Z16910 > S516 > BY39727 > FT29293

Unique Mutations

The mutations unique to this man are summarized in the table below. Those with a '+' or '*' confidence level are considered by FamilyTreeDNA or FullGenomesCorp to be high quality SNPs/INDELs. For completeness, all other mutations of lesser confidence are included as well. These additional mutations may be useful for distinguishing between very closely related men.

Occasionally, some of the mutations listed here will be thought to be shared with other men in which case they might appear in upstream blocks on the tree. When this happens, the 'Blocks' field will indicate what block they appear in. Such a situation might arise with BigY men if the BED data suggests another man may be positive for a SNP, even though it doesn't appear in his VCF data. It might also happen if Chromo2 testing or Sanger sequencing of other men not on the tree show the SNP to be shared.

POS-REF-ALT (hg19) POS-REF-ALT (hg38) Blocks Names Region McDonald BED combBED STRYSEQ
WGS22835
14056464-C-CAAA 11935758-C-CAAA 53×A+
26099875-C-CAA 23953728-C-CAA P1_Y1 +
10474392-A-C +
10474401-T-C +
10474432-A-C +
10474438-T-C +
10474444-G-A +
25609191-G-A 23463044-G-A P1_gr1 +
10474450-A-G +
10474452-TCAAA-T +
10474457-C-CTTCT +
27127650-CT-C 24981503-CT-C P1_g3 +
56737314-G-A +
27127654-CTTT-C 24981507-CTTT-C P1_g3 +
27161914-C-CA 25015767-C-CA P1_g3 32×A+
5195263-C-T 5327222-C-T +
28253537-G-T 26107390-G-T P1_b4 +
58877261-C-A 56713610-G-T +
2845221-C-CAA 2977180-C-CAA 38×A+
58853629-G-A 56737242-C-T +
17061944-C-A 14950064-C-A Y+
16834746-C-CAAAAAA 14722866-C-CAAAAAA 45×A+
24420879-A-ATTTTT 22274732-A-ATTTTT 43×T+
21756966-A-C +
16818971-G-GTATATATA 14707091-G-GTATATATA 21×TA+
7440307-T-C 7572266-T-C Y+
8883522-A-G 9015481-A-G Y+
8480955-C-T 8612914-C-T YY+
22260280-C-T 20098394-C-T DYZ19 +
22503425-G-C 20341539-G-C DYZ19 +
22503692-T-TCA 20341806-T-TCA DYZ19 +
22503693-TGA-T 20341807-TGA-T DYZ19 +
22260267-GT-G 20098381-GT-G DYZ19 +
22260263-C-CT 20098377-C-CT DYZ19 +
9970605-G-T 10132996-G-T Y+
22636166-G-A 20474280-G-A Y+
21756955-AT-A +
22636183-T-C 20474297-T-C Y+
22802868-A-ATTTTTTTTTTTTTTTTTTTTTTTTTTTT 20640982-A-ATTTTTTTTTTTTTTTTTTTTTTTTTTTT 32×T+
23051207-T-G 20889321-T-G Y+
21575219-C-CT 19413333-C-CT +
7025223-CT-C 7157182-CT-C +
15309739-C-CAA 13197843-C-CA 41×A+
21756930-C-T +
21756938-G-A +
21756950-T-C +
15865946-C-CTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 13754066-C-CTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 37×T+
18742404-C-CAAAAAA 16630524-C-CAAAAAA 38×A+
15367754-G-T 13255874-G-T FT30009 Y+
15145337-A-G 13033424-A-G YY+
11028340-T-TTCACCATTCCATTGCATTCCATTCCATCCAATTCTATTCCACTCTATTTCACTCCACTCCACTCCATTAGA +
56737339-G-A +
58857375-T-A 56733496-A-T +
14421893-T-A 12301168-T-A FT29772 Y+
13584054-G-A 11428378-G-A +
15247666-T-A 13135752-T-A Y+
15247664-G-T 13135750-G-T Y+
13483075-G-C 11327399-G-C *
6858617-TGAGATGGAG-T 6990576-TGAGATGGAG-T *
10803766-C-T *
13373900-C-A 11218224-C-A *
7139831-T-TGGGGGGGGGGG 7271790-T-TGGGGGGGGGGG *
13461868-T-A 11306192-T-A *
7139829-GCT-G 7271788-GCT-G *
13720932-G-T 11565256-G-T *
7139828-C-G 7271787-C-G YY*
21402778-AGTTTG-A 19240892-AGTTTG-A *
56830816-ACTCC-A *
6617108-A-G 6749067-A-G Y*
6617338-C-T 6749297-C-T Y*
9980216-A-T 10142607-A-T Y*
6617085-A-G 6749044-A-G Y*
13204353-T-C 11048677-T-C *
13204356-TGGTG-T 11048680-TGGTG-T *
13204361-ATGATG-A 11048685-ATGATG-A *
13462475-T-G 11306799-T-G *
13542829-C-T 11387153-C-T *
13701922-C-T 11546246-C-T *
6617037-G-C 6748996-G-C Y*
10803765-C-T *
7451264-A-T 7583223-A-T IR1_L *
7451043-TA-T 7583002-TA-T IR1_L 13×A*
13488975-G-C 11333299-G-C *
9909111-C-G 10071502-C-G Y*
9510763-T-A 9673154-T-A *
9507982-C-CTTTTTT 9670373-C-CTTTTTT 34×T*
9304459-G-GGGGGGGGGGGC 9466850-G-GGGGGGGGGGGC *
9300273-A-T 9462664-A-T Y*
9090115-C-CCGTTGAAGAAGCTTATAAAGGTTATGAAGGTCTTAAAGGTGTTACCCATAGCATTGAGATTA 9252506-C-CCGTTGAAGAAGCTTATAAAGGTTATGAAGGTCTTAAAGGTGTTACCCATAGCATTGAGATTA *
9075208-TG-T 9237599-TG-T *
13472215-AC-A 11316539-AC-A *
8826720-A-C 8958679-A-C Y*
8630641-T-TTCTGGTTCCTGATGGGACGCGTCGGAGGCGGCTCCTCCGTGATGAGCTTCTCCAAGTCCCGCGCGAAGAAATTCACCAAG 8762600-T-TTCTGGTTCCTGATGGGACGCGTCGGAGGCGGCTCCTCCGTGATGAGCTTCTCCAAGTCCCGCGCGAAGAAATTCACCAAG *
8247250-T-TTCCTAATGCGAAGATTGACGCATGAGAAAATGCACCACCGGAGAACATGTCCAAAAGTGACATAAGACC 8379209-T-TTCCTAATGCGAAGATTGACGCATGAGAAAATGCACCACCGGAGAACATGTCCAAAAGTGACATAAGACC *
6553620-G-A 6685579-G-A *
7730475-C-G,G 7862434-C-G,G *
19025774-A-T 16913894-A-T Y*
19025775-A-T 16913895-A-T Y*
22508982-T-C 20347096-T-C DYZ19 *
28586584-C-T 26440437-C-T *
56695756-GGAATGGAAAGGAATT-G *
56735859-G-C *
9980213-AG-A 10142604-AG-A *
7717737-C-CTTCCTTCT,CTTCCTTCT 7849696-C-CTTCCTTCT,CTTCCTTCT 13×TTCT*
7534406-G-GTTTTTTTTT 7666365-G-GTTTTTTTTT 19×T*
13473733-A-T 11318057-A-T *
56734206-GAATGGAATTGACTCA-G *
13701934-G-C 11546258-G-C *
3769067-C-A 3901026-C-A 8×T*
11293364-C- *
4098557-C-T 4230516-C-T *
4098547-A-G 4230506-A-G *
4098541-A-T 4230500-A-T *
4098525-TAAAG-T 4230484-TAAAG-T *
4098514-G-A 4230473-G-A *
13462394-G-T 11306718-G-T *
4017967-CA-C 4149926-CA-C *
3809136-A-ATTTT 3941095-A-ATTTT 31×T*
3573197-ATCTCAGATTGTCGCTAGGAGGTGTGAAAGGAAAATATCTTGGGCCCCTACAATTACAATCACGAAGCTAAAGGGAAAATTCAAGTTTGGAACTGCTTAGGGCAACCTGCCTCCCATTCTATTCTAATAAGTAGGGTAAGTG-A 3705156-ATCTCAGATTGTCGCTAGGAGGTGTGAAAGGAAAATATCTTGGGCCCCTACAATTACAATCACGAAGCTAAAGGGAAAATTCAAGTTTGGAACTGCTTAGGGCAACCTGCCTCCCATTCTATTCTAATAAGTAGGGTAAGTG-A *
4659051-T-C 4791010-T-C *
3547577-T-C 3679536-T-C *
3405995-C-T 3537954-C-T *
13462481-G-T 11306805-G-T *
13462487-C-G 11306811-C-G *
2653744-TA-T 2785703-TA-T *
56689175-T-G *
13462496-T-A 11306820-T-A *
28803292-G-T 26657145-G-T *
23793898-C-A 21632012-C-A Y*
22507821-A-T 20345935-A-T DYZ19 *
4207957-CA-C,CAA 4339916-CA-C,CAA 22×A*
4848574-G-T 4980533-G-T 29×T*
13483101-C-G 11327425-C-G *
10803777-A-T *
10126556-C- *
10678188-ATTC-A *
13467997-A-C 11312321-A-C *
13480887-C-G 11325211-C-G *
13243329-AC-A 11087653-AC-A *
13486021-C-T 11330345-C-T *
22459714-C-A 20297828-C-A DYZ19 *
6403299-GTT-G 6535258-GTT-G *
22509191-A-T 20347305-A-T DYZ19 *
10803771-T-G *
6403296-GT-G 6535255-GT-G *
4909353-T-C 5041312-T-C *
6402377-G-A 6534336-G-A *
6402330-C-G 6534289-C-G *
6091744-TTTTTG-T 6223703-TTTTTG-T *
5986625-A-ATTT 6118584-A-ATTT *
5986623-TAA-T 6118582-TAA-T *
5571879-C-A 5703838-C-A *
5477491-C-T 5609450-C-T *
5525256-A- *
10803781-C-CGATACACTTT *
5191228-CT-C,CTT 5323187-CT-C,CTT 27×T*
9909118-T-A 10071509-T-A Y*
9956886-A-G 10119277-A-G Y*
9909128-G-C 10071519-G-C Y*
10846486-A-C *
10920929-A-C *
10910831-GA-G,G *
10910828-AC-A,A *
10910755-TA-T,T *
10888054-T-C *
10880982-C-CGGGTT *
10860321-C-CACTCT *
10851074-C-CCATTCCATTT *
10851068-T-TGCACTCCACA *
10851056-A-ATTCCACTCCACTCCACTCCACTCCGTTCCT *
10851041-A-ACTCCATTTCACTCCATTCCACTCCACTCCACTCCATTCCACTCCG *
10846487-T-A *
10842341-T-C *
10930031-CTCCATTTCTG-C *
10839072-T-C *
10826257-A-G *
10826256-C-T *
10825648-A-ATTCCG *
10814330-C-CTAGGT *
10811048-T-A *
10811046-A-AC *
10811042-C-A *
10807374-CCTT-C *
10807371-ATT-A *
10807279-C- *
10799539-C-CCATTT *
10796545-C-G *
10926755-C-G *
10930810-C-T *
10792747-C-G *
10949690-T-C *
10987432-TCTACTCCATTCCATTCAATTC-T *
10987428-CCCTTCTACTCCATTCCATTCAATTCCCTACCATTCCATTCCAT- *
10985416-T-TTCCATTCCATTCCCTTCCAATCCACTCTATTCCATTCCACTCCACTCCATTCCACTCCACTCCTCTCCATTCCACTCCACTCCTCTCCATTCCACTCCACTCCAGTCAAC,TTCCATTCCATTCCCTTCCAATCCACTCTATTCCATTCCACTCCACTCCATTCCACTCCACTCCTCTCCATTCCACTCCACTCCTCTCCATTCCACTCCACTCCAGTCAAC *
10977142-G-GAATC *
10977141-T-TC *
10975463-C-T *
10972695-T-G *
10972688-T-A *
10971983-A-C *
10954053-C-T *
10953769-C-T *
10953759-C-CACCATTTCACGGCAT *
10952284-C-G *
10949684-ATTC-A *
10934872-GCATTCCATC- *
10949678-AATT-A *
10949672-CCTTT-C *
10949667-C-G *
10949654-ATTCCC-A *
10947680-T-G *
10937715-C-G *
10937713-T-C *
10937712-C-A *
10935929-AATTTCACTCCATTCCTTTGCACTCCACTACATTCCACTCCACTCC-A *
10935353-A-AG *
10935352-C-T *
10934891-TCA- *
10934888-A- *
10796535-C-T *
10792301-C-T *
9909171-G-T 10071562-G-T Y*
10119287-AGTGTTCTGGAATCCTATGCGAGGGACAAACATTCAGAACCTCGTAGCAGTG- *
10056093-T-C 10218484-T-C *
10056088-C-T 10218479-C-T *
10056083-A-G 10218474-A-G *
10056072-T-G 10218463-T-G *
10042538-C-A 10204929-C-A *
10042534-T-G 10204925-T-G *
10042519-T-C 10204910-T-C *
10022452-C-T 10184843-C-T Y*
9997387-T-C 10159778-T-C Y*
9993453-G-T 10155844-G-T Y*
9992700-T-C 10155091-T-C Y*
9992638-G-T 10155029-G-T Y*
9957209-C-T 10119600-C-T Y*
13470311-C-A 11314635-C-A *
10068241-T-G 10230632-T-G *
9956780-G-A 10119171-G-A Y*
9945780-G-A 10108171-G-A Y*
9945776-T-TGAAG 10108167-T-TGAAG *
9944776-C-T 10107167-C-T Y*
9943876-C-T 10106267-C-T Y*
9932035-A-G 10094426-A-G Y*
9924676-T-A 10087067-T-A Y*
9924672-A-G 10087063-A-G Y*
9924646-G-T 10087037-G-T Y*
9916199-T-A 10078590-T-A Y*
9916197-A-T 10078588-A-T Y*
9916193-A-T 10078584-A-T Y*
9916153-T-A 10078544-T-A Y*
10056117-C-T 10218508-C-T *
10069301-C-G 10231692-C-G *
10792293-A-G *
10678194-T-TCAC *
10792287-C-T *
10792286-C-T *
10788976-A-G *
10786839-CTGTAT-C *
10763140-C-T,T *
10759427-A-T *
10754013-T-G *
10754005-C-G *
10754004-C-T *
10753250-C-A *
10750462-C-A *
10745749-C-CAATCT *
10679708-T-TCAGAAGATCTCAC *
10673940-TTGCACC- *
10069302-A-C 10231693-A-C *
10673934-ATTCC- *
10672256-TTTTGC-T *
10671798-AC-A *
10663986-T-G *
10663983-A-C *
10663972-C-T *
10663971-C-A *
10663966-C-T *
10663939-TTACAA-T *
10663769-T- *
10657412-T-TATCAGTGTAC *
10626544-A-C *
10082148-A-C 10244539-A-C *
13480246-C-T 11324570-C-T *
13204374-TTATGATAATGGTGGTGATGGTG-T 11048698-TTATGATAATGGTGGTGATGGTG-T *
13470288-C-G 11314612-C-G *
13469979-T-C 11314303-T-C *
28798949-G-A 26652802-G-A *
28798941-ATT-A 26652794-ATT-A *
28798916-AGTGCAGTGGAGCGAAGTGGAGTG-A 26652769-AGTGCAGTGGAGCGAAGTGGAGTG-A *
13692979-GGAATA-G 11537303-GGAATA-G *
13669120-A-T 11513444-A-T *
13489091-G-C 11333415-G-C *
13489028-CTG-C 11333352-CTG-C *
13488675-CG-C 11332999-CG-C *
13482204-T-G 11326528-T-G *
13479478-C-A 11323802-C-A *
13479477-C-A 11323801-C-A *
13470460-A-C 11314784-A-C *
13464071-G-A 11308395-G-A *
28802582-T-C 26656435-T-C *
13464048-G-A 11308372-G-A *
10947651-CTTCT-C *
10934868-CATTGCATTCCATCCCACTCAACTCA-C *
10918075-C-T FT92017 *
10888001-C-A *
10860919-TGCATG-T *
10082123-A-G 10244514-A-G *
10082092-G-T 10244483-G-T FTB39153 *
10082079-A-G 10244470-A-G *
10082076-A-T 10244467-A-T *
10082053-T-A 10244444-T-A *
10082016-G-T 10244407-G-T *
9966419-G-C 10128810-G-C Y*
28802574-G-C 26656427-G-C *
28802597-T-A 26656450-T-A *
9924671-A-C 10087062-A-C Y*
13465624-TCA-T 11309948-TCA-T *
9962628-A-T 10125019-A-T Y*
56835864-C-CACTCTA *
56832931-T-TCCTCTGCAC *
56771207-T-A *
56705577-A-G *
56674395-G-A *
13699376-G-T 11543700-G-T *
13699374-T-C 11543698-T-C *
13689664-T-A 11533988-T-A *
13480731-C-T 11325055-C-T *
13480723-C-T 11325047-C-T *
13465627-T-TGG 11309951-T-TGG *
13465593-A-G 11309917-A-G *
28803335-T-G 26657188-T-G *
13428165-C-G 11272489-C-G *
13428161-T-C 11272485-T-C *
13242234-CAGGA-C 11086558-CAGGA-C *
13242232-A-AT 11086556-A-AT *
10025351-T-C 10187742-T-C Y*
10025344-C-G 10187735-C-G Y*
56771416-A-T *
56757236-G-A *
56751875-G-A,T *
56751872-G-A *
56734105-G-A *
56705614-T-C *
28806323-G-C 26660176-G-C *
9964168-G-GTA 10126559-G-GTA *
5308801-G-T,T 5440760-G-T,T *
10093745-G-T 10256136-G-T *
13488245-G-C 11332569-G-C *
21757200-T-C *
22484076-T-C 20322190-T-C DYZ19 *
13529601-G-A 11373925-G-A *
13492326-G-T 11336650-G-T FT99775 *
13489987-A-C 11334311-A-C *
13489900-AC-A 11334224-AC-A *
13489782-C-A 11334106-C-A *
13489777-C-T 11334101-C-T *
13489762-C-T 11334086-C-T *
13489754-C-G 11334078-C-G *
13489673-GA-G 11333997-GA-G *
13489407-G-C 11333731-G-C *
13484262-T-C 11328586-T-C *
21757208-G-C *
13484222-T-G 11328546-T-G *
13484209-G-C 11328533-G-C *
13484203-A-T 11328527-A-T *
13483796-G-C 11328120-G-C *
13483788-A-C 11328112-A-C *
13482881-A-G 11327205-A-G *
13480908-C-T 11325232-C-T *
13480710-GT-G 11325034-GT-G *
13480707-A-AT 11325031-A-AT *
13474804-A-AG 11319128-A-AG *
13472295-G-A 11316619-G-A *
13472271-C-CCT 11316595-C-CCT *
13472265-GAA-G 11316589-GAA-G *
21757201-C-T *
21757212-T-A *
56751663-CTGGAATGGAA-C *
13470160-G-GCT 11314484-G-GCT *
56724504-G-T *
56724503-G-T *
56706474-A-C,T *
13721720-T-TAAGGG 11566044-T-TAAGGG *
13689478-A-G 11533802-A-G BY35210 *
13637077-AAAAC-A 11481401-AAAAC-A *
13488777-TCCG-T 11333101-TCCG-T *
13481092-T-A 11325416-T-A *
13476765-C-A 11321089-C-A *
13476763-T-A 11321087-T-A *
13474776-A-G 11319100-A-G *
13472563-C-CTGCAGTAAGCAGAGCCTAGACAAGAGTTACATCACCTGGGTGATCAGGGCAGAGATATTTCACAAT 11316887-C-CTGCAGTAAGCAGAGCCTAGACAAGAGTTACATCACCTGGGTGATCAGGGCAGAGATATTTCACAAT *
13470689-T-G 11315013-T-G *
13466850-G-A 11311174-G-A *
28806884-T-A 26660737-T-A *
13463180-CTG-C 11307504-CTG-C *
13461697-CCCATCACCTGGCTGATCAGTGCAGAGT-C 11306021-CCCATCACCTGGCTGATCAGTGCAGAGT-C *
10947648-AT-A *
10626603-G-T *
10626567-C-A *
9983925-G-T 10146316-G-T Y*
9983924-T-G 10146315-T-G Y*
9967392-A-G 10129783-A-G Y*
8644324-C-CAA 8776283-C-CAA 32×A*
56755103-T-A *
56755090-G-T *
56734377-A-G *
56724288-GGAATGGAAAGGAATT-G *
9962693-C-G 10125084-C-G Y*
10093749-C-T 10256140-C-T *
13470277-C-G 11314601-C-G *
23793919-C-T 21632033-C-T Y*
13489749-C-G 11334073-C-G *
13488851-CGGT-C 11333175-CGGT-C *
13476656-G-A 11320980-G-A *
13470599-G-T 11314923-G-T *
13467452-G-A 11311776-G-A *
9941083-T-C 10103474-T-C Y*
9941073-G-C 10103464-G-C Y*
9941072-A-T 10103463-A-T Y*
7827682-C-CAAAA 7959641-C-CAAAA *
7827681-C-G 7959640-C-G YY*
13702754-A-AGAACGGAC 11547078-A-AGAACGGAC *
13702753-A-ATC 11547077-A-ATC *
13466868-T-C 11311192-T-C *
13811241-A-ATCAACTCGAT 11690535-A-ATCAACTCGAT *
9983986-CACCAGTGGCTCATGGCTCACTCCCTCCCTTGCAAACCAGCAGCTCACGGCCTGCTCCCTCCCCTGCAT-C 10146377-CACCAGTGGCTCATGGCTCACTCCCTCCCTTGCAAACCAGCAGCTCACGGCCTGCTCCCTCCCCTGCAT-C *
10626622-C-T *
10626609-T-TTGCATTCCAC *
56826011-C-A,CATTCGATTGCA *
24422478-C-CAA,CAA 22276331-C-CAA,CAA 43×A*
22477959-G-T 20316073-G-T BY25216 DYZ19 *
22477952-A-T 20316066-A-T BY25213 DYZ19 *
13489033-C-CCT 11333357-C-CCT *
56836876-T-TTCCATTCCACTCCATTCCAC *
56724268-T-C *
28815341-A-ATGGAATGGAG 26669194-A-ATGGAATGGAG *
28784753-T-A 26638606-T-A *
28784745-GAA-G 26638598-GAA-G *
13711227-G-A 11555551-G-A *
13811244-G-C 11690538-G-C *
28784723-TGGAGGGA-T 26638576-TGGAGGGA-T *
13735077-G-T 11579401-G-T *
13470273-C-T 11314597-C-T *
13451308-A-G,G 11295632-A-G,G *
10860938-T-C *
10842337-T-A *
10842333-T-C *
10842331-T-C *
9975163-G-A 10137554-G-A Y*
9944027-C-T 10106418-C-T Y*
56714465-T-C *
23415298-ATG-A,A 21253412-ATG-A,A *
13735083-A-C 11579407-A-C *
13735080-A-C 11579404-A-C *
13473855-C-G 11318179-C-G *
9996826-C-T 10159217-C-T Y*
13449142-A-AGTC 11293466-A-AGTC *
10987851-TTCCATTCCATTCCAC- *
10986990-G-C *
10869640-C-A *
10827088-C-T *
10827075-A-C *
10803773-G-C *
10043200-A-G 10205591-A-G *
10043195-AAC-A 10205586-AAC-A *
10043160-A-G 10205551-A-G *
10022429-A-G 10184820-A-G Y*
10022422-G-C 10184813-G-C Y*
9996846-T-G 10159237-T-G Y*
28784743-T-TGC 26638596-T-TGC *
28784712-GGGGAGTGC-G 26638565-GGGGAGTGC-G *
10093767-G-A 10256158-G-A *
13489549-C-G 11333873-C-G *
13474620-T-A 11318944-T-A *
56830805-C-CA *
56757336-AT-A *
56756464-A-T *
56756309-G-A *
56731568-C-A *
56705528-A-C *
56680375-A-G *
28818194-GTGGAATGGAA-G 26672047-GTGGAATGGAA-G 5×TGGAA*
13707392-A-G 11551716-A-G *
13637469-G-C 11481793-G-C *
13489583-A-C 11333907-A-C *
13488204-G-T 11332528-G-T *
10949695-C-T *
13476653-C-A 11320977-C-A *
13471557-TCA-T 11315881-TCA-T *
13470513-C-A 11314837-C-A *
13469339-A-T 11313663-A-T *
13436142-A-G 11280466-A-G *
13418135-A-G 11262459-A-G *
13418112-C-T 11262436-C-T *
10807391-A-C *
10807358-T-TTCC *
10667704-T-TTCCGC *
10093782-A-G 10256173-A-G *
10093772-G-A 10256163-G-A *
10093768-T-C 10256159-T-C *
10949689-T-A *
13476600-G-A 11320924-G-A *
28784710-G-C 26638563-G-C *
9962643-C-T 10125034-C-T Y*
28784703-TG-T 26638556-TG-T *
28784696-AATTG-A 26638549-AATTG-A *
13489621-C-CAA 11333945-C-CAA *
13489599-C-T 11333923-C-T *
13489291-CAG-C 11333615-CAG-C *
13473708-C-G 11318032-C-G *
13472156-C-A 11316480-C-A *
13464285-A-G 11308609-A-G *
10888049-C-CCTCACTCCAG *
10860935-C-A *
9993125-G-C 10155516-G-C Y*
9993117-T-C 10155508-T-C Y*
9962646-G-A 10125037-G-A Y*
9962564-G-A 10124955-G-A Y*
11023172-ACTCC-A *
56685477-A-T *
22508801-G-A 20346915-G-A DYZ19 *
18447445-A-T 16335565-A-T P6_Dst *
9943885-ATTACATTAAACTCAGTGCTGCCATGTCAGTAAAGACCTGGCAGAATTCATCACCTGCTGACTAAAGAACCCCTGTAC-A 10106276-ATTACATTAAACTCAGTGCTGCCATGTCAGTAAAGACCTGGCAGAATTCATCACCTGCTGACTAAAGAACCCCTGTAC-A *
9943883-AC-A 10106274-AC-A *
9943878-G-A 10106269-G-A Y*
56737259-GAATGGAATTGAATGGAATGGAATAATATGA-G,G *
28791415-T-C 26645268-T-C *
14306986-C-T 12186280-C-T Y*
13486053-A-T 11330377-A-T *
13466553-A-G 11310877-A-G *
13466514-G-T 11310838-G-T *
13466495-T-G 11310819-T-G *
10987458-CCAT-C *
13377758-C-T 11222082-C-T *
10989171-C-CCACTCCACTCAACTCTACTCCACTCCACTCCATTCTACCACAATCCACTCCATTTCACTCCACTCCACTCCATTCCACTCCACTGCACTCCACTA *
21402743-G-GC 19240857-G-GC *
21714748-C-CAA,CAA 19552862-C-CAA,CAA 53×A*
21698309-T-TAA 19536423-T-TAA 24×A*
21504019-C-G 19342133-C-G YY*
21402777-T-TCGC 19240891-T-TCGC *
21402775-T-TCCTCAAAA 19240889-T-TCCTCAAAA *
21402768-CCTTTT-C 19240882-CCTTTT-C *
21402764-CCT-C 19240878-CCT-C *
21402760-C-A 19240874-C-A YY*
21402759-C-A 19240873-C-A YY*
21402757-T-TTAACAAACG 19240871-T-TTAACAAACG *
21402747-CCTGATG-C 19240861-CCTGATG-C *
21402745-T-C 19240859-T-C YY*
21402739-G-GACCGA 19240853-G-GACCGA *
22228429-A-AT 20066543-A-AT DYZ19 *
21402736-ATT-A 19240850-ATT-A *
21402734-T-C 19240848-T-C YY*
21402732-C-CCCG 19240846-C-CCCG *
21142834-C-CAA 18980948-C-CAA 16×A*
19802153-A-G 17690273-A-G P5_Prx *
19604839-T-A 17492959-T-A P5_Prx Y*
19561229-C-T 17449349-C-T Y*
19528720-T-TCAACGAATATGACCCCGATGTTCAGAAGCAGTTTGCGGCTATGA 17416840-T-TCAACGAATATGACCCCGATGTTCAGAAGCAGTTTGCGGCTATGA *
19528717-T-TCAAACTCCTCAACTA 17416837-T-TCAAACTCCTCAACTA *
19528715-A-AAC 17416835-A-AAC *
19438146-GA-G 17326266-GA-G *
19036745-A-ATTTTTTT 16924865-A-ATTTTTTT *
18914081-G-T 16802201-G-T YY*
22220555-C-A 20058669-C-A DYZ19 *
22239052-C-G 20077166-C-G DYZ19 *
18616703-A-T 16504823-A-T YY*
22437962-A-T 20276076-A-T DYZ19 *
22488252-T-A 20326366-T-A DYZ19 *
22486364-A-T 20324478-A-T DYZ19 *
22486324-A-T 20324438-A-T DYZ19 *
22484066-GCA-G 20322180-GCA-G DYZ19 *
22472811-G-C 20310925-G-C FT459368 DYZ19 *
22472807-GTGA-G 20310921-GTGA-G DYZ19 *
22459723-T-G 20297837-T-G DYZ19 *
22459717-C-G 20297831-C-G DYZ19 *
22459716-G-C 20297830-G-C DYZ19 *
22449124-A-C 20287238-A-C DYZ19 *
22449089-A-T 20287203-A-T DYZ19 *
22449076-C-T 20287190-C-T DYZ19 *
22352575-G-T 20190689-G-T DYZ19 *
22239589-C-G 20077703-C-G DYZ19 *
22352550-T-G 20190664-T-G DYZ19 *
22352542-T-C 20190656-T-C DYZ19 *
22345997-C-G,G 20184111-C-G,G DYZ19 *
22345688-C-T,T 20183802-C-T,T DYZ19 *
22334743-C-G 20172857-C-G DYZ19 *
22325453-TTTGTTCCTTCAGATAAGTCTAGAGA-T 20163567-TTTGTTCCTTCAGATAAGTCTAGAGA-T DYZ19 *
22325393-AGAATGAAGCTGCAGAATTTAGTGGTGAGCGTTACAGCACTTAAGTTTTTAT-A 20163507-AGAATGAAGCTGCAGAATTTAGTGGTGAGCGTTACAGCACTTAAGTTTTTAT-A DYZ19 *
22325343-TGTGTCCAGAGTTTCTTCCTTGTGGCAGGTTCATGGTCTTGCTCACTTC-T 20163457-TGTGTCCAGAGTTTCTTCCTTGTGGCAGGTTCATGGTCTTGCTCACTTC-T DYZ19 *
22321378-CTCTGGCAGGTTCATGGTCTTGCTCACTTCAAGAATGAAGATGCAGACCTTTACGGTGAGTGTTACAGCACATAAAGGTGTTATATCCAGAGTTTGTTCCTTCAGATGTGTCCAGAGTTTCTTCCT-C 20159492-CTCTGGCAGGTTCATGGTCTTGCTCACTTCAAGAATGAAGATGCAGACCTTTACGGTGAGTGTTACAGCACATAAAGGTGTTATATCCAGAGTTTGTTCCTTCAGATGTGTCCAGAGTTTCTTCCT-C DYZ19 *
22288324-GTTGAGTGTTACAGCATTTAAACGTGTTATGTCCAGAGTTTGTTCCTTTAGATGTGTCCAGAGTTTCTTCCTTCAGGCAGGTTCATGGTCTTGCTCATTTCAAGAATGAAGCTGCAGACC-G 20126438-GTTGAGTGTTACAGCATTTAAACGTGTTATGTCCAGAGTTTGTTCCTTTAGATGTGTCCAGAGTTTCTTCCTTCAGGCAGGTTCATGGTCTTGCTCATTTCAAGAATGAAGCTGCAGACC-G DYZ19 *
22288315-GACCTTT-G 20126429-GACCTTT-G DYZ19 *
22267941-A-T 20106055-A-T DYZ19 *
22249788-TCATGGTCTTGCTCACTTCAAGAATGAAGCTGCAGACCTTAGTGCTGAGCGTTACAGCACTTAAGTTTTTATGTCCAGAGTTTGTTCCTTCAGATAAGTCCAGAGATTCTTCCTTCTGGCAGGTC-T 20087902-TCATGGTCTTGCTCACTTCAAGAATGAAGCTGCAGACCTTAGTGCTGAGCGTTACAGCACTTAAGTTTTTATGTCCAGAGTTTGTTCCTTCAGATAAGTCCAGAGATTCTTCCTTCTGGCAGGTC-T DYZ19 *
18653684-CA-C,CAA 16541804-CA-C,CAA 20×A*
17936490-T-C 15824610-T-C YY*
22490530-AGAATGAAG-A 20328644-AGAATGAAG-A DYZ19 *
13842737-G-A 11722031-G-A *
14459539-A-G 12338812-A-G YY*
14459538-C-T 12338811-C-T YY*
14391769-TA-T 12271065-TA-T *
14151367-C-CTTGAATAATCCGATTTCTTGAGTGTTTCCAACGTGGATACCCCCACAAAGTTCGATTGACCAGTCACCAATGTTG 12030661-C-CTTGAATAATCCGATTTCTTGAGTGTTTCCAACGTGGATACCCCCACAAAGTTCGATTGACCAGTCACCAATGTTG *
9211352-AAC-A 9373743-AAC-A 22×AC*
14035337-C-T 11914631-C-T YY*
13869214-TGAATG-T 11748508-TGAATG-T *
13858104-T-C 11737398-T-C *
13858099-T-A 11737393-T-A *
13858086-G-C 11737380-G-C *
13858074-T-C 11737368-T-C *
13853123-GAATGA-G,G 11732417-GAATGA-G,G *
13833892-C-A 11713186-C-A *
14459547-A-G 12338820-A-G YY*
13833885-T-TCATCC 11713179-T-TCATCC *
13811256-A-G 11690550-A-G *
13811252-T-C 11690546-T-C *
13811251-A-C 11690545-A-C *
13811250-A-G 11690544-A-G *
13808969-C-CAACGCGAGTACAGGGGAATGTAAGGGAACGGAATGCAATGGAATGGAATCATCCGGAATGGAATGGAATGGAATGGAATGGACAT 11688263-C-CAACGCGAGTACAGGGGAATGTAAGGGAACGGAATGCAATGGAATGGAATCATCCGGAATGGAATGGAATGGAATGGAATGGACAT *
13808775-G-A 11688069-G-A *
13808765-G-C 11688059-G-C *
13808757-A-T 11688051-A-T *
13808752-A-T 11688046-A-T *
13808741-A-T 11688035-A-T *
13808739-GC-G 11688033-GC-G *
13808735-G-GA 11688029-G-GA *
14459544-C-T 12338817-C-T YY*
14529108-A-G 12417309-A-G YY*
17920983-A-AAAG 15809103-A-AAAG *
16588668-T-TAA 14476788-T-TAA 10×A*
17705865-T-TCCTGCGCGACCTTCTCATCTTCGTAGTGGAGGACGTGAAAGGTTCCCTACCGAACTACATCAAAGCTCTCACAAGCGATAGCGCCCTCAGTAACG 15593985-T-TCCTGCGCGACCTTCTCATCTTCGTAGTGGAGGACGTGAAAGGTTCCCTACCGAACTACATCAAAGCTCTCACAAGCGATAGCGCCCTCAGTAACG *
17705863-T-TC 15593983-T-TC *
17682964-T-C 15571084-T-C Y*
17577267-G-GTCGTTACTATATTTACTATCAAGGACAAAGTGAATTAGAAAGCAAATGGCAAGCACGTTACAATAAAGAAACTGATACTTTTGAGCTTGACCATTGGGGAACTAATATTGTTACATTAGAACAATT 15465387-G-GTCGTTACTATATTTACTATCAAGGACAAAGTGAATTAGAAAGCAAATGGCAAGCACGTTACAATAAAGAAACTGATACTTTTGAGCTTGACCATTGGGGAACTAATATTGTTACATTAGAACAATT *
17446767-C-CTTTT 15334887-C-CTTTT 33×T*
17339229-GAAAA-G 15227349-GAAAA-G 13×A*
17233977-A-ACTGGTATCCCATAGAGAAGCCATGGGCACCTGTATC 15122097-A-ACTGGTATCCCATAGAGAAGCCATGGGCACCTGTATC *
17233975-T-TCTGCCGAACGAAGTTTGGCATTG 15122095-T-TCTGCCGAACGAAGTTTGGCATTG *
17187597-T-A 15075717-T-A YY*
17187595-C-A 15075715-C-A YY*
16980802-G-A 14868922-G-A YY*
16819638-C-CA,CAA 14707758-C-CA,CAA 9×A*
16569172-A-AT 14457292-A-AT 10×T*
12450522-C-CTTTTTTT,CTTTTTTT 41×T*
16493946-C-CCAAGTAGTGGTGAATGGCCTAACGGAACAGACTTT 14382066-C-CCAAGTAGTGGTGAATGGCCTAACGGAACAGACTTT *
16321105-G-A 14209225-G-A Y*
15745017-G-GGTCTCCTACATGGTTATCCAAGGTAATAGTAAAGCTGTTCACTTTGTATCTATTATCACCCTCGATATTTTTATTAAGTACTGTCTCTAGGTTATCCTTATAAGT 13633137-G-GGTCTCCTACATGGTTATCCAAGGTAATAGTAAAGCTGTTCACTTTGTATCTATTATCACCCTCGATATTTTTATTAAGTACTGTCTCTAGGTTATCCTTATAAGT *
15438936-T-C 13327056-T-C YY*
15408191-G-GGGGCAAACAACTTGAAGTTTACTTTTAATCAGATTGTCAACCGACAGATAGAAGTGACACTCCTTCTCATCTCTCCTTTGCTTACTTTCTTCCTCTTA 13296311-G-GGGGCAAACAACTTGAAGTTTACTTTTAATCAGATTGTCAACCGACAGATAGAAGTGACACTCCTTCTCATCTCTCCTTTGCTTACTTTCTTCCTCTTA *
15397370-A-AGGCGAGGCATCCCCTGCTTCTCGCGCCACTCCGT 13285490-A-AGGCGAGGCATCCCCTGCTTCTCGCGCCACTCCGT *
15397369-A-AGTCG 13285489-A-AGTCG *
15179010-CAA-C,CAAAA 13067096-CAA-C,CAAAA 25×A*
15098043-A-G 12986131-A-G YY*
15098038-T-A 12986126-T-A YY*
15098033-T-C 12986121-T-C YY*
14884725-G-T 12772791-G-T YY*
14613460-T-A 12501658-T-A Y*
22490490-G-A 20328604-G-A DYZ19 *
22503066-C-A 20341180-C-A DYZ19 *
13808615-G-A 11687909-G-A *
28818222-G-T 26672075-G-T *
56715927-A-C,G *
56714317-G-C *
56714147-G-T *
56713658-C-A *
56710277-G-T *
56710270-G-C *
56710255-A-G *
56705646-G-T *
56696977-C-T *
56695891-G-A *
56695747-A-C,T *
56687368-T-A *
28818210-TGGAATGG-T 26672063-TGGAATGG-T *
56720738-T-A *
28818206-GGAA-G 26672059-GGAA-G *
28818202-G-C 26672055-G-C *
28812909-G-C 26666762-G-C *
28806900-T-A 26660753-T-A *
28805979-T-G 26659832-T-G *
28805763-G-C 26659616-G-C *
28805565-G-C 26659418-G-C *
28803997-T-C 26657850-T-C *
28803689-TGGAATGTAAG-T 26657542-TGGAATGTAAG-T *
28802611-G-T 26656464-G-T *
28802610-A-T 26656463-A-T *
28799231-A-G 26653084-A-G *
28799218-G-T 26653071-G-T *
56720735-G-C *
56721430-G-T *
28793266-G-GAGAAT 26647119-G-GAGAAT *
56830583-TG- *
56876124-CAAAAAAAAAAAAAAAAAAAAAAAAAAAA-C 50×A*
56854684-G-A *
56848662-C-T *
56835840-G-GCAT *
56835839-A-ACT *
56835822-C-G *
56835814-C-G *
56835802-C-CACTCTA *
56834249-GTTCCA- 4×TTCCA*
56833112-A-ATTCCGTTCCACTCCACTCCG *
56832832-T-TCCACTCCTTG *
56832493-ACCGCAC- *
56827713-C-T *
56724007-G-C *
56826818-T-TTTCCATTCCATTCGATTAGATTCCATTCGAGACTGTACTATTACACTCCATTCGATTCCATTCCATTCGATTCCATTCCATTCGA,TTTCCATTCCATTCGATTCCATTCCATTCGATTAGATTCCATTCGAGACTGTACTATTACACTCCATTCGATTCCATTCCATTCGATTCCATTCCATTCGA *
56765907-G-T *
56756293-T-C *
56754598-A-G *
56754577-C-T *
56751883-AGTGG-A *
56751831-G-A *
56747826-AGAATGGAATGGAATC- *
56742552-GAATGGAAAGTAATCC-G *
56736781-A-G *
56735879-G-A *
56732176-A-G *
56724239-G-A *
28799216-G-A 26653069-G-A *
28793256-C-G 26647109-C-G *
22503073-G-T 20341187-G-T DYZ19 *
23793801-T-C 21631915-T-C Y*
26010268-GTA-G,GTATATA 23864121-GTA-G,GTATATA P1_Y1 21×TA*
25402924-G-T 23256777-G-T P2_r2 *
25200847-CAAAGAAAG-C,CAAAG 23054700-CAAAGAAAG-C,CAAAG g1 15×AAAG*
24904490-C-CAA 22758343-C-CAA g1 17×A*
24895661-G-C 22749514-G-C g1 10×A*
24877503-CT-C,CAT 22731356-CT-C,CAT g1 23×T*
24729706-G-T 22583559-G-T P3_b2 *
21757018-G-T *
21756997-T-C *
23793910-T-C 21632024-T-C Y*
23793808-C-T 21631922-C-T FTB49733 Y*
23793805-C-CT 21631919-C-CT *
23069084-A-ACGACAATCTGCACACCCTCGCCGACGGCGGGCACCTGTG 20907198-A-ACGACAATCTGCACACCCTCGCCGACGGCGGGCACCTGTG *
26060211-T-TAAAA 23914064-T-TAAAA P1_Y1 *
23069083-A-ACCTGG 20907197-A-ACCTGG *
23069081-A-AAG 20907195-A-AAG *
23069079-C-CTCGACGTCGTGGGCGG 20907193-C-CTCGACGTCGTGGGCGG *
22852438-G-A 20690552-G-A Y*
22511375-T-A 20349489-T-A DYZ19 *
22511365-T-G 20349479-T-G DYZ19 *
22511332-T-C 20349446-T-C DYZ19 *
22510713-G-C 20348827-G-C DYZ19 *
22510662-C-T 20348776-C-T DYZ19 *
22510631-G-A 20348745-G-A DYZ19 *
22509549-CTGGTGAGTGTTACAGCACTTAAAGCTGTTATGTCCAGAGTTTGTTCCTTCGGATGTTTCCAGAGTTTCTTCCTTCTGGCAGGTTCGTGGTCTTGCTCACTTCTTTAATGAAGCTGCAGACCTTAA-C 20347663-CTGGTGAGTGTTACAGCACTTAAAGCTGTTATGTCCAGAGTTTGTTCCTTCGGATGTTTCCAGAGTTTCTTCCTTCTGGCAGGTTCGTGGTCTTGCTCACTTCTTTAATGAAGCTGCAGACCTTAA-C DYZ19 *
22508115-T-A 20346229-T-A DYZ19 *
22503104-T-C 20341218-T-C DYZ19 *
26024573-G-T 23878426-G-T P1_Y1 *
26416274-C-CAAAAAAAAAAAAAAAAAAAAA 24270127-C-CAAAAAAAAAAAAAAAAAAAAA P1_Y1 24×A*
28793252-A-G 26647105-A-G *
28786065-GGAACA-G 26639918-GGAACA-G *
28793243-T-A 26647096-T-A *
28793237-T-A 26647090-T-A *
26646823-TG- *
26645289-G- *
26645286-T- *
26644957-C- *
28790936-GTT-G 26644789-GTT-G *
28790934-T-TGGAG 26644787-T-TGGAG *
28790932-T-TGGC 26644785-T-TGGC *
28790931-T-A 26644784-T-A *
28786671-G-GTGGAATGGAATGCAGTGGAATGCAGTGGAGTGGAATGGAATGGAATTAATTGGAATGGAATGGAA 26640524-G-GTGGAATGGAATGCAGTGGAATGCAGTGGAGTGGAATGGAATGGAATTAATTGGAATGGAATGGAA 5×TGGAA*
28786076-G-T 26639929-G-T *
28784810-G-C 26638663-G-C *
27432762-TA-T 25286615-TA-T P1_g3 12×A*
28784805-G-C 26638658-G-C *
28784802-G-A 26638655-G-A *
28784793-T-G 26638646-T-G *
28784785-G-T 26638638-G-T *
28784783-T-G 26638636-T-G *
28784779-G-T 26638632-G-T *
28784777-G-T 26638630-G-T *
28784773-T-C 26638626-T-C *
28784767-A-T 26638620-A-T *
28585574-G-A 26439427-G-A *
28549803-G-T 26403656-G-T *
28520627-T-G 26374480-T-G Y*
27432963-T-A 25286816-T-A P1_g3 *
13808727-A-ATGACCACCAG 11688021-A-ATGACCACCAG *
13808611-T-TCTAC 11687905-T-TCTAC *
10998945-T-A *
13467472-C-CA 11311796-C-CA *
13468400-AG-A 11312724-AG-A *
13468387-AGGCAGAT-A 11312711-AGGCAGAT-A *
13468377-AAGTCCCGT-A 11312701-AAGTCCCGT-A *
11312663-CCCCATCACCTGGATGATCAGTGCAGAGTTATGT- *
13468330-A-G 11312654-A-G *
13468292-T-G 11312616-T-G *
13468148-GTT-G 11312472-GTT-G *
13468146-T-TCG 11312470-T-TCG *
11312225-CAGAATTCCCTGTAGGCAGTGCTTATAAAAGTGTTACATCACCTAGGTGATCAGTGCAGAGATTTGTCA- *
11312222-T- *
13467482-G-T 11311806-G-T *
13467481-T-A 11311805-T-A *
13467471-C-CAA 11311795-C-CAA *
13469140-G-A 11313464-G-A *
13467416-A-T 11311740-A-T *
13467382-G-T 11311706-G-T *
13466405-AGGCAGAGCCTAGACAAGAGTCCCATCACCTGGGTGATCAGTGCAGAGTTATGTCAAAATGCCCCC-A 11310729-AGGCAGAGCCTAGACAAGAGTCCCATCACCTGGGTGATCAGTGCAGAGTTATGTCAAAATGCCCCC-A *
13466401-CTGT-C 11310725-CTGT-C *
13466073-G-A 11310397-G-A *
13465995-T-G 11310319-T-G *
13465990-GC-G 11310314-GC-G *
13465986-C-CAA 11310310-C-CAA *
11309950-A- *
13465163-A-G 11309487-A-G *
13464437-T-C 11308761-T-C *
13464418-G-A 11308742-G-A *
13464314-G-A 11308638-G-A *
13468402-AAGAGTTACATCACTCGGGT-A 11312726-AAGAGTTACATCACTCGGGT-A *
13469694-AAAATTCCCATCCGCTGGGTAATC-A 11314018-AAAATTCCCATCCGCTGGGTAATC-A *
13464309-T-C 11308633-T-C *
13473761-C-T 11318085-C-T *
13476947-T-TTTTA 11321271-T-TTTTA *
13476942-G-A 11321266-G-A *
11321187-T- *
13476786-C-G 11321110-C-G *
13476645-G-T 11320969-G-T *
13475595-GGTTGCATCACCTGGGGGATCAGTGCAGAGATATGTCGCAATACCCCCTGTAAGCAGAGCCTAGACAAGAGTTACATCACCTGGGTGATCAGTGCAGAGATATGTGACGAGGCCCCTTTAAGCAGAGC-G 11319919-GGTTGCATCACCTGGGGGATCAGTGCAGAGATATGTCGCAATACCCCCTGTAAGCAGAGCCTAGACAAGAGTTACATCACCTGGGTGATCAGTGCAGAGATATGTGACGAGGCCCCTTTAAGCAGAGC-G *
13475581-AGAACCTACAC-A 11319905-AGAACCTACAC-A *
13475498-AT-A 11319822-AT-A *
13474728-AGT-A 11319052-AGT-A *
13474627-A-T 11318951-A-T *
13474610-A-T 11318934-A-T *
13474609-C-G 11318933-C-G *
13473529-G-T 11317853-G-T *
13469721-GCAGAGATACGTCACAAAGCCCCGTAGGCAGAGCATAGACAAGAT-G 11314045-GCAGAGATACGTCACAAAGCCCCGTAGGCAGAGCATAGACAAGAT-G *
13473514-C-T 11317838-C-T *
13473513-C-T 11317837-C-T *
13473501-C-A 11317825-C-A *
11316617-C- *
13472110-T-G 11316434-T-G *
11316211-A- *
13471553-C-CG 11315877-C-CG *
13471550-C-G 11315874-C-G *
13470566-ATCCG-A 11314890-ATCCG-A *
11314866-GCCA- *
13470342-C-T 11314666-C-T *
11314479-CAG- *
13470072-G-A 11314396-G-A *
13464313-A-G 11308637-A-G *
13464289-C-G 11308613-C-G FT371372 *
11321273-T- *
13342246-C-T 11186570-C-T *
13452075-C-CTCCACTCCAA,CTCCACTCCAATCCAA 11296399-C-CTCCACTCCAA,CTCCACTCCAATCCAA *
11293418-A- *
13449090-CTCCAT-C 11293414-CTCCAT-C *
11292828-T- *
11291456-CATTCCATTCCATTCCATTCCATTCT- *
13446804-GCCATTCCATTCCATTCCATTCCATTCCATTCCATTCCATT-G,GCCATTCCATT 11291128-GCCATTCCATTCCATTCCATTCCATTCCATTCCATTCCATT-G,GCCATTCCATT 12×CCATT*
13425313-G-T 11269637-G-T *
13419864-C-T 11264188-C-T *
13395682-C-T 11240006-C-T *
13471882-GTGTCA-G 11316206-GTGTCA-G *
13364605-G-A 11208929-G-A *
13347107-T-C 11191431-T-C *
13342225-T-C 11186549-T-C *
11297062-TTCC- *
13342224-G-A 11186548-G-A *
13340667-A-C 11184991-A-C *
13340663-C-A 11184987-C-A *
13340658-G-A 11184982-G-A *
13333844-T-C 11178168-T-C *
13323468-A-T 11167792-A-T *
13270013-A-C 11114337-A-C *
13242386-A-G 11086710-A-G *
13196301-T-C 11040625-T-C *
13196267-CCACTCCAGTCCAACTTCATTTCATTG-C 11040591-CCACTCCAGTCCAACTTCATTTCATTG-C *
13194135-T-G 11038459-T-G *
13194069-A-G 11038393-A-G *
11020476-T-G *
11297060-C- *
13453399-CTTTCCT-C 11297723-CTTTCCT-C *
13464288-G-GT 11308612-G-GT *
13463228-G-T 11307552-G-T *
13464275-ACC-A 11308599-ACC-A *
13464273-A-AAAG 11308597-A-AAAG *
13464270-G-GTGAAA 11308594-G-GTGAAA *
13464269-C-T 11308593-C-T FT443989 *
13464266-CCA-C 11308590-CCA-C *
13464199-C-CCA 11308523-C-CCA *
13464195-AAC-A 11308519-AAC-A *
11308502-CACAA- *
13464177-CCA-C 11308501-CCA-C *
13464175-C-CAT 11308499-C-CAT *
13464119-C-A 11308443-C-A *
13463363-T-TCACCACCCGGGCAAAAGCCGGGAGGACTGGGACCTGCAGTGCAACGGCCTGCTGGGCCCTTGTGCGGTGGGACAGCCTGGGCCC 11307687-T-TCACCACCCGGGCAAAAGCCGGGAGGACTGGGACCTGCAGTGCAACGGCCTGCTGGGCCCTTGTGCGGTGGGACAGCCTGGGCCC *
11307508-A- *
13455123-T-A 11299447-T-A *
11307506-GTA- *
13462521-G-C 11306845-G-C *
13462509-G-A 11306833-G-A *
13462438-G-T 11306762-G-T *
11306028-C- *
13461200-A-C 11305524-A-C *
13461157-T-C 11305481-T-C *
13461126-C-A 11305450-C-A *
13460614-C-T 11304938-C-T *
13460611-C-T 11304935-C-T *
13457168-AT-A 11301492-AT-A *
13455141-A-T 11299465-A-T *
13455124-C-A 11299448-C-A *
13476948-CTGGA-C 11321272-CTGGA-C *
11321274-G- *
13808609-T-TGGAAGA 11687903-T-TGGAAGA *
13489821-G-GCA 11334145-G-GCA *
13561734-T-G 11406058-T-G *
13545834-A-AG 11390158-A-AG *
13540309-A-G 11384633-A-G *
13540303-T-C 11384627-T-C *
13540300-A-C 11384624-A-C *
13540298-A-T 11384622-A-T *
13540266-A-G 11384590-A-G *
13540253-A-AAC,C 11384577-A-AAC,C 23×AC*
13533275-T-G 11377599-T-G *
13533236-C-T 11377560-C-T *
13532875-CAAAAAAAAAAA-C,CAAAAAA 11377199-CAAAAAAAAAAA-C,CAAAAAA 13×A*
13519021-C-T 11363345-C-T *
13489817-TGG-T 11334141-TGG-T *
13566959-A-G 11411283-A-G *
11334056-GCCGC- *
11333937-C- *
13489593-A-T 11333917-A-T *
11333287-AG- *
13488949-GGTTCC-G 11333273-GGTTCC-G *
13488947-G-GTGTC 11333271-G-GTGTC *
13488944-G-GC 11333268-G-GC *
13488243-G-C 11332567-G-C *
13488168-G-C 11332492-G-C *
13488104-C-A 11332428-C-A *
13488045-G-A 11332369-G-A *
13487969-C-A 11332293-C-A *
13487878-T-A 11332202-T-A *
13561757-C-T 11406081-C-T *
13599427-TG-T 11443751-TG-T *
11332048-A- *
13717055-G-A 11561379-G-A *
13808605-C-G 11687899-C-G *
13808601-A-G 11687895-A-G *
13808595-A-G 11687889-A-G *
13808585-T-A 11687879-T-A *
13808576-G-A 11687870-G-A *
13805112-G-T 11684406-G-T *
13805110-T-A 11684404-T-A *
11578457-AACGGAATTGAATGTCATGGAATGGAATGGC- *
13734085-T-A 11578409-T-A *
13723479-C-G 11567803-C-G *
13720969-A-C 11565293-A-C *
13720936-A-G 11565260-A-G *
13713679-C-T 11558003-C-T *
13599429-AAATGAGATG-A 11443753-AAATGAGATG-A *
13713642-G-C 11557966-G-C *
13707206-T-C 11551530-T-C *
11550410-ATGGCGTGGAATGGAAT- *
13704375-A-T 11548699-A-T *
13702013-G-A 11546337-G-A *
11544837-T- *
13694339-A-T 11538663-A-T FT448846 *
13692968-T-A 11537292-T-A *
13692719-C-T 11537043-C-T *
13689496-G-A 11533820-G-A *
13611827-AACCTTTTTTTT-A 11456151-AACCTTTTTTTT-A *
13599478-AATAATGAAACGAGATGAAATGAAATAATGAAAT-A 11443802-AATAATGAAACGAGATGAAATGAAATAATGAAAT-A *
13599476-GC-G 11443800-GC-G *
11332064-CCCT- *
13486468-A-G 11330792-A-G *
11321276-A- *
13478861-CCG-C 11323185-CCG-C *
13478965-TCG-T 11323289-TCG-T *
13478955-C-A 11323279-C-A *
13478953-C-A 11323277-C-A *
13478950-C-A 11323274-C-A *
13478933-G-C 11323257-G-C *
13478903-G-T 11323227-G-T *
13478901-G-C 11323225-G-C *
13478897-G-A 11323221-G-A *
13478888-C-A 11323212-C-A *
13478887-C-T 11323211-C-T BY86021 *
13478873-GA-G 11323197-GA-G *
13478871-C-CCCA 11323195-C-CCCA *
13478858-C-T 11323182-C-T *
11323291-G- *
11323175-CGAA- *
13478796-T-TGGC 11323120-T-TGGC *
13478520-G-T 11322844-G-T *
13478423-TGG-T 11322747-TGG-T *
11322516-G- *
11322515-G- *
13476993-C-T 11321317-C-T *
13476986-C-A 11321310-C-A *
13476978-C-T 11321302-C-T BY85963 *
13476976-C-A 11321300-C-A *
13476969-T-TCA 11321293-T-TCA *
13476965-C-CACCACT 11321289-C-CACCACT *
13476964-C-CAT 11321288-C-CAT *
11323290-C- *
13478989-A-G 11323313-A-G *
13486101-A-G 11330425-A-G *
13482796-T-G 11327120-T-G *
13486096-C-A 11330420-C-A *
13486064-C-T 11330388-C-T *
13486055-T-A 11330379-T-A *
13486020-T-G 11330344-T-G *
13485984-G-A 11330308-G-A *
13485970-CA-C 11330294-CA-C *
13485930-G-GGTGATCAGTGCAGAGATATCTCACAATACCCATTGTAGGCAGAGCCTAGACAAGAGTTACATCATCTGC 11330254-G-GGTGATCAGTGCAGAGATATCTCACAATACCCATTGTAGGCAGAGCCTAGACAAGAGTTACATCATCTGC *
13484404-G-C 11328728-G-C *
13483789-T-C 11328113-T-C *
13483773-G-T 11328097-G-T *
13482825-G-T 11327149-G-T *
13482820-C-T 11327144-C-T *
11326554-A- *
11323318-C- *
13481548-A-T 11325872-A-T *
13480497-GTC-G 11324821-GTC-G *
13480215-T-C 11324539-T-C *
13480200-T-C 11324524-T-C *
13480181-A-T 11324505-A-T *
13480171-T-G 11324495-T-G *
13479607-A-C 11323931-A-C *
13479606-C-A 11323930-C-A *
13479529-G-T 11323853-G-T *
13479468-T-A 11323792-T-A *
13479311-G-GGT 11323635-G-GGT *
13479028-T-C 11323352-T-C *
11323319-G- *
13471892-G-GATTCT 11316216-G-GATTCT *
13465666-A-G 11309990-A-G *
13470560-G-GTGCC 11314884-G-GTGCC *
13853650-A-G 11732944-A-G *
13735097-G-A 11579421-G-A *
58898266-T-C 56692605-A-G *
58898263-C-G 56692608-G-C *
58894620-C-A 56696251-G-T *
9975415-T-C 10137806-T-C Y*
58854949-A-T 56735922-T-A *
58916305-T-G 56674566-A-C *
58916312-C-T 56674559-G-A *
58902062-G-A 56688809-C-T *
9960463-T-C 10122854-T-C Y*
58981699-T-C 56835552-T-C *
28793027-A-C 26646880-A-C *
13853676-T-G 11732970-T-G *
13713055-A-T 11557379-A-T *
58869865-C-T 56721006-G-A *
13809079-G-T 11688373-G-T *
58857626-C-T 56733245-G-A *
13498156-G-A 11342480-G-A *
58856475-C-A 56734396-G-T *
9956895-CAGTGTTCTGGAATCCTATGCGAGGGACAAACATTCAGAACCTCGTAGCAGT-C 10119286-CAGTGTTCTGGAATCCTATGCGAGGGACAAACATTCAGAACCTCGTAGCAGT-C *
13466530-C-G 11310854-C-G *
13480695-C-A 11325019-C-A *
28549561-G-T 26403414-G-T *
10081980-C-T 10244371-C-T *
13488306-G-A 11332630-G-A *
58893427-G-C 56697444-C-G *
58869790-C-T 56721081-G-A *
5571890-C-CTT 5703849-C-CTT 16×T*
58869860-G-A 56721011-C-T *
13475426-C-T 11319750-C-T *
13340967-T-G 11185291-T-G *
10954051-G-T *
17143891-A-ATT 15032011-A-ATT 35×T*
58912457-C-A 56678414-G-T *
19146599-A-T 17034719-A-T YY*
13488978-A-C 11333302-A-C *
13696909-G-T 11541233-G-T *
10918065-C-A *
6402589-C-A 6534548-C-A *
19508177-C-T 17396297-C-T YY19×T*
10888043-A-T *
10820764-A-C *
10820760-A-G *
10820756-T-G *
10820750-T-A *
10797694-T-C *
58839252-A-G 56751619-T-C *
10797683-A-T *
13464486-C-G 11308810-C-G *
10954344-T-A *
10954335-C-A *
10823736-T-G *
13488623-C-A 11332947-C-A *
13486530-G-A 11330854-G-A *
13462065-C-A 11306389-C-A *
13483954-G-A 11328278-G-A *
22366298-C-G 20204412-C-G DYZ19 *
13737416-A-T 11581740-A-T *
9300240-AACACACACAC-A 9462631-AACACACACAC-A 20×AC*
58859229-T-A 56731642-A-T *
58883057-C-G 56707814-G-C *
22238374-T-A 20076488-T-A DYZ19 *
9416756-A-T 9579147-A-T YY*
4821259-T-C 4953218-T-C *
10082124-C-T 10244515-C-T *
58885261-G-C 56705610-C-G *
13473829-C-T 11318153-C-T *
58834226-T-A 56756645-A-T *
58868981-C-G 56721890-G-C *
9977603-A-T 10139994-A-T Y*
13464224-C-T 11308548-C-T BY47070 *
5388261-T-TAA 5520220-T-TAA 18×A*
13468097-A-G 11312421-A-G *
58869429-T-C 56721442-A-G *
58874799-C-G 56716072-G-C *
58874792-T-C 56716079-A-G *
4821316-G-A 4953275-G-A *
58824554-C-G 56766317-G-C *
58874954-C-G 56715917-G-C *
13468161-G-A 11312485-G-A *
13718214-T-C 11562538-T-C *
13714321-G-T 11558645-G-T *
13714312-C-G 11558636-C-G *
13713048-C-A 11557372-C-A *
13709813-G-T 11554137-G-T *
22509009-C-T 20347123-C-T DYZ19 *
58893863-T-C 56697008-A-G *
13464034-G-A 11308358-G-A *
13467395-T-C 11311719-T-C *
58882418-G-A 56708453-C-T *
13137086-T-C 10626572-T-C *
22510013-G-C 20348127-G-C DYZ19 *
10082104-C-G 10244495-C-G *
58981977-T-TCCAC 56835830-T-TCCAC *
58844636-C-A 56746235-G-T *
22511385-G-A 20349499-G-A BY177541 DYZ19 *
58823570-C-A 56767301-G-T *
13469829-C-T 11314153-C-T *
13194152-G-C 11038476-G-C *
58875598-T-C 56715273-A-G *
10022394-T-C 10184785-T-C Y*
18735674-C-CT 16623794-C-CT 24×T*
58882362-G-T 56708509-C-A *
58868344-G-C 56722527-C-G *
13380527-T-TC 11224851-T-TC *
10068347-A-C 10230738-A-C *
9925265-A-G 10087656-A-G Y*
28583394-T-C 26437247-T-C CTS12373 *
22508036-G-T 20346150-G-T DYZ19 *
13486591-T-C 11330915-T-C *
3330251-GT-G 3462210-GT-G 12×T*
13466545-C-T 11310869-C-T *
13480939-C-G 11325263-C-G *
28795809-T-G 26649662-T-G *
10042541-G-T 10204932-G-T *
13348940-T-C 11193264-T-C *
13340917-C-T 11185241-C-T *
58882452-C-A 56708419-G-T *
58834125-T-C 56756746-A-G *
58884687-T-C 56706184-A-G *
13393449-ATTT-A 11237773-ATTT-A 12×T*
58852185-G-T 56738686-C-A *
13611806-T-C 11456130-T-C *
58868837-G-C 56722034-C-G *
9416755-G-T 9579146-G-T YY*
9416758-A-T 9579149-A-T YY*
4820730-T-C 4952689-T-C *
10081999-C-G 10244390-C-G *
13480230-G-A 11324554-G-A *
10792295-C-T *
18343602-C-CTT 16231722-C-CTT P6_Prx 25×T*
13488167-A-T 11332491-A-T *
13488156-A-T 11332480-A-T *
13488131-C-A 11332455-C-A *
13488130-C-A 11332454-C-A *
13463767-G-A 11308091-G-A *
10846492-T-A *
9909163-TG-T 10071554-TG-T *
9909098-C-G 10071489-C-G Y*
7280981-C-A 7412940-C-A YY*
9992756-C-T 10155147-C-T Y*
10081962-C-A 10244353-C-A *
13488882-G-T 11333206-G-T *
10081943-T-C 10244334-T-C *
10081934-T-G 10244325-T-G *
10061348-A-C 10223739-A-C *
10826261-C-T *
13468186-G-A 11312510-G-A *
5702620-CAA-C 5834579-CAA-C 25×A*
13484634-C-A 11328958-C-A *
13466500-C-G 11310824-C-G *
10663961-A-C *
10663957-T-C *
14774253-C-CT 12662322-C-CT 28×T*
10842343-A-C *
10959785-C-A *
13464415-C-G 11308739-C-G FT41991 *
13466473-T-C 11310797-T-C *
13717810-G-T 11562134-G-T *
13488191-G-T 11332515-G-T *
13392768-CAA-C 11237092-CAA-C 11×A*
18443482-A-T 16331602-A-T P6_Dst *
13480905-C-A 11325229-C-A *
58834378-C-A 56756493-G-T *
13488677-C-A 11333001-C-A *
13464432-C-A 11308756-C-A *
10926744-T-G *
2685668-G-T 2817627-G-T YY*
28813839-A-C 26667692-A-C *
22509217-G-T 20347331-G-T DYZ19 *
22447664-T-A 20285778-T-A DYZ19 *
13691929-A-G 11536253-A-G BY88709 *
13466013-A-G 11310337-A-G *
13468182-G-T 11312506-G-T *
13478370-G-T 11322694-G-T *
28815860-G-A 26669713-G-A *
13503538-T-C 11347862-T-C *
9997147-A-T 10159538-A-T Y*
13480510-G-A 11324834-G-A *
58857613-A-G 56733258-T-C *
13705835-A-C 11550159-A-C *
13483936-C-G 11328260-C-G *
13474526-G-T 11318850-G-T *
13468430-C-T 11312754-C-T *
13460577-C-G 11304901-C-G *
13460576-A-T 11304900-A-T *
10082067-G-A 10244458-G-A *
13478380-C-A 11322704-C-A *
13472234-G-C 11316558-G-C *
13717809-C-A 11562133-C-A *
10971946-C-A *
13461887-G-C 11306211-G-C *
2741123-G-T 2873082-G-T YY*
13468138-A-G 11312462-A-G *
28802604-G-C 26656457-G-C *
10954340-C-A *
19520875-G-T 17408995-G-T YY*
13488721-T-A 11333045-T-A *
7280979-G-T 7412938-G-T YY*
13489595-C-A 11333919-C-A *
10772496-C-A *
13462044-C-A 11306368-C-A *
10953766-A-C *
9965999-A-G 10128390-A-G Y*
10888034-T-A *
6402623-C-A 6534582-C-A *
13480849-G-T 11325173-G-T *
10672248-C-A *
10672246-T-C *
19146601-GC-G 17034721-GC-G *
10921998-T-C *
13480867-C-A 11325191-C-A *
10996643-C-T *
10996641-A-T *
10974753-C-T *
13468195-A-C 11312519-A-C *
6944971-AG-A 7076930-AG-A *
13483705-C-A 11328029-C-A *
10773223-A-T *
13476776-C-T 11321100-C-T *
10860928-T-C *
10937722-C-T *
13717802-A-C 11562126-A-C *
10792248-A-G *
16729196-C-T 14617316-C-T YY*
13462127-C-A 11306451-C-A *
13462525-T-A 11306849-T-A *
10937709-G-C *
10954329-T-C *
10974759-T-C *
10974746-T-C *
10977156-C-T *
13488776-C-G 11333100-C-G *
10792757-C-G *
56734464-T-G *
17951299-ATT-A,AT 15839419-ATT-A,AT 25×T*
11030294-T-C *
13488192-A-C 11332516-A-C *
10768705-A-T *
13489082-A-G 11333406-A-G *
13488985-G-A 11333309-G-A *
13473901-A-G 11318225-A-G *
10989917-ACTCTC-A *
13466313-A-C 11310637-A-C *
10851105-A-T *
10803769-A-T *
28721499-CAA-C 26575352-CAA-C 18×A*
5224926-C-CAA 5356885-C-CAA 19×A*
27651806-G-T 25505659-G-T P1_Y2 *
13463888-G-A 11308212-G-A *
13473657-A-G 11317981-A-G *
10996655-A-T *
4909354-G-A 5041313-G-A *
13379472-G-A 11223796-G-A *
58856329-C-T 56734542-G-A *
13246436-G-A 11090760-G-A *
13383123-G-A 11227447-G-A *
13383047-C-T 11227371-C-T *
13382987-C-T 11227311-C-T *
13382963-G-A 11227287-G-A *
13380078-T-C 11224402-T-C *
13374833-G-C 11219157-G-C *
13373903-A-C 11218227-A-C *
13346776-C-CAA 11191100-C-CAA 13×A*
13326305-A-T 11170629-A-T *
13326279-T-C 11170603-T-C *
13292774-TG-T 11137098-TG-T *
13273818-A-G 11118142-A-G *
13261840-A-C 11106164-A-C *
13242241-C-T 11086565-C-T 21×T*
13383604-C-A 11227928-C-A *
13239356-T-A 11083680-T-A *
10061475-C-A 10223866-C-A *
10057518-T-G 10219909-T-G *
10057486-C-T 10219877-C-T *
10057434-A-G 10219825-A-G *
10042540-T-C 10204931-T-C *
10042527-C-G 10204918-C-G *
6402621-A-G 6534580-A-G *
5041051-G-C 5173010-G-C *
4803455-G-A 4935414-G-A FT247869 *
4370920-G-A 4502879-G-A *
13507927-G-A 11352251-G-A *
9983930-T-A 10146321-T-A Y*
13383230-A-G 11227554-A-G *
13383967-G-A 11228291-G-A *
17141731-T-A 15029851-T-A YY*
13611794-C-T 11456118-C-T *
5338175-T-G 5470134-T-G *
59027475-A-AG 56881328-A-AG *
58859196-G-A 56731675-C-T *
13486624-C-A 11330948-C-A *
13478848-T-A 11323172-T-A *
19604842-C-A 17492962-C-A P5_Prx Y*
58865539-T-A 56725332-A-T *
9983966-G-A 10146357-G-A Y*
22444114-G-T 20282228-G-T BY48575 DYZ19 *
22289308-A-G 20127422-A-G DYZ19 *
22255563-A-C 20093677-A-C DYZ19 *
18821201-AAC-A 16709321-AAC-A *
13639725-C-A 11484049-C-A *
13611684-C-A 11456008-C-A *
13399966-T-C 11244290-T-C *
13611675-T-G 11455999-T-G *
13576786-G-A 11421110-G-A FT183139 *
13520440-G-A 11364764-G-A *
13520396-A-T 11364720-A-T *
13520387-G-T 11364711-G-T FGC80360 *
13520293-G-A 11364617-G-A *
13503524-T-TAC 11347848-T-TAC *
13443133-T-G 11287457-T-G *
13440286-C-T 11284610-C-T *
13440270-C-A 11284594-C-A *
13425358-G-A 11269682-G-A *
13425337-C-T 11269661-C-T *
13423104-G-T 11267428-G-T *
22362032-T-A 20200146-T-A DYZ19 *
22278704-A-G 20116818-A-G DYZ19 *
6403139-A-G 6535098-A-G *
58865554-T-G 56725317-A-C *
13704618-C-G 11548942-C-G *
17998540-A-T 15886660-A-T P7_Gap Y*
13383436-A-C 11227760-A-C *
13713598-G-A 11557922-G-A BY156303 *
13434702-T-A 11279026-T-A *
58845026-C-T 56745845-G-A *
18679925-C-CAA 16568045-C-CAA 25×A*
58890263-A-T 56700608-T-A *
13465453-A-G 11309777-A-G *
58916245-A-G 56674626-T-C *
58877134-T-C 56713737-A-G *
13467393-C-G 11311717-C-G *
58877061-C-A 56713810-G-T *
13475717-C-T 11320041-C-T *
13516195-C-T 11360519-C-T *
13475702-C-T 11320026-C-T *
9966443-T-A 10128834-T-A Y*
28790987-C-T 26644840-C-T *
13488037-C-A 11332361-C-A *
13488036-C-A 11332360-C-A *
22239596-C-T 20077710-C-T DYZ19 *
22511356-T-G 20349470-T-G DYZ19 *
13456566-T-C 11300890-T-C *
13486132-T-C 11330456-T-C *
3653209-C-G 3785168-C-G ZS249 *
13808606-A-G 11687900-A-G *
13196296-T-C 11040620-T-C *
22220570-T-A 20058684-T-A A225BY41465 DYZ19 *
13396281-G-A 11240605-G-A *
22490575-G-T 20328689-G-T DYZ19 *
10022421-T-G 10184812-T-G Y*
58868772-A-C 56722099-T-G *
58876451-A-T 56714420-T-A *
58839001-A-T 56751870-T-A *
22433365-C-A 20271479-C-A DYZ19 *
13488259-T-C 11332583-T-C *
13434927-A-C 11279251-A-C *
13110553-C-T 10600039-C-T *
13466466-C-A 11310790-C-A *
9952050-T-G 10114441-T-G Y*
13467385-T-A 11311709-T-A *
13476861-GCT-G 11321185-GCT-G *
13470902-C-A 11315226-C-A *
13464117-A-T 11308441-A-T *
13517949-T-G 11362273-T-G *
13697248-T-C,G 11541572-T-C,G *
13483973-T-C 11328297-T-C *
28790892-T-A 26644745-T-A *
58834583-A-T 56756288-T-A *
24924132-C-CT 22777985-C-CT g1 11×T*
13467450-G-T 11311774-G-T *
10082062-G-T 10244453-G-T *
9944250-T-C 10106641-T-C Y*
4909318-G-C 5041277-G-C *
4370865-C-T 4502824-C-T *
13427873-T-G 11272197-T-G *
13699369-T-A 11543693-T-A *
13465606-G-C 11309930-G-C BY85726 *
58914148-T-C 56676723-A-G *
28790904-C-A 26644757-C-A *
6402201-A-G 6534160-A-G *
6617071-G-A 6749030-G-A Y*
7154797-C-CA 7286756-C-CA 18×A*
58903424-C-G 56687447-G-C *
13465961-G-A 11310285-G-A *
9962780-G-T 10125171-G-T Y*
9962665-T-C 10125056-T-C Y*
9946318-G-T 10108709-G-T Y*
9946313-C-T 10108704-C-T Y*
13194124-A-C 11038448-A-C *
9957957-C-A 10120348-C-A Y*
58906099-A-C 56684772-T-G *
13379541-C-T 11223865-C-T *
58876490-G-C 56714381-C-G *
13110569-G-C 10600055-G-C *
58824569-CATTCCAATAG-C 56766285-ATGGAATCTAT-A *
58824517-T-C 56766354-A-G *
58865589-G-A 56725282-C-T *
58856356-T-G 56734515-A-C *
13194132-G-C 11038456-G-C *
28802606-C-G 26656459-C-G *
13475503-C-CT 11319827-C-CT *
9909109-C-A 10071500-C-A Y*
58898226-C-T 56692645-G-A *
13449160-T-TTCCATTCCAC 11293484-T-TTCCATTCCAC *
22477504-G-C 20315618-G-C DYZ19 *
22477500-G-A 20315614-G-A DYZ19 *
13712288-G-C 11556612-G-C *
28791004-G-A 26644857-G-A *
22352549-A-C 20190663-A-C DYZ19 *
22486296-C-A 20324410-C-A DYZ19 *
22477957-A-C 20316071-A-C BY25215 DYZ19 *
58886938-T-G 56703933-A-C *
58829930-T-G 56760941-A-C *
58912456-T-A 56678415-A-T *
9975424-G-A 10137815-G-A Y*
58865707-C-G 56725164-G-C *
13487737-C-A 11332061-C-A *
58903883-T-A 56686988-A-T *
22427331-T-A 20265445-T-A DYZ19 *
58865545-T-G 56725326-A-C *
58853372-C-G 56737499-G-C *
58839107-C-A 56751764-G-T *
58839102-A-G 56751769-T-C *
58839073-G-C 56751798-C-G *
10043360-A-T 10205751-A-T *
10043362-C-T 10205753-C-T *
22510717-T-G 20348831-T-G DYZ19 *
58869676-C-A 56721195-G-T *
58862295-A-G 56728576-T-C *
13488137-C-A 11332461-C-A *
58824899-C-G 56765972-G-C *
58824892-T-C 56765979-A-G *
58912874-A-G 56677997-T-C *
26810590-A-T 24664443-A-T P1_g2 *
58859213-A-T 56731658-T-A *
22503088-A-C 20341202-A-C DYZ19 *
13489664-G-T 11333988-G-T *
58874810-G-A 56716061-C-T *
58882431-T-A 56708440-A-T *
58882402-C-T 56708469-G-A *
17120597-AT-A 15008717-AT-A FT354145 9×T*
13853663-GAATTT-G 11732957-GAATTT-G *
13476959-C-A 11321283-C-A *
22477956-A-C 20316070-A-C BY25214 DYZ19 *
13461122-A-T 11305446-A-T *
9941014-C-G 10103405-C-G Y*
13271621-C-G 11115945-C-G *
13424609-A-C 11268933-A-C *
13403822-C-A 11248146-C-A *
13399953-T-G 11244277-T-G *
13383943-T-C 11228267-T-C *
13383525-C-G 11227849-C-G FGC39086 *
13383095-T-G 11227419-T-G *
13382874-G-A 11227198-G-A *
13374043-A-G 11218367-A-G *
13369622-C-G 11213946-C-G *
13367734-A-G 11212058-A-G *
13362318-C-T 11206642-C-T *
13362307-C-A 11206631-C-A *
13286821-ATTG-A 11131145-ATTG-A *
13263563-C-G 11107887-C-G *
13440166-G-T 11284490-G-T *
13254978-C-T 11099302-C-T *
13110531-G-A 10600017-G-A *
10061232-A-G 10223623-A-G *
10057468-C-T 10219859-C-T *
10042528-A-C 10204919-A-C *
10042501-C-T 10204892-C-T Z23218 K574 *
10014880-C-A 10177271-C-A Y*
9992788-C-CA 10155179-C-CA *
9983976-C-A 10146367-C-A Y*
9965951-T-C 10128342-T-C Y*
9957175-A-G 10119566-A-G Y*
9957145-C-T 10119536-C-T FT373532 Y*
9941192-A-G 10103583-A-G Y*
13425574-A-G 11269898-A-G *
13448825-A-G 11293149-A-G *
58819457-C-A 56771414-G-T *
58866756-C-T 56724115-G-A *
58823281-C-G 56767590-G-C *
10081968-C-G 10244359-C-G FT44712 *
28793913-G-C 26647766-G-C *
13481082-T-G 11325406-T-G *
6402056-G-T 6534015-G-T *
58834117-A-G 56756754-T-C *
58840925-C-A 56749946-G-T *
13485472-G-A 11329796-G-A *
9944762-C-T 10107153-C-T Y*
13474772-C-A 11319096-C-A *
13496647-G-A 11340971-G-A *
59012859-C-G 56866712-C-G *
58999813-A-G 56853666-A-G *
28809021-T-C 26662874-T-C *
13466560-A-G 11310884-A-G BY51506 *
28583527-T-C 26437380-T-C CTS12379 *
22510265-C-G 20348379-C-G Z11173 DYZ19 *
22507990-T-A 20346104-T-A DYZ19 *
22239605-A-G 20077719-A-G DYZ19 *
18006651-G-A 15894771-G-A FT23971 P7_Gap Y*
13705814-G-A 11550138-G-A *
13692970-T-G 11537294-T-G *
13692275-T-G 11536599-T-G *
13688538-A-C 11532862-A-C *
13611863-G-T 11456187-G-T *
13533357-C-G 11377681-C-G *
13517933-A-G 11362257-A-G *
13517931-T-C 11362255-T-C *
13476990-G-A 11321314-G-A BY47626 *
28813717-T-A 26667570-T-A *
58891275-C-A 56699596-G-T *
13466837-T-A 11311161-T-A *
13473482-A-C 11317806-A-C *
22511309-T-A 20349423-T-A DYZ19 *
22511292-G-A 20349406-G-A DYZ19 *
15468678-CA-C,CAA 13356798-CA-C,CAA 23×A*
13704823-G-C 11549147-G-C *
13488714-CCA-C 11333038-CCA-C *
13480878-T-G 11325202-T-G *
10986925-TCTATTTCATTCCATC-T *
10693747-TCCTTTCC-T *
19025588-T-A 16913708-T-A Y*
13485491-G-A 11329815-G-A *
13479634-C-A 11323958-C-A *
13473493-G-A 11317817-G-A *
13473486-C-G 11317810-C-G *
13427975-C-A 11272299-C-A *
4909304-C-G 5041263-C-G *
13379420-G-A 11223744-G-A *
10750453-C-A *
10043363-A-G 10205754-A-G *
7100770-G-C 7232729-G-C Y*
4797787-A-C 4929746-A-C *
9992694-G-A 10155085-G-A Y*
9992655-A-G 10155046-A-G Y*
9992649-A-G 10155040-A-G Y*
9992626-G-A 10155017-G-A Y*
9780404-C-T 9942795-C-T Y*
9780401-T-C 9942792-T-C Y*
56676422-T-C *
13853713-G-C 11733007-G-C *
4909300-TC-T 5041259-TC-T *
9056619-T-TTTGTGTTC *
13562324-T-C 11406648-T-C *
9916142-A-G 10078533-A-G Y*
10093351-C-T 10255742-C-T *
10093346-T-G 10255737-T-G *
10093338-C-T 10255729-C-T *
10093336-T-A 10255727-T-A *
10093332-G-C 10255723-G-C *
10093329-G-T 10255720-G-T *
10093314-T-C 10255705-T-C *
10093312-C-G 10255703-C-G *
10093305-C-T 10255696-C-T *
10068230-G-A 10230621-G-A *
10056993-C-G 10219384-C-G *
9916149-T-G 10078540-T-G Y*
9916145-A-T 10078536-A-T Y*
9916134-A-T 10078525-A-T Y*
9056621-A-ACTATTTCTCCATTTTGTATTTCTATTGTCTTTTTTTTTTTCTTGAGTT *
9916130-C-T 10078521-C-T Y*
9916112-ACT-A 10078503-ACT-A *
9916107-T-C 10078498-T-C Y*
9916106-T-G 10078497-T-G Y*
9916101-G-A 10078492-G-A Y*
9916098-T-A 10078489-T-A Y*
9916090-C-G 10078481-C-G Y*
9916081-T-A 10078472-T-A Y*
9916080-T-C 10078471-T-C Y*
9056674-G-GTA *
9056671-ACC-A *
9056626-A-AGTCTTCATATGTTGTGGATAACAGACTTCTTACATCTACAAC *
9056624-A-AC *
13853692-G-A 11732986-G-A *
13559069-C-A 11403393-C-A *
10625079-G-C *
9365860-T-C 9528251-T-C Y*
10869642-T-C *
13809088-C-T 11688382-C-T *
13531368-A-AAAAT 11375692-A-AAAAT *
13491002-G-A 11335326-G-A *
13488089-C-T 11332413-C-T *
13425584-G-T 11269908-G-T *
13428151-G-T 11272475-G-T *
13428129-T-G 11272453-T-G *
11025616-A-G *
10082046-G-T 10244437-G-T *
15476975-G-A 13365095-G-A FT60117 YY*
13470908-C-A 11315232-C-A *
13470687-A-T 11315011-A-T *
22486310-G-T 20324424-G-T DYZ19 *
13252936-C-T 11097260-C-T *
10792276-C-A *
13396229-G-A 11240553-G-A *
13370167-G-A 11214491-G-A *
13292797-CT-C 11137121-CT-C *
3541288-A-C 3673247-A-C *
56734551-G-T *
10913817-G-A *
56736608-C-G *
13515126-G-A 11359450-G-A *
13404294-G-A 11248618-G-A *
13243633-C-T 11087957-C-T *
9962761-G-A 10125152-G-A Y*
9962749-A-G 10125140-A-G Y*
9965315-G-T 10127706-G-T Y*
13480900-C-T 11325224-C-T *
13559064-A-C 11403388-A-C *
13469842-A-G 11314166-A-G *
13559055-G-A 11403379-G-A *
13531518-CA-C 11375842-CA-C *
13436144-T-A 11280468-T-A *
10625275-A-C *
10062142-C-G 10224533-C-G *
10062140-C-A 10224531-C-A *
10062135-C-G 10224526-C-G *
10062133-T-A 10224524-T-A *
10062130-C-G 10224521-C-G *
10062129-A-T 10224520-A-T *
28814099-T-C 26667952-T-C BY31662 *
13608647-CAA-C,CAAA 11452971-CAA-C,CAAA 27×A*
28457748-CAA-C 26311601-CAA-C 21×A*
3403261-CAAAAA-C,CAAAA 3535220-CAAAAA-C,CAAAA 30×A*
13461899-A-T 11306223-A-T *
13433639-T-C 11277963-T-C *
10082082-T-A 10244473-T-A *
13453396-T-C 11297720-T-C *
13470048-G-T 11314372-G-T *
28790912-T-G 26644765-T-G *
5303350-ATTTTT-A 5435309-ATTTTT-A 22×T*
13465401-T-A 11309725-T-A *
5225260-G-GTA 5357219-G-GTA *
26344423-C-A 24198276-C-A P1_Y1 28×T*
10692391-A-C *
13476714-C-A 11321038-C-A *
13476709-G-T 11321033-G-T *
13476634-G-A 11320958-G-A *
10093353-T-C 10255744-T-C *
10626484-G-A *
13435916-A-ATT 11280240-A-ATT *
13811253-G-C 11690547-G-C *
28809042-CG-C 26662895-CG-C *
28809033-A-T 26662886-A-T *
23793873-G-C 21631987-G-C Y*
23793842-G-A 21631956-G-A Y*
23793841-T-C 21631955-T-C Y*
23793835-T-G 21631949-T-G Y*
23793833-G-A 21631947-G-A Y*
23793827-A-G 21631941-A-G Y*
23793825-T-G 21631939-T-G Y*
23793823-T-C 21631937-T-C Y*
23793817-C-G 21631931-C-G Y*
22489898-C-A 20328012-C-A DYZ19 *
22446131-GTGTTATGTCCAGAGTTTTTTACATCAGATGTGTCCAGACTTTCTTCCTTCTGGCAGTTTCGTGGTCTTCCTCACTTCAAGAATGAAGCTGCAGACCTTAGTGGTGAGTGTTACAGCTCTTTAAGT-G 20284245-GTGTTATGTCCAGAGTTTTTTACATCAGATGTGTCCAGACTTTCTTCCTTCTGGCAGTTTCGTGGTCTTCCTCACTTCAAGAATGAAGCTGCAGACCTTAGTGGTGAGTGTTACAGCTCTTTAAGT-G DYZ19 *
13693717-TGGAAC-T 11538041-TGGAAC-T *
56678436-A-T *
13692444-G-A 11536768-G-A *
13688924-C-T,T 11533248-C-T,T *
13490020-C-A 11334344-C-A *
13489938-T-G 11334262-T-G *
13489640-C-A 11333964-C-A *
13489578-C-A 11333902-C-A *
13489573-C-T 11333897-C-T *
13489295-G-GTT 11333619-G-GTT *
13489266-G-A 11333590-G-A *
13489265-A-C 11333589-A-C *
13488491-G-C 11332815-G-C *
13488456-G-T 11332780-G-T *
13488414-C-T 11332738-C-T *
28814105-T-A 26667958-T-A *
56700611-G-T *
13484958-G-A 11329282-G-A *
13451490-G-A,A 11295814-G-A,A *
13466808-G-A 11311132-G-A *
22489867-T-A 20327981-T-A DYZ19 *
13463359-C-CCTCGGTG 11307683-C-CCTCGGTG *
13463358-G-GTT 11307682-G-GTT *
13462447-A-C 11306771-A-C *
13462427-T-A 11306751-T-A *
13462420-C-A 11306744-C-A *
13462414-G-A 11306738-G-A *
13462060-G-A 11306384-G-A *
13461983-G-T 11306307-G-T *
13461955-A-T 11306279-A-T *
13461924-G-T 11306248-G-T *
13460615-A-T 11304939-A-T *
13428120-A-G 11272444-A-G *
56734340-G-A *
13428116-A-C 11272440-A-C *
13269594-C-CA 11113918-C-CA *
13194078-C-T 11038402-C-T *
11025623-A-T *
11025621-T-A *
10626551-T-C *
9994853-TATAA-AATAA,T 10157244-TATAA-AATAA,T *
9958285-G-GA 10120676-G-GA *
56878253-G-GCACACACACACACA 9×CA*
56874786-C-CTTTTTTTTTTTTT 11×T*
56830821-AC-A *
56771229-G-T *
56755010-G-C *
13488402-C-T 11332726-C-T *
13484954-C-T 11329278-C-T *
10794263-CCACTCTACTCCACTCCA-C *
13462114-T-TGA 11306438-T-TGA *
13470514-A-G 11314838-A-G *
13470039-T-G 11314363-T-G *
13469937-C-CAA 11314261-C-CAA *
13469932-GAC-G 11314256-GAC-G *
13469905-G-C 11314229-G-C *
13469899-A-T 11314223-A-T *
13469892-A-C 11314216-A-C *
13469875-C-G 11314199-C-G *
13469863-A-T 11314187-A-T *
13469821-G-T 11314145-G-T *
13468334-A-C 11312658-A-C *
13466488-C-T 11310812-C-T *
13462115-CCA-C 11306439-CCA-C *
13462103-A-G 11306427-A-G *
13472017-TAA-T 11316341-TAA-T *
13462037-T-G 11306361-T-G *
13447601-A-C 11291925-A-C *
13447586-T-C 11291910-T-C *
13443296-C-A 11287620-C-A *
10996662-C-G *
10996653-TA-T *
10996651-T-TA *
10996647-C-G *
10996621-TCGACTCAA-T *
10996617-CCA-C *
10996615-T-G *
10921985-CTCCAA-C *
10794283-T-TTC *
13470547-C-G 11314871-C-G *
13472025-TCCATACAGCAGAGAAC-T 11316349-TCCATACAGCAGAGAAC-T *
13484673-G-A 11328997-G-A *
13478619-T-C 11322943-T-C *
13484668-T-G 11328992-T-G *
13482608-A-C 11326932-A-C *
13480994-A-T 11325318-A-T *
13480990-C-A 11325314-C-A *
13479593-T-A 11323917-T-A *
13479582-G-A 11323906-G-A *
13479562-T-C 11323886-T-C *
13479553-G-T 11323877-G-T *
13479544-C-T 11323868-C-T *
13479524-T-C 11323848-T-C *
13479518-G-A 11323842-G-A *
13479515-A-T 11323839-A-T *
13478949-A-T 11323273-A-T *
13478616-G-C 11322940-G-C *
13472332-T-TCA 11316656-T-TCA *
13478610-C-G 11322934-C-G *
13478506-G-A 11322830-G-A *
13478487-G-C 11322811-G-C *
13478476-T-C 11322800-T-C *
13478429-C-A 11322753-C-A *
13478417-G-A 11322741-G-A *
13476573-G-A 11320897-G-A *
13476563-G-T 11320887-G-T *
13476560-G-T 11320884-G-T *
13472347-C-CCTCTGT 11316671-C-CCTCTGT *
13472344-C-CATGTG 11316668-C-CATGTG *
13472338-G-GAAACCCCTCCGGTGGCT 11316662-G-GAAACCCCTCCGGTGGCT *
13472336-G-GAGCCTCCGCAGCATCCAGTCC 11316660-G-GAGCCTCCGCAGCATCCAGTCC *
9943700-T-A 10106091-T-A FT263042 Y*
13339725-A-G 11184049-A-G *
10888003-A-T *
10082078-C-A 10244469-C-A *
10692449-C-T *
10949643-C-T *
10745741-T-A *
13701929-G-A 11546253-G-A FT55990 *
13489067-C-A 11333391-C-A *
28793253-C-G 26647106-C-G *
13488783-G-A 11333107-G-A *
13470348-C-A 11314672-C-A *
10887998-A-G *
13808575-G-T 11687869-G-T *
13470837-G-A 11315161-G-A *
13463190-G-T 11307514-G-T *
13489729-C-CAG 11334053-C-CAG *
13466555-A-T 11310879-A-T *
13700689-G-C 11545013-G-C *
13466544-C-A 11310868-C-A *
28790899-G-C 26644752-G-C *
13478412-C-A 11322736-C-A *
13457973-C-CTCCGTTCCGT 11302297-C-CTCCGTTCCGT 7×TCCGT*
13462036-G-C 11306360-G-C *
13476585-G-A 11320909-G-A *
13466507-G-A 11310831-G-A *
13463912-G-T 11308236-G-T *
13463906-T-A 11308230-T-A *
13484675-C-T 11328999-C-T *
10780021-C-A *
56836310-T-TTCCAG *
56835574-G-A *
9975197-T-G 10137588-T-G Y*
10826485-A-C *
56756699-T-A *
13489630-C-CAA 11333954-C-CAA *
13476519-G-C 11320843-G-C *
13476536-G-T 11320860-G-T *
28813812-AGGAAT-A 26667665-AGGAAT-A 5×GGAAT*
13488455-C-T 11332779-C-T *
13470590-C-G 11314914-C-G *
13476502-G-A 11320826-G-A *
13488099-C-T 11332423-C-T *
3076069-CT-C,CTT 3208028-CT-C,CTT 25×T*
10768702-C-G *
13470500-A-G 11314824-A-G *
13470499-C-T 11314823-C-T *
13488890-G-T 11333214-G-T *
13689215-G-GGAATGGAATGGATTGGAATA 11533539-G-GGAATGGAATGGATTGGAATA *
13489627-CA-C 11333951-CA-C *
13480848-A-T 11325172-A-T *
13487723-CAG-C 11332047-CAG-C *
13487722-C-CTG 11332046-C-CTG *
13478283-CCG-C 11322607-CCG-C *
13478280-C-CAT 11322604-C-CAT *
13476859-C-CCG 11321183-C-CCG *
13476800-C-CTT 11321124-C-CTT *
13476795-ACC-A 11321119-ACC-A *
13476680-T-TGA 11321004-T-TGA *
13472289-G-GAA 11316613-G-GAA *
10093297-A-AAG 10255688-A-AAG *
9975357-C-CT 10137748-C-CT *
13476842-A-G 11321166-A-G *
10057458-G-A 10219849-G-A *
56771244-A-C *
13433634-C-A 11277958-C-A *
13487921-T-G 11332245-T-G *
10818728-C-A *
13483717-A-G 11328041-A-G A14504 *
13483704-G-C 11328028-G-C *
13462397-C-A 11306721-C-A *
58823492-A-T 56767379-T-A *
58823473-G-T 56767398-C-A *
58823467-A-T 56767404-T-A *
58905297-A-T 56685574-T-A *
6402918-T-A 6534877-T-A FT285919 *
6402095-T-A 6534054-T-A *
22509183-G-T 20347297-G-T DYZ19 *
8470549-C-CAA 8602508-C-CAA 22×A*
13482838-A-G 11327162-A-G *
13483811-A-C 11328135-A-C *
9962677-C-A 10125068-C-A Y*
10753999-G-T *
13721471-C-T 11565795-C-T *
17187596-C-A 15075716-C-A YY*
10954322-A-T *
15860282-T-G 13748402-T-G YY*
13484902-A-G 11329226-A-G *
13473805-A-T 11318129-A-T *
13473802-G-C 11318126-G-C *
22517410-CAA-C 20355524-CAA-C 13×A*
13478636-C-A 11322960-C-A *
10920912-G-A *
10803785-G-T *
5484667-AT-A 5616626-AT-A 10×T*
10972009-A-C *
56742783-A-C *
11022054-T-C *
10842345-C-A *
13705089-C-G 11549413-C-G *
10937720-C-T FT225466 *
56685531-C-T *
28816441-T-C 26670294-T-C *
13480904-G-A 11325228-G-A *
13473762-C-T 11318086-C-T *
28791103-TC-T 26644956-TC-T *
13466551-C-A 11310875-C-A *
10826262-A-G *
10061366-A-G 10223757-A-G *
10061357-C-A 10223748-C-A *
58905453-G-T 56685418-C-A *
13438263-T-C 11282587-T-C *
13709114-C-A 11553438-C-A *
10988842-C-T *
11022067-AT-A *
16345600-GAA-G 14233720-GAA-G 11×A*
10792304-A-C *
13463285-A-C 11307609-A-C *
10792282-T-A *
13998071-CTTTT-C 11877365-CTTTT-C 19×T*
15208845-C-CAA 13096931-C-CAA 23×A*
9992712-G-C 10155103-G-C Y*
13478988-C-T 11323312-C-T *
13809067-T-A 11688361-T-A *
9962700-A-C 10125091-A-C Y*
10949625-CTGCAA-C *
2708459-T-G 2840418-T-G Y*
13688502-G-C 11532826-G-C BY48166 *
10045598-G-A 10207989-G-A BY209689 *
28790919-A-C 26644772-A-C *
9983938-C-A 10146329-C-A Y*
24508205-CT-C,CTT 22362058-CT-C,CTT 22×T*
13340644-T-C 11184968-T-C *
13484183-A-C 11328507-A-C *
22511337-A-T 20349451-A-T DYZ19 *
10022407-T-C 10184798-T-C Y*
10022398-T-C 10184789-T-C Y*
25402881-G-T 23256734-G-T P2_r2 *
13478527-G-T 11322851-G-T *
13478526-G-T 11322850-G-T *
7451294-C-CT 7583253-C-CT IR1_L 29×T*
7364401-C-A 7496360-C-A YY*
22852199-C-CTT 20690313-C-CTT 16×T*
28680947-T-A 26534800-T-A *
10947635-T-A *
13470082-C-T 11314406-C-T *
6403320-A-C 6535279-A-C *
3867534-GTT-G 3999493-GTT-G 12×T*
13488399-G-T 11332723-G-T *
13369641-A-T 11213965-A-T *
13369638-G-A 11213962-G-A *
13369633-T-G 11213957-T-G *
56757376-C-A *
13697448-A-C 11541772-A-C *
13688935-C-G 11533259-C-G *
13194137-C-A 11038461-C-A *
13490991-A-C 11335315-A-C *
13693244-C-A 11537568-C-A *
13482806-A-C 11327130-A-C *
56722035-A-C *
13470061-C-A 11314385-C-A *
13433640-T-C 11277964-T-C *
28807259-A-T 26661112-A-T *
28803334-A-G 26657187-A-G *
5491261-CA-C 5623220-CA-C 18×A*
28819175-T-C,G 26673028-T-C,G *
13462518-A-C 11306842-A-C *
13340638-G-A 11184962-G-A *
4836963-AT-A 4968922-AT-A 11×T*
56693959-A-C *
13465116-C-A 11309440-C-A *
13476707-G-A 11321031-G-A *
13473522-T-A 11317846-T-A *
9075210-A-T 9237601-A-T Y*
13476582-C-T 11320906-C-T *
13469854-G-T 11314178-G-T *
28587131-T-C 26440984-T-C *
13466526-G-T 11310850-G-T *
13468435-A-T 11312759-A-T *
13470834-T-A 11315158-T-A *
13476549-C-T 11320873-C-T *
13488490-G-A 11332814-G-A *
5474213-A-AT 5606172-A-AT 9×T*
13398450-G-A 11242774-G-A *
13476617-G-T 11320941-G-T *
13433505-G-C 11277829-G-C *
13495446-T-C 11339770-T-C *
13475405-G-A 11319729-G-A *
13479203-G-T 11323527-G-T BY153339 *
13473718-A-C 11318042-A-C *
13712541-T-A 11556865-T-A *
13641232-T-G 11485556-T-G *
56710301-T-C *
28807257-A-G 26661110-A-G *
9300312-A-G 9462703-A-G Y*
10068354-A-G 10230745-A-G *
22484034-T-A 20322148-T-A DYZ19 *
13809053-G-A 11688347-G-A *
13711619-G-A 11555943-G-A *
13711615-A-G 11555939-A-G *
13711604-G-T 11555928-G-T *
13611671-C-T 11455995-C-T *
13486460-C-G 11330784-C-G *
13474633-G-C 11318957-G-C *
13340942-T-C 11185266-T-C *
13340924-C-T 11185248-C-T *
13340921-G-A 11185245-G-A *
10600052-G-A *
10082090-C-G 10244481-C-G *
10068331-T-C 10230722-T-C *
28583415-T-C 26437268-T-C *
10068330-T-A 10230721-T-A *
10068328-T-G 10230719-T-G *
10068321-A-T 10230712-A-T *
10068317-T-A 10230708-T-A *
10068275-A-T 10230666-A-T *
10068269-T-C 10230660-T-C *
10068257-G-A 10230648-G-A *
10068247-G-C 10230638-G-C *
10068244-C-G 10230635-C-G *
9975391-G-T 10137782-G-T Y*
9975384-C-T 10137775-C-T Y*
9975376-C-A 10137767-C-A Y*
9975375-A-T 10137766-A-T Y*
28583410-C-G 26437263-C-G *
28790337-A-C 26644190-A-C *
28791014-G-C 26644867-G-C *
10883268-T-C *
28791013-T-A 26644866-T-A *
28790954-G-T 26644807-G-T *
22508146-C-A 20346260-C-A DYZ19 *
17842693-T-C 15730813-T-C YY*
13531525-T-C 11375849-T-C *
13520479-C-G 11364803-C-G *
13520457-T-G 11364781-T-G *
13520448-G-C 11364772-G-C *
13486533-T-A 11330857-T-A *
13473166-A-T 11317490-A-T *
13460738-C-G 11305062-C-G *
13418124-G-A 11262448-G-A *
10929574-T-G *
10663981-A-G *
28790907-G-C 26644760-G-C *
10663977-T-C *
9980641-T-C 10143032-T-C Y*
9944736-C-T 10107127-C-T Y*
9941077-G-T 10103468-G-T Y*
9909160-T-C 10071551-T-C Y*
58834218-G-C,T 56756653-C-A,G *
56756468-G-A *
56686078-A-C *
28816638-C-G 26670491-C-G *
28816471-C-T 26670324-C-T *
28816464-G-C 26670317-G-C *
28816457-C-T 26670310-C-T *
28790962-C-T 26644815-C-T *
28790914-C-A 26644767-C-A *
56887139-GT- *

In the table above, the meaning of the confidence field depends on whether the data comes from an FTDNA kit or an FGC kit. For FTDNA kits, + implies a "PASS" result with just one possible variant, * indicates a "PASS" but with multiple variants, ** indicates "REJECTED" with just a single variant, and *** indicates "REJECTED" with multiple possible variants. 'A*' are heterozygous variants not called by FTDNA, but still pulled from the VCF file. For FGC kits, + indicates over 99% likely genuine (95% for INDELs); * over 95% likely genuine (90% for INDELs); ** about 40% likely genuine; *** about 10% likely genuine. Manual entries read directly from a BAM file will be either + indicating positive, or * indicating that the data show a mixture of possible variants.

For the FTDNA kits, the BED data is encoded in the background color of the cells. Those cells with a white background have coverage, those with a grey background indicate no coverage in the BED file, and those with a pink background indicate the mutation is on the edge of a coverage region. These pink regions often indicate that the individual may be positive for a SNP even if there is no corresponding entry in the vcf file.

The combBED column indicates whether or not the mutation is a SNP and falls in the combBED region defined in Defining a New Rate Constant for Y-Chromosome SNPs based on Full Sequencing Data by Dmitry Adamov, Vladimir Guryanov, Sergey Karzhavin, Vladimir Tagankin, Vadim Urasin.

The McDonald BED column indicates whether or not the mutation is a SNP and falls in the BED region used by Dr. Iain McDonald in the age analysis he does for R-U106 men.

Age Analysis Information (work in progress)

AllMcDonaldYFull
Kit: WGS2283517289424105127438461343
Used in age calculations17289424105127438461343
Counts of SNPs19260
Variant counts last updated 2022-11-28 03:50:21.



Big Tree Main Page