Tree Position

R-M269 > L23 > Z2103 > Z2106 > Z2108 > Z2110 > CTS7556 > Y5589 > BY250 > BY3717 > BY20217 > FT407478

Unique Mutations

The mutations unique to this man are summarized in the table below. Those with a '+' or '*' confidence level are considered by FamilyTreeDNA or FullGenomesCorp to be high quality SNPs/INDELs. For completeness, all other mutations of lesser confidence are included as well. These additional mutations may be useful for distinguishing between very closely related men.

Occasionally, some of the mutations listed here will be thought to be shared with other men in which case they might appear in upstream blocks on the tree. When this happens, the 'Blocks' field will indicate what block they appear in. Such a situation might arise with BigY men if the BED data suggests another man may be positive for a SNP, even though it doesn't appear in his VCF data. It might also happen if Chromo2 testing or Sanger sequencing of other men not on the tree show the SNP to be shared.

POS-REF-ALT (hg19) POS-REF-ALT (hg38) Blocks Names Region McDonald BED combBED STRKane-BY3
MI61544
10104154-T-G 10266545-T-G +
13579563-TC-T 11423887-TC-T +
15477291-CAAA-C 13365411-CAAA-C 18×A+
22503088-ATTTTTCCTTCAGATGTGTCCAGGGTTTCTGTCTTCTGGCAGGTTCATGGTCTTGCTCACTTCCAGAATGAAGCTGCAGACTTTAGTGGTGAGTGTTACAGCACTTAAAGTTGTTATGTCCAGAGT-A 20341202-ATTTTTCCTTCAGATGTGTCCAGGGTTTCTGTCTTCTGGCAGGTTCATGGTCTTGCTCACTTCCAGAATGAAGCTGCAGACTTTAGTGGTGAGTGTTACAGCACTTAAAGTTGTTATGTCCAGAGT-A DYZ19 +
28804479-A-G 26658332-A-G +
28804481-A-G 26658334-A-G +
10689000-C-CTCCATTCCAT +
13579573-A-G 11423897-A-G +
18890882-A-ATT 16779002-A-ATT 17×T+
21464771-G-GTTCTTC 19302885-G-GTTCTTC 16×TTC+
11021478-A-ATTCCATTCCATTCTACTCCACTCCATTCCACTCCACTCCACTCCGTTCCCTTATACTCCACTCCACTCCATTCCCGTCGACTCCACACAACTCCACTCCATTCAATTCCT +
28324772-G-T 26178625-G-T P1_b4 +
27518309-A-T 25372162-A-T P1_Y2 +
27495597-C-G 25349450-C-G P1_Y2 +
13579546-AAAAAAAAACAGAAAC-A 11423870-AAAAAAAAACAGAAAC-A +
56746001-G-T +
13579537-A-G 11423861-A-G +
58827069-G-C 56763802-C-G +
13477239-C-T 11321563-C-T +
11649618-A-AAATGGAATGGAATGGAATGGAATGGAATGGAATGGAATGGAATGG +
13843923-A-AGGAATGGAAT 11723217-A-AGGAATGGAAT 14×GGAAT+
13479002-C-A 11323326-C-A +
13479023-C-T 11323347-C-T +
14739804-GT-G 12627872-GT-G 13×T+
2649802-CAAA-C 2781761-CAAA-C 24×A+
13463374-C-T 11307698-C-T +
10647167-T-TCATTC +
13488683-G-T 11333007-G-T +
4726634-G-A 4858593-G-A +
13579633-G-A 11423957-G-A +
13293652-C-T 11137976-C-T +
17669700-C-CATAT 15557820-C-CATAT 15×AT+
13479006-C-T 11323330-C-T +
7164467-C-CA 7296426-C-CA 24×A+
21630370-G-GT 19468484-G-GT 9×T+
58914368-C-T 56676503-G-A +
10104062-G-T 10266453-G-T +
13726631-A-G 11570955-A-G +
10104087-G-A 10266478-G-A +
21757286-T-C +
10104089-C-T 10266480-C-T +
10104090-T-A 10266481-T-A +
10104096-G-T 10266487-G-T +
10104114-C-G 10266505-C-G +
2861534-C-CA 2993493-C-CA 25×A+
10104115-C-A 10266506-C-A +
10104122-T-C 10266513-T-C +
3967105-T-C 4099064-T-C +
10104161-T-G 10266552-T-G +
10104132-A-G 10266523-A-G +
10104134-A-G 10266525-A-G +
14031696-C-CTCTTTCTTTCTT 11910990-C-CTCTTTCTTTCTT 13×TCTT+
22360572-C-G 20198686-C-G DYZ19 +
56769788-A-G +
22360610-C-G 20198724-C-G DYZ19 +
10104156-G-A 10266547-G-A +
28565722-T-TTA 26419575-T-TTA 13×TA+
13482241-T-A 11326565-T-A *
13461126-CA-C 11305450-CA-C *
13447586-T-C 11291910-T-C *
28802897-TA-T 26656750-TA-T *
13482235-C-G 11326559-C-G *
28816894-T-C 26670747-T-C *
28802851-GTGTAGTGCATTGGACTGTAGGGGAT-G 26656704-GTGTAGTGCATTGGACTGTAGGGGAT-G *
28802886-T-G 26656739-T-G *
28802892-TGCAA-T 26656745-TGCAA-T *
13448836-C-CTCCATTCCAT,CTGCAT 11293160-C-CTCCATTCCAT,CTGCAT *
3712813-T-TGTGAGAGAGAGAGAGAGAGAGAGAGAGAGA 3844772-T-TGTGAGAGAGAGAGAGAGAGAGAGAGAGAGA *
56826916-C-CCATTCCATTA *
13269594-C-CA 11113918-C-CA *
13462139-C-T 11306463-C-T *
13460615-A-T 11304939-A-T *
13450104-CTCCACTCCACCCCATCCCATCCCATTCTATTCCAT-C,TTCCACTCCACCCCATCCCATCCCATTCTATTCCAT 11294428-CTCCACTCCACCCCATCCCATCCCATTCTATTCCAT-C,TTCCACTCCACCCCATCCCATCCCATTCTATTCCAT *
13450027-C-CTA 11294351-C-CTA *
13421119-G-T 11265443-G-T *
13421099-A-T 11265423-A-T *
13267907-TACAGGC-T 11112231-TACAGGC-T *
56826966-A-ATTT *
10780627-T-TTCCATTTCATTCCATTGCATTCCAC *
56860676-A-ACAC *
56849010-ATGTAACTCTTGCCTAGGCTTTGCCACAGGGGACTTTGTGACATATCTCTGCACTGATCACCCAGG-A *
56849005-AGGT-A *
56830349-A-AG *
56828548-C-CATTCCATTCGATTCCCTTTCATTTGATTCCATTCCATTA *
56828547-T-TAGTTTG *
13443296-C-A 11287620-C-A *
13860001-G-GGGGA 11739295-G-GGGGA *
10669556-T-C *
22364738-T-A 20202852-T-A DYZ19 *
10632717-G-C,C *
10632714-CA-C,C *
10632709-A-C,C *
9932231-G-A 10094622-G-A Y*
9320548-AACACACACACAC-A,AAC 9482939-AACACACACACAC-A,AAC 20×AC*
28587865-G-A 26441718-G-A *
13691419-T-A 11535743-T-A BY88676 *
13566828-A-G 11411152-A-G *
13493157-T-C 11337481-T-C *
13466879-C-A 11311203-C-A *
13241542-C-T 11085866-C-T *
9930019-G-T 10092410-G-T Y*
13480772-C-T 11325096-C-T *
10632765-CAACTG-C,C *
9943692-T-C 10106083-T-C Y*
13476667-A-T 11320991-A-T *
4044605-A-G 4176564-A-G *
14458558-CA-C,CAA 12337831-CA-C,CAA 21×A*
13483860-A-C 11328184-A-C *
9946115-A-G 10108506-A-G Y*
13516034-A-C 11360358-A-C *
4118676-CA-C,CAA 4250635-CA-C,CAA 14×A*
3042286-AT-A 3174245-AT-A 10×T*
22508580-T-G 20346694-T-G DYZ19 *
13475965-G-A 11320289-G-A *
17672318-G-GAA 15560438-G-GAA 16×A*
10632738-ATTCCATCCATATCATTCCATTCCC-A,A *
10632777-ACTCCTGTCCTCTTCT-A,A *
10625079-G-C *
13714910-AAGAAT-A 11559234-AAGAAT-A *
10625073-A-T *
10625070-A-C *
10625059-G-C *
10043548-A-G 10205939-A-G *
10043546-A-T 10205937-A-T *
10043542-C-G 10205933-C-G *
9932078-G-C 10094469-G-C Y10×T*
9932076-CA-C 10094467-CA-C *
56874786-CT-C 11×T*
13472667-A-G 11316991-A-G *
13860000-G-GA 11739294-G-GA *
13730693-T-G 11575017-T-G *
13704114-C-CAA 11548438-C-CAA *
10632799-TC-T,T *
13688379-ATGC-A 11532703-ATGC-A *
13688376-AG-A 11532700-AG-A *
13688374-A-ATAAT 11532698-A-ATAAT *
13474363-C-T 11318687-C-T *
13463797-G-A 11308121-G-A *
13463782-G-C 11308106-G-C *
13451188-C-CATTCCACTCCATTCCATTCCA 11295512-C-CATTCCACTCCATTCCATTCCA *
13451180-C-CTCATTTCCATTCCAT 11295504-C-CTCATTTCCATTCCAT *
13451173-C-CAATCCACTCT 11295497-C-CAATCCACTCT *
13449774-T-C,TCATTCAATTCCATCAC 11294098-T-C,TCATTCAATTCCATCAC *
13449351-C-CCTAAA,G 11293675-C-CCTAAA,G *
13241544-T-A 11085868-T-A *
10632802-ATTCCATTCCACTCCAT-A,A *
13468478-C-T 11312802-C-T *
13463838-T-G 11308162-T-G *
13483981-T-C 11328305-T-C *
13471701-G-A 11316025-G-A *
13479051-C-T 11323375-C-T *
10859967-A-ATTCAGTGCCATTCTATTCCTTTCAATACCATTCAATTCCATTCCACTCCT *
14658026-C-CTT 12546091-C-CTT 16×T*
28813884-A-C 26667737-A-C *
16029783-G-T 13917903-G-T Y*
16029774-TATG-T 13917894-TATG-T *
16029768-TAAAAC-T 13917888-TAAAAC-T *
13693710-A-C 11538034-A-C *
13693679-AAATAGCCTAGAATGGAATGAAATGG-A 11538003-AAATAGCCTAGAATGGAATGAAATGG-A *
13480773-C-A 11325097-C-A *
13471745-G-T 11316069-G-T *
13466264-C-CGG 11310588-C-CGG *
28638920-A-AT 26492773-A-AT 9×T*
13466260-ATGC-A 11310584-ATGC-A *
13462253-G-GC 11306577-G-GC *
13447514-T-A 11291838-T-A *
13443763-T-C 11288087-T-C *
13478952-C-A 11323276-C-A *
13479185-C-T 11323509-C-T *
18426175-C-CA 16314295-C-CA P6_Gap 9×A*
56850094-G-GATCACTCAGGTGATGGGTCTATTTTCTATACTCTGCCTAGAGGTGGATTCGTGACATAATCTCTGTACTA *
22362029-C-CTG 20200143-C-CTG DYZ19 *
13563623-C-T 11407947-C-T *
13481659-C-T 11325983-C-T *
13479138-C-A 11323462-C-A *
28785976-G-C 26639829-G-C *
13481626-T-A 11325950-T-A *
13470524-T-A 11314848-T-A *
9967284-T-C 10129675-T-C Y*
28586715-T-C 26440568-T-C *
22319066-A-T,T 20157180-A-T,T DYZ19 *
13698922-G-C 11543246-G-C *
13638475-G-A 11482799-G-A *
13504810-T-TAA 11349134-T-TAA *
13480769-C-T 11325093-C-T *
13479155-T-A 11323479-T-A *
13479118-CTAT-C 11323442-CTAT-C *
13479114-A-T 11323438-A-T *
13478997-A-C,C 11323321-A-C,C *
13464965-C-T 11309289-C-T BY85710 *
28785985-G-A 26639838-G-A *
13447506-TTCCA-T 11291830-TTCCA-T *
13263702-C-A 11108026-C-A *
13263694-G-C 11108018-G-C *
13263664-G-T 11107988-G-T *
56834810-T-TTCC *
22447655-T-C 20285769-T-C DYZ19 *
13701363-G-T 11545687-G-T *
13480839-C-G 11325163-C-G *
13449362-T-TCCAC 11293686-T-TCCAC *
13435787-ACTGTCATCGT-A 11280111-ACTGTCATCGT-A *
3603491-ATTTTTTTT-A 3735450-ATTTTTTTT-A 24×T*
28785991-G-C 26639844-G-C *
13481628-T-C 11325952-T-C *
13481619-T-A 11325943-T-A *
13489216-GC-G 11333540-GC-G *
14646227-C-T 12534291-C-T YY*
13449960-T-TTCCATTCCATACCATTCCATTCCATTGCATTCCACTCCATTCCACTCCACTCCAATCAACTCCACTCCACTCCACTTCACTCCAATCCACTCCAC 11294284-T-TTCCATTCCATACCATTCCATTCCATTGCATTCCACTCCATTCCACTCCACTCCAATCAACTCCACTCCACTCCACTTCACTCCAATCCACTCCAC *
10762763-T-C *
10627141-T-TGC *
10627137-ATT-A *
10627134-T-A *
9963959-T-G 10126350-T-G Y*
56861830-A-AGG *
56832495-C-T,T *
56826912-C-CATTTG *
14646275-G-A 12534339-G-A YY*
14646228-A-G 12534292-A-G YY*
14646209-A-T 12534273-A-T YY*
13497585-T-C 11341909-T-C *
14646187-A-G 12534251-A-G YY*
14646186-C-T 12534250-C-T YY*
13721684-G-A 11566008-G-A *
13502883-C-T 11347207-C-T *
13479096-C-T 11323420-C-T *
13469903-C-T 11314227-C-T *
13373097-C-T 11217421-C-T *
13476609-T-A,G 11320933-T-A,G *
9930024-GAC-G 10092415-GAC-G *
9930023-A-AAG 10092414-A-AAG *
9930012-ACCAG-A 10092403-ACCAG-A *
13697388-C-CAA 11541712-C-CAA *
13460648-G-T 11304972-G-T *
13497593-C-G 11341917-C-G *
13481613-C-G 11325937-C-G *
9964774-A-G 10127165-A-G Y*
13481612-C-G 11325936-C-G *
13481608-T-C 11325932-T-C *
13481598-A-T 11325922-A-T *
13479194-C-A 11323518-C-A *
13476863-T-TCG 11321187-T-TCG *
13476859-CTG-C 11321183-CTG-C *
13263606-G-T 11107930-G-T *
13263602-G-A 11107926-G-A *
10807377-TTC-T *
10807371-ATTC-A *
10807361-T-TGCA *
9963962-T-G 10126353-T-G Y*
22361950-A-T 20200064-A-T DYZ19 *
56832931-T-TCCTCTGCAC *
22509931-G-T 20348045-G-T DYZ19 *
13699376-G-T 11543700-G-T *
13699374-T-C 11543698-T-C *
13480616-G-A 11324940-G-A *
13480605-G-A 11324929-G-A *
13470917-C-CTGAT 11315241-C-CTGAT *
13470912-ACCAC-A 11315236-ACCAC-A *
13468114-G-T 11312438-G-T *
13452075-C-CTCCAA 11296399-C-CTCCAA *
22361987-C-T 20200101-C-T DYZ19 *
22361986-A-C 20200100-A-C DYZ19 *
13420167-T-C 11264491-T-C *
9949364-G-A 10111755-G-A Y*
28564242-AG-A 26418095-AG-A *
13476494-A-T 11320818-A-T *
13466214-G-C 11310538-G-C *
13466912-A-C 11311236-A-C *
13476642-C-T 11320966-C-T *
13476595-C-A 11320919-C-A *
13476576-G-C 11320900-G-C *
6045315-G-T 6177274-G-T *
5563451-C-CT 5695410-C-CT 11×T*
13555254-TA-T 11399578-TA-T 11×A*
13475970-T-G 11320294-T-G *
4009628-G-T 4141587-G-T *
6607981-A-AT 6739940-A-AT 11×T*
13725860-G-A 11570184-G-A *
4705290-G-GA 4837249-G-GA 10×A*
3240355-ATTTT-A 3372314-ATTTT-A 19×T*
4047392-G-GC 4179351-G-GC *
6525793-G-T 6657752-G-T *
26206003-G-GA 24059856-G-GA P1_Y1 9×A*
3570934-A-AT 3702893-A-AT 13×T*
5552459-TA-T 5684418-TA-T 11×A*
4050376-C-T 4182335-C-T FGC81653 *
13462191-A-C 11306515-A-C *
28588305-GAGCTATCAAGAAAGAC-G 26442158-GAGCTATCAAGAAAGAC-G *
10039044-C-CGT 10201435-C-CGT *
10039041-ATT-A 10201432-ATT-A *
13516242-C-A 11360566-C-A *
13466225-C-T 11310549-C-T *
18553441-AACAC-A 16441561-AACAC-A 11×AC*
4008588-CA-C 4140547-CA-C 10×A*
13590517-G-T 11434841-G-T *
13375484-G-A 11219808-G-A *
13375468-T-A 11219792-T-A *
13375465-T-C 11219789-T-C *
13264180-G-C 11108504-G-C *
13241590-C-T 11085914-C-T *
3432104-T-G 3564063-T-G *
3432101-C-A 3564060-C-A *
28802885-C-A 26656738-C-A *
22447486-G-T 20285600-G-T DYZ19 *
13730719-T-C 11575043-T-C *
13700381-G-C 11544705-G-C *
13590554-C-T 11434878-C-T *
13508326-A-AGC 11352650-A-AGC *
5951189-AT-A 6083148-AT-A 10×T*
13482219-G-T 11326543-G-T *
13480646-C-T 11324970-C-T *
13435745-G-A 11280069-G-A *
13398411-T-C 11242735-T-C *
13398045-C-T 11242369-C-T *
13375625-C-T 11219949-C-T *
9951552-A-G 10113943-A-G Y*
9940534-A-T 10102925-A-T Y*
6401115-T-C 6533074-T-C *
5230398-A-T 5362357-A-T *
5230395-A-T 5362354-A-T *
13706161-C-T 11550485-C-T FT449168 *
3950704-T-TA 4082663-T-TA 8×A*
16351273-G-GT,GTT 14239393-G-GT,GTT 16×T*
13395147-G-A 11239471-G-A *
4035474-T-TACA 4167433-T-TACA *
13468221-T-C 11312545-T-C *
17419435-C-A 15307555-C-A YY*
10978931-C-T *
23127414-CA-C,CAA 20965528-CA-C,CAA 24×A*
10869107-A-C *
22028383-G-GAA 19866497-G-GAA 12×A*
16648610-T-TA 14536730-T-TA 10×A*
16382748-TA-T 14270868-TA-T 10×A*
13472066-G-A 11316390-G-A *
15057738-ATTTT-A 12945830-ATTTT-A 18×T*
22364743-G-A 20202857-G-A DYZ19 *
9349520-C-G 9511911-C-G Y*
56832786-C-A *
13474415-G-C 11318739-G-C *
9913042-ATT-A 10075433-ATT-A 14×T*
56822552-A-G *
10869110-C-T *
17755383-G-T 15643503-G-T YY*
22241140-A-T 20079254-A-T DYZ19 *
13468049-A-T 11312373-A-T *
13489656-C-T 11333980-C-T *
13460951-A-G 11305275-A-G *
22508568-T-G 20346682-T-G DYZ19 *
4036460-T-C 4168419-T-C *
13474530-A-G 11318854-A-G *
10949625-CTGCAA-C *
13468123-G-C 11312447-G-C *
10846969-A-G *
13486578-C-G 11330902-C-G *
4050510-AT-A 4182469-AT-A 10×T*
13486574-C-T 11330898-C-T *
3378851-CAA-C 3510810-CAA-C 13×A*
13474762-A-C 11319086-A-C *
10949643-C-T *
13692307-G-A 11536631-G-A FT448726 *
13691962-G-A 11536286-G-A *
13480962-T-C 11325286-T-C *
10669548-C-G *
16842175-A-C 14730295-A-C YY*
13466446-T-G 11310770-T-G *
13487831-C-A 11332155-C-A *
9952609-G-T 10115000-G-T Y*
13463621-C-T 11307945-C-T *
13484837-A-C 11329161-A-C *
10677329-T-C *
5744662-C-CT 5876621-C-CT 11×T*
13474616-C-T 11318940-C-T *
13463292-C-G 11307616-C-G *
18054002-G-GTT 15942122-G-GTT 13×T*
9967159-C-A 10129550-C-A Y*
10974986-T-G *
3542368-CTT-C 3674327-CTT-C 13×T*
22477090-G-T 20315204-G-T FT459940 DYZ19 *
13480776-T-A 11325100-T-A *
13474779-T-A 11319103-T-A *
13461610-G-T 11305934-G-T *
13375486-T-A 11219810-T-A *
13395168-T-A 11239492-T-A *
28564241-G-C 26418094-G-C FTB34670 *
28564239-G-GC 26418092-G-GC *
13410455-A-G 11254779-A-G *
10043562-G-A 10205953-G-A *
10043520-G-T 10205911-G-T FT426891 *
13243683-G-A 11088007-G-A *
4370462-TA-T 4502421-TA-T *
13603629-A-AT 11447953-A-AT 15×T*
22359375-C-T 20197489-C-T DYZ19 *
13492824-G-T 11337148-G-T *
13431838-G-A 11276162-G-A *
6401112-C-T 6533071-C-T *
6401100-T-G 6533059-T-G *
22215217-CT-C,CTT 20053331-CT-C,CTT 17×T*
13481596-A-G 11325920-A-G *
13539438-A-G 11383762-A-G *
13438298-C-T 11282622-C-T *
13420904-C-T 11265228-C-T *
13375659-A-C 11219983-A-C *
3199752-C-CT 3331711-C-CT 10×T*
14097945-AT-A,ATT 11977239-AT-A,ATT 23×T*
13476602-C-T 11320926-C-T *
4316748-A-C 4448707-A-C *
2954670-G-GA 3086629-G-GA 10×A*
5338087-AT-A,ATT 5470046-AT-A,ATT 16×T*
18109358-TA-T,TAA 15997478-TA-T,TAA 23×A*
28785979-T-C 26639832-T-C *
13470544-C-G 11314868-C-G *
13438325-C-T 11282649-C-T *
13553457-C-A 11397781-C-A *
13476638-C-T 11320962-C-T *
9951436-C-G 10113827-C-G Y*
23435682-CT-C,C 21273796-CT-C,C 21×T*
18857159-T-G 16745279-T-G YY*
13719053-A-T 11563377-A-T *
9946078-C-T 10108469-C-T Y*
13390134-C-T 11234458-C-T *
13567356-G-A 11411680-G-A *
9340831-AAC-A,AACACAC 9503222-AAC-A,AACACAC 22×AC*
27011393-C-CT 24865246-C-CT P1_r4 9×T*
13478399-T-C 11322723-T-C *
10910698-C-CCTGTAGTCAGAG *
17351381-C-CT 15239501-C-CT 10×T*
13590531-GT-G 11434855-GT-G *
22458066-T-C 20296180-T-C DYZ19 *
13553465-A-G 11397789-A-G *
14646262-C-G 12534326-C-G YY*
14646203-G-T 12534267-G-T YY*
13251368-A-T 11095692-A-T *
9977069-C-T 10139460-C-T Y*
13583827-T-A 11428151-T-A *
13482242-T-C 11326566-T-C *
13435132-G-T 11279456-G-T *
13413226-G-C 11257550-G-C *
13372964-T-C 11217288-T-C *
13372939-T-G 11217263-T-G *
13372918-C-A 11217242-C-A *
13553475-G-T 11397799-G-T *
6401062-A-T 6533021-A-T *
5438920-C-T 5570879-C-T *
13395229-G-C 11239553-G-C *
13538393-A-G 11382717-A-G *
9964409-T-C 10126800-T-C Y*
9946013-C-G 10108404-C-G Y*
4055283-T-A 4187242-T-A *
6525804-G-T 6657763-G-T *
13470535-G-T 11314859-G-T *
13545748-CA-C 11390072-CA-C *
13476607-A-T 11320931-A-T *
6099384-CAA-C,CA 6231343-CAA-C,CA 17×A*
22484108-G-C 20322222-G-C DYZ19 *
22484069-C-T 20322183-C-T DYZ19 *
13489289-G-T 11333613-G-T *
13538400-A-C 11382724-A-C *
13375669-T-TAA 11219993-T-TAA *
13375825-T-A 11220149-T-A *
13859982-AT-A 11739276-AT-A *
56859243-T-G *
13733975-C-A 11578299-C-A *
13693522-T-G 11537846-T-G *
13590560-G-A 11434884-G-A *
13567342-G-A 11411666-G-A *
13539590-G-T 11383914-G-T *
13528502-G-A 11372826-G-A *
13506616-A-G 11350940-A-G *
13489338-C-G 11333662-C-G *
13482205-C-A 11326529-C-A *
13439700-G-T 11284024-G-T *
9964424-G-T 10126815-G-T Y*
13733982-G-T 11578306-G-T *
13706193-C-G 11550517-C-G *
13711806-A-T 11556130-A-T *
13395319-G-A 11239643-G-A *
13395280-C-T 11239604-C-T *
13395279-G-T 11239603-G-T *
13269581-ACAAAAAC-A 11113905-ACAAAAAC-A *
13251754-T-C 11096078-T-C *
15752638-CCTTCTT-C,CCTT 13640758-CCTTCTT-C,CCTT 25×CTT*
21687985-C-CAG 19526099-C-CAG 19×AG*
13488052-T-A 11332376-T-A *
13977176-T-C 11856470-T-C Y*
13733997-G-A 11578321-G-A *
13733993-A-G 11578317-A-G *
13733969-A-C 11578293-A-C *
13583716-C-T 11428040-C-T *
22487047-C-T 20325161-C-T BY224881 DYZ19 *
9994716-T-A 10157107-T-A Y*
13479154-C-A 11323478-C-A *
13444829-T-C 11289153-T-C *
13411544-A-G 11255868-A-G *
13251742-A-G 11096066-A-G *
10677319-TCCTTC-T *
4106178-C-T 4238137-C-T *
56881325-T-TAAAAA 11×A*
13513400-A-G 11357724-A-G *
9940532-TC-T 10102923-TC-T *
9940505-C-T 10102896-C-T Y*
56878253-G-GCA,GCACACA 9×CA*
10653557-C-G *
56827914-C-CAATCCATTCCATTCCATTCCATTAAATTCG *
13471725-G-A 11316049-G-A *
13636965-T-G 11481289-T-G *
14291258-T-A 12170552-T-A Y*
14215268-A-G 12094562-A-G YY*
14158568-A-T 12037862-A-T YY*
14140788-A-C 12020082-A-C YY*
14082047-TTCTATCTA-T,TTCTA 11961341-TTCTATCTA-T,TTCTA 11×TCTA*
13873784-T-C 11753078-T-C Y*
13745366-AATGGC-A 11589690-AATGGC-A *
13728455-G-T 11572779-G-T *
13714903-A-T 11559227-A-T BY211304 *
11557473-AAGTGGAATGGCATCG- *
13638623-G-T 11482947-G-T *
13597973-G-A 11442297-G-A *
14495163-AT-A 12383360-AT-A 9×T*
13572479-T-A 11416803-T-A *
13539607-C-T 11383931-C-T FT445008 *
13518547-T-A 11362871-T-A *
13516669-C-T 11360993-C-T *
13516043-A-G 11360367-A-G *
13503676-TG-T 11348000-TG-T *
13503674-TA-T 11347998-TA-T *
13489929-G-A,A 11334253-G-A,A *
11334094-G- *
11333967-C- *
13489637-C-A,CCCCA 11333961-C-A,CCCCA *
11333950-CCA- *
14451801-G-A 12331074-G-A Y*
14693739-A-G 12581805-A-G YY*
13489535-T-A 11333859-T-A *
15604375-G-T 13492495-G-T YY*
16855286-C-T 14743406-C-T YY*
16842168-G-A 14730288-G-A YY*
16749740-T-TG,TTG 14637860-T-TG,TTG 12×TG*
16641959-A-G 14530079-A-G YY*
16545267-TAA-T 14433387-TAA-T 12×A*
16408114-CCACACACA-C,CCACA 14296234-CCACACACA-C,CCACA 19×CA*
16318984-T-C 14207104-T-C Y*
16315096-CAAA-C 14203216-CAAA-C 12×A*
16202389-T-C 14090509-T-C YY*
15956841-G-T 13844961-G-T YY*
15903799-T-C 13791919-T-C YY*
15839959-TA-T,TAA 13728079-TA-T,TAA 17×A*
15486535-T-C 13374655-T-C YY*
14797320-G-GAA 12685391-G-GAA 13×A*
15388606-AC-A 13276726-AC-A 8×C*
15277703-AT-A 13165792-AT-A *
15270966-G-T 13159055-G-T YY*
15270963-G-C 13159052-G-C YY*
15270956-G-C 13159045-G-C YY*
15160483-G-A 13048569-G-A YY*
15076054-T-C 12964144-T-C YY*
15028821-C-T 12916909-C-T YY*
15028800-C-CT 12916888-C-CT *
14984680-T-A 12872748-T-A YY*
12868908-T- *
14927321-C-A 12815386-C-A YY*
13489573-C-G 11333897-C-G *
13489143-G-GAGGGCA 11333467-G-GAGGGCA *
17414908-CA-C,CAAA 15303028-CA-C,CAAA 18×A*
13470030-G-A 11314354-G-A *
13470581-G-A 11314905-G-A *
11314894-G- *
13470566-A-G,T 11314890-A-G,T *
13470545-AG-A,GG 11314869-AG-A,GG *
13470475-C-G 11314799-C-G *
13470441-C-A 11314765-C-A *
13470268-C-A 11314592-C-A *
13470262-CT-C 11314586-CT-C *
13470093-A-G 11314417-A-G *
13470076-C-G 11314400-C-G *
13470068-C-T 11314392-C-T *
13469925-T-C 11314249-T-C *
13474458-G-A 11318782-G-A *
13469904-G-A 11314228-G-A *
13469879-C-CATGG 11314203-C-CATGG *
13469872-GTGCC-G 11314196-GTGCC-G *
13469197-C-G 11313521-C-G *
13468602-T-A 11312926-T-A *
13468073-C-T 11312397-C-T *
13468052-C-T 11312376-C-T *
13468050-G-A 11312374-G-A *
13465445-A-C,T 11309769-A-C,T *
13465398-C-G,T 11309722-C-G,T *
13465390-T-A 11309714-T-A *
13465126-A-C 11309450-A-C *
13470585-G-T 11314909-G-T *
13474481-T-C 11318805-T-C *
13489139-GCC-G 11333463-GCC-G *
13482170-A-C 11326494-A-C *
13489138-A-ATG 11333462-A-ATG *
13488848-G-A 11333172-G-A *
13488844-G-GCC,GCT 11333168-G-GCC,GCT *
13488811-G-A,T 11333135-G-A,T *
13488621-A-G,G 11332945-A-G,G *
13487740-C-CAA 11332064-C-CAA *
13484982-T-C 11329306-T-C *
13484980-G-A 11329304-G-A *
13484943-C-T 11329267-C-T *
13484900-A-G 11329224-A-G *
13484887-TTA-T 11329211-TTA-T *
13483441-A-G 11327765-A-G *
13481516-C-A 11325840-C-A *
13476671-C-T 11320995-C-T *
13481506-A-T 11325830-A-T *
13480163-A-T 11324487-A-T *
13479201-A-G 11323525-A-G *
13479177-C-T 11323501-C-T *
13479100-G-A 11323424-G-A *
13478985-C-G 11323309-C-G *
13478967-G-T 11323291-G-T *
13478436-A-G 11322760-A-G *
13477094-A-G 11321418-A-G *
13477079-T-A 11321403-T-A *
11321184-T- *
13476708-C-G 11321032-C-G *
17355793-A-G 15243913-A-G YY*
17592345-CTTT-C,CTTTTTT 15480465-CTTT-C,CTTTTTT 24×T*
13465107-T-A 11309431-T-A *
27216342-T-G 25070195-T-G P1_g3 *
28668145-A-C 26521998-A-C *
28657147-G-GAA 26511000-G-GAA 14×A*
28600578-C-T 26454431-C-T Y*
28599582-A-G 26453435-A-G *
28587802-A-G 26441655-A-G *
28527833-G-GAGCCGAGATGGTGCCACT 26381686-G-GAGCCGAGATGGTGCCACT *
28518464-T-A 26372317-T-A *
28498430-C-A 26352283-C-A *
28486348-G-A 26340201-G-A *
28486296-A-T 26340149-A-T *
28375782-TA-T 26229635-TA-T P1_gr2 *
25733034-GTT-G 23586887-GTT-G P1_b3 17×T*
28706200-G-A 26560053-G-A Y*
25358368-A-G 23212221-A-G P2_r2 *
25302951-TAA-T 23156804-TAA-T P2_r1 12×A*
24910631-A-G 22764484-A-G g1 *
24513465-A-G 22367318-A-G *
24485605-T-A 22339458-T-A *
24432018-A-G 22285871-A-G Y*
24392482-T-C 22246335-T-C Y*
24079271-C-CA 21933124-C-CA P3_b1 9×A*
23969636-GA-G 21823489-GA-G 9×A*
21757878-T-C *
23839123-A-G 21677237-A-G Y*
23770366-C-T 21608480-C-T Y*
28668154-G-T 26522007-G-T *
28717031-ATAAT-A 26570884-ATAAT-A *
23049916-G-T 20888030-G-T YY*
56832858-C-G *
56884636-C-CAA *
56878565-AAT- *
56856797-G-T *
56856795-T-TATATTAAA *
56844293-C- *
56844231-TCTAGGCTCTGCGAACAGGGGCATTTTAACTTATCACTGCACTGATCATCGAGGTGATGC- *
56835867-G-GCCACTCCATTCCACTCCACTCCATTCCATTCCACTCTACTCCACTCCACTCCACGCCACTCCATTCCACTCCACA *
56833846-ACT- *
56832937-TCCCCTCCCCTCCATTGCATTCCCTTCC-T *
56832932-TCCA-T *
56832886-CTCAACTCAAT-C *
56832862-TCCATTCC-T *
56832833-CCACTCCATGCCAGTCCA-C *
28785747-G-A 26639600-G-A *
56832832-TCCACTCCATGCCAGTCCACTCCACTCCA- *
56832829-CATT-C *
56832765-A-ACTCC *
56830109-A-G,G *
56706932-T-C *
28815338-G-A 26669191-G-A *
28813885-A-C 26667738-A-C *
28813867-T-A 26667720-T-A *
28793395-G-T 26647248-G-T *
28785765-T-A 26639618-T-A *
28785758-A-C 26639611-A-C *
28785753-A-G 26639606-A-G *
23695834-T-TGC 21533948-T-TGC *
22747063-A-G 20585177-A-G YY*
17747605-A-G 15635725-A-G YY*
18820822-A-C 16708942-A-C YY*
21438919-C-A 19277033-C-A YY*
21437294-TA-T 19275408-TA-T *
21148696-T-G 18986810-T-G YY*
21117284-A-C 18955398-A-C YY*
20984748-TTATC-T,T 18822862-TTATC-T,T P4_Dst 12×TATC*
20833370-G-GAAA 18671484-G-GAAA P4_Gap 12×A*
19329157-A-G 17217277-A-G Y*
18959650-G-A 16847770-G-A YY*
18934347-T-G 16822467-T-G YY*
18907691-C-A 16795811-C-A YY*
18898233-G-A 16786353-G-A FT111886 YY*
18780601-C-T 16668721-C-T YY*
21510788-A-T 19348902-A-T YY*
18683086-CA-C 16571206-CA-C 8×A*
18555516-A-G 16443636-A-G YY*
18396936-A-ATTT 16285056-A-ATTT P6_Gap 10×T*
18384508-AAG-A 16272628-AAG-A P6_Gap *
18209106-GTAGA-G,G 16097226-GTAGA-G,G 12×TAGA*
18125759-GGAAA-G,GGAAAGAAA 16013879-GGAAA-G,GGAAAGAAA 13×GAAA*
18036565-G-A 15924685-G-A YY*
18036559-A-T 15924679-A-T YY*
18036539-C-T 15924659-C-T YY*
17874748-T-A 15762868-T-A YY*
17808559-AGG-A 15696679-AGG-A *
17808557-G-GAC 15696677-G-GAC *
21495971-G-A 19334085-G-A Y*
21785944-T-C 19624058-T-C YY*
22657115-GT-G 20495229-GT-G 8×T*
22319171-G-T,T 20157285-G-T,T DYZ19 *
22633871-AAATAATAAT-A,AAATAATAATAAT 20471985-AAATAATAAT-A,AAATAATAATAAT 13×AAT*
22509356-G-GT 20347470-G-GT DYZ19 *
22489997-CCTTCTGGCAGGTTCGTGGTCTTGCTCACTTCACTAATGAAGCTGCAGACCTTACTGGTGAGTATTACAGCACTTAAAGGTGTTATGTCCAGAGTTTGTTCCTTCAGATGTGTCCAGGGTTTCTGT-C 20328111-CCTTCTGGCAGGTTCGTGGTCTTGCTCACTTCACTAATGAAGCTGCAGACCTTACTGGTGAGTATTACAGCACTTAAAGGTGTTATGTCCAGAGTTTGTTCCTTCAGATGTGTCCAGGGTTTCTGT-C DYZ19 *
22486358-GT-G 20324472-GT-G DYZ19 *
22469253-G-A 20307367-G-A DYZ19 *
22448540-T-A 20286654-T-A DYZ19 *
22447681-C-CT 20285795-C-CT DYZ19 *
22443558-C-A 20281672-C-A DYZ19 *
22426373-C-G 20264487-C-G DYZ19 *
22364685-C-G 20202799-C-G DYZ19 *
22362038-T-C 20200152-T-C DYZ19 *
22362031-G-T 20200145-G-T DYZ19 *
22311224-T-G 20149338-T-G DYZ19 *
21832725-C-CA 19670839-C-CA 8×A*
22269972-AGATGTGTCCAGTTTCTTCCTTCTGGCAGGTTCATGGTCTTGCTAGCTTCAAGAATGAAGCTGCAGACATTTT-A 20108086-AGATGTGTCCAGTTTCTTCCTTCTGGCAGGTTCATGGTCTTGCTAGCTTCAAGAATGAAGCTGCAGACATTTT-A DYZ19 *
22255597-T-G 20093711-T-G DYZ19 *
22255596-G-C 20093710-G-C DYZ19 *
22255543-C-A 20093657-C-A DYZ19 *
22255524-C-A 20093638-C-A DYZ19 *
22241166-G-C 20079280-G-C DYZ19 *
22241159-A-C 20079273-A-C DYZ19 *
22241158-C-G 20079272-C-G DYZ19 *
22100345-A-G 19938459-A-G YY*
22039821-A-G 19877935-A-G YY*
21961738-TA-T 19799852-TA-T *
21851458-A-G 19689572-A-G Y*
13465114-A-T 11309438-A-T *
13465100-G-T 11309424-G-T BY48388 *
13471729-G-T 11316053-G-T *
3160974-T-C 3292933-T-C *
3840067-A-C 3972026-A-C *
3830037-A-G 3961996-A-G *
3820305-T-C 3952264-T-C *
3765042-A-G 3897001-A-G *
3664718-A-G 3796677-A-G *
3578946-A-G 3710905-A-G *
3548417-A-C 3680376-A-C *
3320920-G-A 3452879-G-A *
3301427-CAAA-C 3433386-CAAA-C 12×A*
3193677-C-T 3325636-C-T *
3175487-T-C 3307446-T-C *
3042238-T-C 3174197-T-C *
3850596-A-G 3982555-A-G *
2986298-T-C 3118257-T-C *
2934097-T-A 3066056-T-A *
2798710-A-T 2930669-A-T YY20×T*
56835778-ATTCCACTGCATTCCATTCCATTCCCTTCGACTCCACTCCACTCCTCTCCATT-A *
56835773-ATTCC-A *
16282398-CA-C,CAA 14170518-CA-C,CAA 24×A*
13489760-C-A 11334084-C-A *
56831940-T- *
56831844-A- *
22441644-G-T 20279758-G-T DYZ19 *
22441643-T-A 20279757-T-A DYZ19 *
22441637-TA-T 20279751-TA-T DYZ19 *
3848398-A-G 3980357-A-G *
3929072-C-T 4061031-C-T *
13469083-A-G 11313407-A-G *
4564938-TA-T 4696897-TA-T 10×A*
5327719-A-G 5459678-A-G *
5291165-A-G 5423124-A-G *
5291163-TA-T 5423122-TA-T *
5134713-G-T 5266672-G-T *
5028129-A-G 5160088-A-G *
4938930-T-C 5070889-T-C *
4882134-AT-A 5014093-AT-A 8×T*
4853140-A-G 4985099-A-G *
4739380-A-G 4871339-A-G *
4694533-A-G 4826492-A-G *
4692365-G-T 4824324-G-T *
4605400-A-G 4737359-A-G *
4502509-C-T 4634468-C-T *
4031611-A-G 4163570-A-G *
4502494-T-TC 4634453-T-TC *
4481397-C-T 4613356-C-T *
4467758-T-C 4599717-T-C *
4420178-T-C 4552137-T-C *
4378539-T-C 4510498-T-C *
4282271-G-C 4414230-G-C *
4271014-A-G 4402973-A-G *
4217759-C-CT 4349718-C-CT 9×T*
4044541-G-T 4176500-G-T *
4044464-A-G 4176423-A-G *
4033988-C-T 4165947-C-T FT400970 *
4031623-C-G 4163582-C-G *
13488510-A-G 11332834-A-G *
5507713-ATT-A,AT 5639672-ATT-A,AT 24×T*
5529684-C-T 5661643-C-T *
13474624-C-T 11318948-C-T *
56826965-T-TCC *
13466891-A-T 11311215-A-T *
13466516-G-A 11310840-G-A *
8992722-C-CTT 9155113-C-CTT 14×T*
28588249-A-G 26442102-A-G *
13480457-T-C 11324781-T-C *
13465005-G-T 11309329-G-T *
13354434-C-T 11198758-C-T *
9946140-T-C 10108531-T-C Y*
9946136-G-T 10108527-G-T Y*
56851299-A-AAGACATATCTCTGCACTGATCACCCCAGGGAGAGAATTCTTGTTTAGGTTCTGCCTACAGGGGGCTTTG *
13450122-CATCCCATTCT-C 11294446-CATCCCATTCT-C *
13469889-G-A 11314213-G-A *
6688165-T-TA 6820124-T-TA 10×A*
56833368-T-TCCATTCCATTCCAC *
56833367-A-AC *
56756886-A-C *
18679925-CA-C,CAA 16568045-CA-C,CAA 25×A*
13480855-A-G 11325179-A-G *
13479058-C-G 11323382-C-G *
13347507-C-G 11191831-C-G *
9320496-TA-T,T 9482887-TA-T,T 10×A*
13489599-C-T 11333923-C-T *
13474300-G-C 11318624-G-C *
13471747-A-C 11316071-A-C *
15489127-C-CA 13377247-C-CA 8×A*
13489638-ACCCCCG-A 11333962-ACCCCCG-A *
13706150-A-T 11550474-A-T *
9944027-C-T 10106418-C-T Y*
13476686-T-C 11321010-T-C *
13476664-A-T 11320988-A-T *
13476658-A-T 11320982-A-T *
13470510-G-A 11314834-G-A *
13469202-T-A 11313526-T-A *
13583816-G-T 11428140-G-T *
9946147-A-C 10108538-A-C Y*
9946142-AAT-A 10108533-AAT-A *
22487083-C-T 20325197-C-T DYZ19 *
22446741-T-A 20284855-T-A DYZ19 *
13478458-C-G 11322782-C-G *
13478449-C-A 11322773-C-A *
56832005-C-CTCCACTCCACTCCAT *
56833253-T-TTCCATTCCACTCCAC *
13482153-C-T 11326477-C-T *
13462257-C-CCCCTCACCCCTT 11306581-C-CCCCTCACCCCTT *
13204374-TTATGATAATGGTGGTGATGGTG-T 11048698-TTATGATAATGGTGGTGATGGTG-T *
10978921-C-T *
5862226-T-C 5994185-T-C *
13484974-C-A 11329298-C-A *
13469878-T-A 11314202-T-A *
13469871-G-A 11314195-G-A *
13469840-A-T 11314164-A-T *
13466937-G-C 11311261-G-C *
13470862-G-A 11315186-G-A *
13468071-A-G 11312395-A-G *
5438570-A-G 5570529-A-G *
5539254-G-GTTT 5671213-G-GTTT 13×T*
13464964-C-A 11309288-C-A *
10974999-G-A *
13262762-G-A 11107086-G-A *
13258360-T-G 11102684-T-G *
13256635-GTTTT-G 11100959-GTTTT-G 16×T*
13253176-AGGCCCCGC-A 11097500-AGGCCCCGC-A *
13253155-AC-A 11097479-AC-A *
13251844-C-T 11096168-C-T FT441845 *
13251843-C-G 11096167-C-G *
13251808-C-T 11096132-C-T *
13243717-G-A 11088041-G-A *
10987344-C-T *
10980761-CT-C *
10964920-G-C *
13271093-C-T 11115417-C-T *
10924524-CTCCAT-C *
10914784-G-C *
10914490-A-G *
10914298-C-A *
10914249-G-T *
10914248-G-C *
10869112-C-A *
10820994-CCCTTCCATTTCATTCTACTT-C *
10816518-G-GTTCCA,GTTCCATTCCA *
10807269-T- *
10794271-C-CTT *
10794268-CTA-C *
11113912-CAAAA- *
13338621-G-C 11182945-G-C *
10765743-TCACTGCACTCCACTC- *
11296305-A- *
13464912-C-T 11309236-C-T *
13463940-G-GTTGTATCTTCCCCCGCCCCCAAAACCGGGCT 11308264-G-GTTGTATCTTCCCCCGCCCCCAAAACCGGGCT *
13463348-T-C,C 11307672-T-C,C *
13462144-C-G 11306468-C-G *
13461132-A-G 11305456-A-G *
13460917-A-G 11305241-A-G *
13454898-A-T 11299222-A-T *
13454885-T-C 11299209-T-C *
13454876-C-G 11299200-C-G *
13454867-C-T 11299191-C-T *
13454847-C-CTTTCT 11299171-C-CTTTCT *
11296323-AATCCACTCCAATCCATTCCACTCCAGTCCATTCCAATCCATTCCACTCTACGCCATAACATTAAG- *
13451211-C-CCATTCCATTCCATTCCATTCCATTCCACGT 11295535-C-CCATTCCATTCCATTCCATTCCATTCCACGT *
13338622-C-A 11182946-C-A *
13451163-T-TCCTCTGCACTCCACTCCACTGC 11295487-T-TCCTCTGCACTCCACTCCACTGC *
13450879-A-ACCACTCCACTCCTCTCCCCAACACT,ACCACTCCATTCCTCTCCCCAACACT 11295203-A-ACCACTCCACTCCTCTCCCCAACACT,ACCACTCCATTCCTCTCCCCAACACT *
11294441-CATCCCATCCCATTCT- *
13449752-TCAAC-T 11294076-TCAAC-T *
13447537-T-C 11291861-T-C *
13447532-T-C 11291856-T-C *
13447517-CCGATTACACTA-C 11291841-CCGATTACACTA-C *
13443773-G-A 11288097-G-A *
13421656-C-G 11265980-C-G *
13415407-AT-A 11259731-AT-A 10×T*
13398430-A-C 11242754-A-C *
13353858-T-C 11198182-T-C *
10794022-CCTCCA-C *
10762778-T-TGCCATTCCACTCCAC *
5659975-T-C 5791934-T-C *
7618087-TC-T 7750046-TC-T *
10016736-T- *
9842202-A-G 10004593-A-G YY*
9820767-C-CA 9983158-C-CA 8×A*
9339830-C-G 9502221-C-G Y*
9297639-A-C 9460030-A-C Y*
9227829-G-A 9390220-G-A Y*
8888405-G-T 9020364-G-T Y*
9020362-A- *
9020361-C- *
8470549-C-CAAA 8602508-C-CAAA 22×A*
8153654-T-C 8285613-T-C YY*
7618089-TTTC-T 7750048-TTTC-T *
7513257-TA-T 7645216-TA-T *
9919852-A-T 10082243-A-T Y*
7456717-A-C 7588676-A-C IR1_L *
7400573-TGAGAGA-T 7532532-TGAGAGA-T 12×GA*
7115932-A-T 7247891-A-T Y*
6674945-T-C 6806904-T-C YY*
6401877-G-A 6533836-G-A *
6089355-G-T 6221314-G-T *
5991363-G-C 6123322-G-C *
5933233-CA-C,CAA 6065192-CA-C,CAA 18×A*
5889496-T-C 6021455-T-C *
5871948-A-G 6003907-A-G *
5776638-C-CA 5908597-C-CA 9×A*
5660149-C-A 5792108-C-A *
9867269-CT-C 10029660-CT-C 9×T*
9919881-A-G 10082272-A-G Y*
10762772-T-A *
10627152-C-A *
10762769-A-AT *
10762767-A-C *
10762765-G-GCACT *
10679706-T-TTTCAGAAGATCTCACTCTGTCACTCAGGTTGGAGTGCAGTCGCATAATCTCAGCTCACATTACA *
10677324-CCCATT- *
10671808-ATTGC-A *
10669563-C-G *
10669553-C-T *
10669543-CCGT-C *
10669540-ATT-A *
10652337-CAGCTCACAATTCATTTCACTTTTCCATTCCATTCCATTCCTTTCAATTACATTCCACACCATTCCACCACCCTCCACTCTACTCCATTCCATTCCATTGCATTCCATTCCATTTCGTTCCATTCCATTTCATTCCATTCCATTCCTTT-C *
10652277-CATTCTGTCTTCAACAGGATCTCACTTTGTCACTTAGGCTGGAGTGCAGTGTCACAA-C *
10627143-CCCCAA-C *
9919882-T-G 10082273-T-G Y*
9963946-A-G 10126337-A-G Y*
9963941-T-A 10126332-T-A Y*
9963939-G-T 10126330-G-T Y*
9949355-T-G 10111746-T-G Y*
9949354-A-G 10111745-A-G Y*
9949353-C-A 10111744-C-A Y*
9949349-G-T 10111740-G-T Y*
9949348-T-C 10111739-T-C Y*
10094478-TTAAAA- *
9930004-CTTGGG-C 10092395-CTTGGG-C *
9930000-TG-T 10092391-TG-T *
9919895-A-T 10082286-A-T Y*
3349229-CAA-C 3481188-CAA-C 22×A*
15495460-C-CAAA 13383580-C-CAAA 16×A*
13464473-G-A 11308797-G-A *
13567254-A-C 11411578-A-C *
22255563-A-C 20093677-A-C DYZ19 *
21462353-A-AGT 19300467-A-AGT 16×GT*
19048041-GTA-G 16936161-GTA-G *
13705785-G-A 11550109-G-A *
13622184-G-T 11466508-G-T *
13588891-C-T 11433215-C-T *
13588868-G-A 11433192-G-A *
13588867-A-C 11433191-A-C *
13578048-A-G 11422372-A-G *
13567325-T-C 11411649-T-C *
13567313-A-T 11411637-A-T *
13559115-G-A 11403439-G-A *
22477612-T-A 20315726-T-A BY174798 DYZ19 *
13549908-C-G 11394232-C-G *
13544547-G-A 11388871-G-A *
13544546-T-C 11388870-T-C *
13520913-C-T 11365237-C-T *
13507611-A-G 11351935-A-G *
13502954-G-T 11347278-G-T *
13475530-C-G 11319854-C-G *
13466495-T-A 11310819-T-A *
13460805-T-C 11305129-T-C *
13443721-A-C 11288045-A-C *
13442638-G-A 11286962-G-A *
13442410-T-C 11286734-T-C FT443692 *
22458007-T-A 20296121-T-A DYZ19 *
28709245-G-T 26563098-G-T *
13435909-A-G 11280233-A-G *
58978989-G-GCCACTCCATT 56832842-G-GCCACTCCATT *
10068695-A-T 10231086-A-T *
10068654-G-C 10231045-G-C *
13257515-A-T 11101839-A-T *
13466401-C-A 11310725-C-A *
22255974-A-T 20094088-A-T BY214317 DYZ19 *
10043489-C-A 10205880-C-A *
10043484-A-G 10205875-A-G *
22270195-G-T 20108309-G-T A3997 DYZ19 *
9984941-A-AG 10147332-A-AG *
22366390-C-T 20204504-C-T DYZ19 *
22366380-A-G 20204494-A-G DYZ19 *
13599174-T-G 11443498-T-G *
58984292-C-T 56838145-C-T *
28709494-G-A 26563347-G-A *
22348628-G-A 20186742-G-A DYZ19 *
17648009-CAAAA-C 15536129-CAAAA-C 17×A*
9341856-A-G 9504247-A-G Y*
13384985-G-A 11229309-G-A *
59000107-A-G 56853960-A-G *
13718534-C-T 11562858-C-T *
13740210-T-A 11584534-T-A *
28583314-A-G 26437167-A-G *
28583310-C-T 26437163-C-T *
13464981-C-A 11309305-C-A *
13476120-G-A 11320444-G-A *
59021041-C-T 56874894-C-T *
13439650-C-T 11283974-C-T *
13390135-A-G 11234459-A-G *
10068701-C-A 10231092-C-A *
4047357-C-T 4179316-C-T *
5136311-A-T 5268270-A-T *
4688849-T-C 4820808-T-C *
4342513-A-C 4474472-A-C *
4318635-A-C 4450594-A-C *
4317897-T-C 4449856-T-C *
4317065-T-C 4449024-T-C *
4312100-A-G 4444059-A-G *
4303101-G-C 4435060-G-C *
4207957-C-CAA 4339916-C-CAA 22×A*
4096709-A-G 4228668-A-G *
4050177-A-G 4182136-A-G A13688 *
4044776-T-G 4176735-T-G *
5415500-T-C 5547459-T-C FGC69280 *
4044718-C-T 4176677-C-T *
4044613-C-A 4176572-C-A *
4044545-G-T 4176504-G-T *
4040607-T-C 4172566-T-C *
4040549-G-A 4172508-G-A *
4036477-G-A 4168436-G-A *
4036326-A-G 4168285-A-G *
4036271-A-C 4168230-A-C *
4014266-C-T 4146225-C-T FGC81631 *
3998149-A-G 4130108-A-G FT7217 *
3997518-T-C 4129477-T-C *
3989883-T-A 4121842-T-A *
5143006-C-T 5274965-C-T FGC7826 *
5666456-GTC-G 5798415-GTC-G 8×TC*
13354110-C-T 11198434-C-T *
10044248-GA-G 10206639-GA-G *
13279942-G-T 11124266-G-T *
13269043-G-A 11113367-G-A *
13269042-T-C 11113366-T-C *
13267464-GT-G 11111788-GT-G *
13267099-C-T 11111423-C-T *
13256619-G-C 11100943-G-C *
13256287-G-T 11100611-G-T *
13252473-C-T 11096797-C-T *
10093273-G-A 10255664-G-A *
10093259-G-A 10255650-G-A FT91461 *
10044286-T-G 10206677-T-G *
10044280-A-T 10206671-A-T *
10043530-C-T 10205921-C-T *
6445370-A-C 6577329-A-C *
10043064-C-T 10205455-C-T *
10043007-G-C 10205398-G-C *
9984401-A-G 10146792-A-G Y*
9977932-C-A 10140323-C-A Y*
9977021-T-C 10139412-T-C Y*
9964760-G-A 10127151-G-A Y*
9964758-G-T 10127149-G-T Y*
9956972-C-G 10119363-C-G Y*
9956934-A-C 10119325-A-C Y*
9944533-T-G 10106924-T-G Y*
8787783-TTG-T 8919742-TTG-T 8×TG*
7148000-A-C 7279959-A-C YY*
10068698-T-G 10231089-T-G *
22447692-G-A 20285806-G-A DYZ19 *
3932521-G-A 4064480-G-A *
17362452-A-AAC 15250572-A-AAC 11×AC*
58985783-A-C 56839636-A-C *
9215995-G-T 9378386-G-T Y*
13480430-C-T 11324754-C-T *
4035854-G-GAT 4167813-G-GAT *
3404731-G-GA 3536690-G-GA 11×A*
6130157-AAC-A 6262116-AAC-A 18×AC*
22359444-C-T 20197558-C-T DYZ19 *
13466349-G-C 11310673-G-C *
13261324-A-G 11105648-A-G *
13709781-T-G 11554105-T-G *
13709774-G-C 11554098-G-C *
10043572-A-C 10205963-A-C *
13465493-T-G 11309817-T-G *
9952611-C-T 10115002-C-T Y*
7103038-T-TAC 7234997-T-TAC 17×AC*
13504824-G-T 11349148-G-T *
13504823-G-T 11349147-G-T *
13375630-C-A 11219954-C-A *
9977946-C-G 10140337-C-G Y*
18082920-GT-G 15971040-GT-G 11×T*
13488918-C-A 11333242-C-A *
9952545-G-T 10114936-G-T Y*
13496647-G-A 11340971-G-A *
59031043-C-A 56884896-C-A *
59026970-A-T 56880823-A-T *
13688317-G-T 11532641-G-T *
17832657-T-TAC 15720777-T-TAC 11×AC*
59024675-G-A 56878528-G-A *
13482148-C-A 11326472-C-A *
13471997-C-T 11316321-C-T *
13471993-C-G 11316317-C-G *
5740515-TA-T 5872474-TA-T 11×A*
21078408-C-CA 18916522-C-CA 12×A*
13466234-A-G 11310558-A-G *
9946318-G-T 10108709-G-T Y*
9946313-C-T 10108704-C-T Y*
10043014-G-T 10205405-G-T *
28786382-A-G 26640235-A-G A13131 *
28786368-T-A 26640221-T-A *
59003424-C-A 56857277-C-A *
58905306-C-A 56685565-G-T *
13474720-G-A 11319044-G-A *
13463876-G-T 11308200-G-T *
10043040-A-T 10205431-A-T *
13467399-T-C 11311723-T-C *
58995120-G-A 56848973-G-A *
6604084-CTT-C 6736043-CTT-C 17×T*
9962277-C-T 10124668-C-T Y*
13461286-G-T 11305610-G-T *
9909109-C-A 10071500-C-A Y*
13475567-T-A 11319891-T-A *
13433252-C-A 11277576-C-A *
13740237-G-A 11584561-G-A *
13472015-G-A 11316339-G-A *
13472031-C-G 11316355-C-G *
59024836-G-T 56878689-G-T *
59020291-A-G 56874144-A-G *
6346345-CATAT-C 6478304-CATAT-C 10×AT*
10037880-C-T 10200271-C-T *
13469179-A-G 11313503-A-G *
13468216-G-T 11312540-G-T *
13447457-C-A 11291781-C-A *
13435833-A-G 11280157-A-G *
13390022-G-A 11234346-G-A *
13265490-G-A 11109814-G-A *
13264217-TTC-T 11108541-TTC-T *
13263674-G-A 11107998-G-A *
13258510-C-T 11102834-C-T *
13251168-C-T 11095492-C-T FGC16843 F6610 *
13243576-G-A 11087900-G-A *
10044262-C-T 10206653-C-T FT32882 *
9964517-C-G 10126908-C-G Y*
13475539-G-T 11319863-G-T *
9956939-G-A 10119330-G-A Y*
9944010-G-A 10106401-G-A Y*
6445359-C-T 6577318-C-T *
6401083-T-C 6533042-T-C *
5877093-T-C 6009052-T-C *
5136277-A-T 5268236-A-T *
4896953-CAG-C 5028912-CAG-C *
4096763-C-T 4228722-C-T *
3320940-C-G 3452899-C-G *
3003745-C-G 3135704-C-G FT315709 *
58978144-C-G 56831997-C-G *
58978140-C-CATTCA 56831993-C-CATTCA *
13474679-A-G 11319003-A-G *
13480642-GC-G 11324966-GC-G *
59013962-A-G 56867815-A-G *
28582492-A-G 26436345-A-G FTB18381 *
59013931-C-G 56867784-C-G *
59012157-C-T 56866010-C-T *
59011890-G-T 56865743-G-T *
59003608-G-T 56857461-G-T *
59003562-C-T 56857415-C-T *
59003453-T-G 56857306-T-G *
59003292-AG-A 56857145-AG-A *
59001276-C-T 56855129-C-T *
59001114-C-T 56854967-C-T *
59000369-G-T 56854222-G-T *
58999540-T-G 56853393-T-G *
58994390-G-T 56848243-G-T *
22684036-C-T 20522150-C-T CTS10657 YY*
13480654-A-T 11324978-A-T *
22662303-C-T 20500417-C-T YY*
22508571-A-T 20346685-A-T BY46401 DYZ19 *
18769726-AAT-A 16657846-AAT-A *
18553485-AAG-A 16441605-AAG-A *
16718688-CAT-C 14606808-CAT-C *
16199759-ACATT-A 14087879-ACATT-A 5×CATT*
14071549-CGT-C 11950843-CGT-C *
13842705-ATCAACCCGAG-A 11721999-ATCAACCCGAG-A *
13566116-G-T 11410440-G-T *
13550291-C-G 11394615-C-G *
13538347-T-G 11382671-T-G *
13510205-G-GA 11354529-G-GA 11×A*
3945638-T-G 4077597-T-G *
3928845-C-A 4060804-C-A *
13472014-C-T 11316338-C-T *
22251131-C-T 20089245-C-T DYZ19 *
22511817-C-G 20349931-C-G DYZ19 *
22511788-T-A 20349902-T-A DYZ19 *
7474374-AAGAG-A 7606333-AAGAG-A IR1_L 21×AG*
58833986-CCCATT-C 56756844-CAATGG-C 8×CCATT*
13712039-A-C 11556363-A-C *
13473884-T-A 11318208-T-A *
13723479-C-A 11567803-C-A *
9979502-C-T 10141893-C-T Y*
22476755-T-A 20314869-T-A DYZ19 *
13729019-G-A 11573343-G-A *
22475252-G-A 20313366-G-A F25197 DYZ19 *
13846445-G-A 11725739-G-A FGC40689 *
58883943-T-C 56706928-A-G *
21815962-A-AT 19654076-A-AT 11×T*
22476767-G-T 20314881-G-T DYZ19 *
22446727-A-C,G 20284841-A-C,G DYZ19 *
13469880-G-A 11314204-G-A BY85823 *
22503072-G-T 20341186-G-T DYZ19 *
13709802-A-T 11554126-A-T *
13484955-G-C 11329279-G-C BY210388 *
13477072-A-G 11321396-A-G *
22255612-T-A 20093726-T-A BY214293 DYZ19 *
13734173-A-C 11578497-A-C *
9160320-A-AAC 9322711-A-AAC 17×AC*
22359343-G-A 20197457-G-A DYZ19 *
13463315-C-G 11307639-C-G *
16369735-GAA-G 14257855-GAA-G 15×A*
9944537-A-T 10106928-A-T Y*
9304601-G-C 9466992-G-C Y*
59007432-C-CTTTA 56861285-C-CTTTA 18×T*
22266400-C-G 20104514-C-G DYZ19 *
13437203-G-T 11281527-G-T Z7999 *
22436926-T-A 20275040-T-A DYZ19 *
13474543-T-A 11318867-T-A *
7517715-T-TA 7649674-T-TA 10×A*
7289779-GGA-G 7421738-GGA-G 9×GA*
13489646-A-G 11333970-A-G *
22508268-C-G 20346382-C-G DYZ19 *
13487825-G-A 11332149-G-A *
9940587-A-T 10102978-A-T FT361940 Y*
13721355-T-C 11565679-T-C *
28812373-T-A 26666226-T-A *
13451055-C-T 11295379-C-T *
13489215-C-T 11333539-C-T *
13460942-T-A 11305266-T-A *
58883954-A-G 56706917-T-C *
13349747-T-G 11194071-T-G *
9447510-TA-T 9609901-TA-T A426A728 10×A*
16051847-TA-T 13939967-TA-T 10×A*
28812375-G-GA 26666228-G-GA *
13709020-T-C 11553344-T-C *
13559135-C-G 11403459-C-G PF586 *
22303673-T-C 20141787-T-C DYZ19 *
9992019-G-C 10154410-G-C Y*
22361968-A-C 20200082-A-C DYZ19 *
14102359-TTCTA-T 11981653-TTCTA-T 9×TCTA*
19393434-T-A 17281554-T-A Z16504Z16505 YY*
10043505-T-C 10205896-T-C *
13467363-C-A 11311687-C-A *
9944021-C-T 10106412-C-T Y*
7484034-G-GA 7615993-G-GA IR1_L 11×A*
22359384-G-C 20197498-G-C DYZ19 *
28790608-GTGGAA-G 26644461-GTGGAA-G 4×TGGAA*
13705060-T-C 11549384-T-C *
23505495-C-CA 21343609-C-CA 23×A*
16715034-GGT-G 14603154-GGT-G 10×GT*
58848143-T-TCCATC 56742718-A-AATGGG *
27087610-GCCTT-G 24941463-GCCTT-G P1_r4 15×CCTT*
13728555-G-A 11572879-G-A *
13480161-C-G 11324485-C-G *
13466174-G-C 11310498-G-C *
13476684-T-C 11321008-T-C *
13719751-C-A 11564075-C-A *
13447536-C-T 11291860-C-T *
24264736-AAC-A 22118589-AAC-A P3_b1 9×AC*
22509928-G-T 20348042-G-T DYZ19 *
13504848-A-G 11349172-A-G *
13461130-A-G 11305454-A-G *
13470989-G-C 11315313-G-C *
6332659-AAC-A 6464618-AAC-A IR3_Dst 8×AC*
22362035-T-G 20200149-T-G DYZ19 *
13466143-G-C 11310467-G-C *
13464524-C-T 11308848-C-T *
13714925-C-G 11559249-C-G BY89613 *
9944168-C-T 10106559-C-T Y*
13482226-G-C 11326550-G-C BY86090 *
9909092-A-G 10071483-A-G Y*
24315773-GA-G 22169626-GA-G P3_t1 11×A*
28693795-A-G 26547648-A-G CTS12757 *
13450995-CCATTCCACTT-C 11295319-CCATTCCACTT-C *
13449696-CTCCAT-C 11294020-CTCCAT-C 11×TCCAT*
58858842-C-T 56732029-G-A *
13483992-A-G 11328316-A-G *
13460649-T-C 11304973-T-C *
9977949-T-G 10140340-T-G Y*
22430791-A-G 20268905-A-G DYZ19 *
13482204-T-C 11326528-T-C *
27290770-CT-C 25144623-CT-C P1_g3 11×T*
22255593-A-T 20093707-A-T BY25031 DYZ19 *
8907405-AT-A 9039364-AT-A 11×T*
22303653-T-C 20141767-T-C DYZ19 *
13482255-C-G 11326579-C-G *
13349644-G-A 11193968-G-A *
13476793-C-G 11321117-C-G *
13480608-A-G 11324932-A-G *
15463403-AT-A 13351523-AT-A 10×T*
22479484-A-C 20317598-A-C DYZ19 *
14395398-GA-G 12274694-GA-G 10×A*
9952470-C-T 10114861-C-T Y*
58978019-CCATTG-C 56831872-CCATTG-C *
25501261-C-CT 23355114-C-CT P2_r2 12×T*
22469979-A-T 20308093-A-T FGC3510 DYZ19 *
13722413-A-G 11566737-A-G *
13489749-C-T 11334073-C-T *
9963199-A-G 10125590-A-G Y*
7567753-C-CTT 7699712-C-CTT 25×T*
3915369-G-A 4047328-G-A FT308096 *
22475181-A-C 20313295-A-C DYZ19 *
9962265-C-CAT 10124656-C-CAT *
4044971-A-T 4176930-A-T FGC81652 *
13384873-T-C 11229197-T-C *
13431841-G-T 11276165-G-T *
16411214-T-TA 14299334-T-TA 11×A*
4319180-CTAGGTAAT-C 4451139-CTAGGTAAT-C *
3945784-G-A 4077743-G-A FGC24596 *
3945705-C-T 4077664-C-T *
13255991-T-C 11100315-T-C *
22477566-T-A 20315680-T-A DYZ19 *
14191088-C-CT 12070382-C-CT 11×T*
13702448-A-G 11546772-A-G *
13299500-T-C 11143824-T-C *
28813902-C-A 26667755-C-A *
2742659-C-CA 2874618-C-CA 12×A*
28813906-T-G 26667759-T-G BY152192 *
18857575-C-CT 16745695-C-CT 15×T*
13699369-T-A 11543693-T-A *
22360561-G-C 20198675-G-C DYZ19 *
8142931-T-C 8274890-T-C PF4660 YY*
13579528-T-C 11423852-T-C *
13256015-C-T 11100339-C-T *
22469330-CAG-C 20307444-CAG-C DYZ19 *
6878971-C-CA 7010930-C-CA 11×A*
17074139-TTG-T 14962259-TTG-T *
21717473-T-TA 19555587-T-TA 10×A*
13299483-G-A 11143807-G-A *
24326954-TACAC-T 22180807-TACAC-T P3_t1 19×AC*
22359440-C-G 20197554-C-G DYZ19 *
3915310-T-G 4047269-T-G *
3800075-CCA-C 3932034-CCA-C 8×CA*
3377471-G-C 3509430-G-C *
3289275-A-G 3421234-A-G *
3010175-C-G 3142134-C-G *
2940479-T-A 3072438-T-A A13668 *
21118158-TACAC-T 18956272-TACAC-T 22×AC*
5123986-CT-C 5255945-CT-C *
5943666-G-C 6075625-G-C *
24392915-C-CT 22246768-C-CT 12×T*
58978993-G-T 56832846-G-T *
5919330-C-CT 6051289-C-CT 10×T*
22237729-T-C 20075843-T-C A3945 DYZ19 *
13482571-T-A 11326895-T-A *
21562049-T-TCACA 19400163-T-TCACA 18×CA*
13467902-AG-A 11312226-AG-A *
13561802-A-G 11406126-A-G *
13481355-G-T 11325679-G-T *
13481642-G-A 11325966-G-A BY86080 *
13481638-C-G 11325962-C-G Z8985 *
13375617-G-A 11219941-G-A *
13375609-G-A 11219933-G-A *
15108916-CTTTT-C 12997003-CTTTT-C 15×T*
13428727-A-C 11273051-A-C *
16196502-G-GA 14084622-G-GA FGC15726 10×A*
13482611-G-C 11326935-G-C *
9423975-G-GA 9586366-G-GA 11×A*
58827280-C-T 56763591-G-A *
58866021-C-CCCATT 56724789-C-CAATGG 12×CCATT*
22366433-G-C 20204547-G-C DYZ19 *
13460530-T-C 11304854-T-C *
13258279-C-G 11102603-C-G *
21221977-TA-T 19060091-TA-T 10×A*
22447640-C-T 20285754-C-T DYZ19 *
9994638-T-C 10157029-T-C Y*
24931540-GA-G 22785393-GA-G g1 10×A*
16305924-CA-C 14194044-CA-C 24×A*
14363164-ATT-A 12242459-ATT-A 16×T*
8702809-TG-T 8834768-TG-T *
13481308-G-T 11325632-G-T *
13351895-T-C 11196219-T-C *
13351889-A-C 11196213-A-C *
13728176-G-A 11572500-G-A *
13484968-T-C 11329292-T-C *
22364734-G-C 20202848-G-C DYZ19 *
22364693-C-T 20202807-C-T DYZ19 *
13465453-A-G 11309777-A-G *
59024001-CAAAAA-C 56877854-CAAAAA-C 18×A*
13475961-A-C 11320285-A-C *
13857542-GATGGA-G 11736836-GATGGA-G 9×ATGGA*
3558246-TA-T 3690205-TA-T 16×A*
14559665-G-GA 12447866-G-GA 10×A*
13435869-T-TG 11280193-T-TG *
22366429-C-A 20204543-C-A DYZ19 *
22366408-G-T 20204522-G-T DYZ19 *
13467436-C-A 11311760-C-A *
22366393-T-G 20204507-T-G DYZ19 *
13461618-T-A 11305942-T-A *
9188597-T-A 9350988-T-A Y*
21200434-T-TA 19038548-T-TA 12×A*
58858835-T-A 56732036-A-T *
15422968-C-CAA 13311088-C-CAA 14×A*
13488044-C-A 11332368-C-A *
22509112-C-A 20347226-C-A DYZ19 *
19048392-T-TAG 16936512-T-TAG 9×AG*
6595244-TCACA-T 6727203-TCACA-T 15×CA*
9909154-T-G 10071545-T-G Y*
13733937-G-T 11578261-G-T *
4317060-T-C 4449019-T-C *
6401064-G-A 6533023-G-A FT326427 *
28717005-G-A 26570858-G-A CTS12832 *
28716998-C-A 26570851-C-A CTS12831 *
21049870-G-GGA 18887984-G-GGA 12×GA*
22311202-G-T 20149316-G-T DYZ19 *
13702433-C-T 11546757-C-T *
13728164-T-C 11572488-T-C *
9215472-A-G 9377863-A-G Y*
13572481-C-T 11416805-C-T *
58985793-G-C 56839646-G-C *
17234926-C-CA 15123046-C-CA 10×A*
10019584-TTC-T 10181975-TTC-T *
22266410-C-G 20104524-C-G BY23241 DYZ19 *
28492932-A-AT 26346785-A-AT 22×T*
27481929-C-CT 25335782-C-CT P1_Y2 9×T*
58883893-C-A 56706978-G-T *
58883892-C-A 56706979-G-T *
13472005-G-A 11316329-G-A *
22311232-T-A 20149346-T-A DYZ19 *
6403276-A-C 6535235-A-C *
13488782-G-A 11333106-G-A *
13489332-G-A 11333656-G-A *
56833683-C-A *
15418589-C-CT 13306709-C-CT 9×T*
13470436-C-A 11314760-C-A *
13469425-G-C 11313749-G-C *
15557469-T-TA 13445589-T-TA 10×A*
13485538-A-T 11329862-A-T *
13488869-C-T 11333193-C-T *
56862621-CT-C 14×T*
8287131-CTT-C 8419090-CTT-C 12×T*
56857500-A-T *
56842387-CTG-C *
28508007-C-CA 26361860-C-CA 14×A*
12786501-CTT-C,CTTT 16×T*
13721675-C-A 11565999-C-A *
23391496-ATTT-A,ATT 21229610-ATTT-A,ATT 20×T*
18249986-T-TA 16138106-T-TA 10×A*
11033913-C-T *
13480429-G-C 11324753-G-C *
13480427-A-AT 11324751-A-AT *
5179543-C-T 5311502-C-T *
24427882-GTT-G 22281735-GTT-G 14×T*
6465537-C-CT 6597496-C-CT 11×T*
5008758-C-CA 5140717-C-CA 11×A*
13488546-C-A 11332870-C-A *
15969956-TAAAA-T 13858076-TAAAA-T 20×A*
10934829-A-T *
13474683-C-T 11319007-C-T *
3940014-G-GT 4071973-G-GT 9×T*
5111539-AT-A 5243498-AT-A 12×T*
13468195-A-T 11312519-A-T *
13474439-C-T 11318763-C-T *
10906068-T-C FT436127 *
10906057-G-A *
10975812-A-T *
10669560-T-A *
13466275-G-C 11310599-G-C *
13468518-C-T 11312842-C-T *
3094131-C-CT 3226090-C-CT 11×T*
4044629-GA-G 4176588-GA-G 11×A*
4370626-CACACACAG-C 4502585-CACACACAG-C *
13480440-C-T 11324764-C-T *
10934841-T-G *
5127076-A-G 5259035-A-G *
7617852-A-AT 7749811-A-AT 10×T*
13462254-T-G 11306578-T-G *
21318477-CAA-C,CA 19156591-CAA-C,CA 19×A*
2919170-CTT-C 3051129-CTT-C 11×T*
10978923-G-C *
13466424-G-A 11310748-G-A *
18931131-GA-G 16819251-GA-G 10×A*
11033698-C-T *
13461076-G-A 11305400-G-A *
22538806-AT-A 20376920-AT-A 10×T*
11027686-T-C *
16948363-CT-C,CTT 14836483-CT-C,CTT 14×T*
7409901-TAA-T,TA 7541860-TAA-T,TA 19×A*
10762758-A-T *
10917966-C-G *
13461259-A-T 11305583-A-T *
5480489-A-AT 5612448-A-AT 11×T*
10671833-A-T *
24520707-GA-G 22374560-GA-G 10×A*
9836888-GTTT-G,GTT 9999279-GTTT-G,GTT 20×T*
13860030-G-C 11739324-G-C *
4577093-CA-C 4709052-CA-C 13×A*
3695724-CAA-C 3827683-CAA-C 14×A*
59003446-T-C 56857299-T-C *
8970861-C-A 9133252-C-A *
10917985-T-C *
10917955-T-G *
8462064-CAAA-C,CAA 8594023-CAAA-C,CAA 26×A*
10917946-C-A *
10917917-G-C *
10917901-A-T *
10917900-G-A *
17048865-TAA-T 14936985-TAA-T 14×A*
13488783-G-T 11333107-G-T *
13468075-C-A 11312399-C-A *
18683522-G-GA 16571642-G-GA 10×A*
13473797-C-CT 11318121-C-CT *
10975818-C-A FT438813 *
10037875-C-A 10200266-C-A *
10748004-G-GCCATT *
10934827-C-T *
7161513-GTT-G 7293472-GTT-G 14×T*
9951537-T-A 10113928-T-A Y*
13468479-A-G 11312803-A-G *
9951463-C-G 10113854-C-G Y*
18728721-G-GAA 16616841-G-GAA 16×A*
13433361-G-A 11277685-G-A *
13487732-C-A 11332056-C-A *
3511839-GT-G 3643798-GT-G 10×T*
13472193-C-G 11316517-C-G *
9109031-A-G *
9109021-C-G *
7608540-TAA-T,TA 7740499-TAA-T,TA 17×A*
3816689-CTT-C 3948648-CTT-C 12×T*
13474754-C-A 11319078-C-A *
10869104-C-G *
24381882-ATT-A 22235735-ATT-A 11×T*
9029736-C-CTT 9192127-C-CTT 16×T*
13489335-A-G 11333659-A-G *
22874563-T-TA 20712677-T-TA 8×A*
10934842-C-G *
10934812-T-G *
56862613-T-C *
56830244-A-T *
13461056-CA-C 11305380-CA-C *
10906109-C-T *
13461071-T-G 11305395-T-G *
13467894-G-C 11312218-G-C *
10669536-T-C *
15956846-C-A 13844966-C-A YY*
10792725-C-CTCCATTCCAT *
13201928-A-G 11046252-A-G *
13722055-G-C 11566379-G-C *
13719245-G-T 11563569-G-T *
7149323-C-CTT 7281282-C-CTT 13×T*
28796906-G-C 26650759-G-C *
19382553-A-AT 17270673-A-AT 9×T*
3134256-G-GA 3266215-G-GA 10×A*
22447684-G-T 20285798-G-T DYZ19 *
28806419-G-T 26660272-G-T *
28806418-G-T 26660271-G-T *
13480861-G-A 11325185-G-A *
13466470-C-A 11310794-C-A *
10653554-C-G *
10987354-A-C *
8666723-GTTT-G,GTT 8798682-GTTT-G,GTT 25×T*
3833256-GA-G 3965215-GA-G 10×A*
13199164-C-CA,CAA 11043488-C-CA,CAA 18×A*
5392022-G-A 5523981-G-A *
4370436-A-G 4502395-A-G FGC76630 *
4390006-GA-G 4521965-GA-G 10×A*
13504498-C-CAAA 11348822-C-CAAA 12×A*
13977178-A-G 11856472-A-G Y*
13977174-T-C 11856468-T-C Y*
13709114-C-G 11553438-C-G *
13691929-A-G 11536253-A-G BY88709 *
13592800-G-C 11437124-G-C *
13577907-T-C 11422231-T-C FGC82309 *
13431857-C-T 11276181-C-T *
13466457-G-A 11310781-G-A *
10974995-A-C *
3015855-G-T 3147814-G-T FGC81639 *
13488829-G-A 11333153-G-A *
13622200-G-A 11466524-G-A *
13354869-A-AC 11199193-A-AC *
4304887-A-G 4436846-A-G FGC81654 *
4042706-C-CT 4174665-C-CT 10×T*
10024258-GTCTC-G 10186649-GTCTC-G *
9944075-G-T 10106466-G-T Y*
13709495-G-A 11553819-G-A *
13489350-T-C 11333674-T-C *
13489160-C-A 11333484-C-A *
13464982-C-A 11309306-C-A *
18036529-G-A 15924649-G-A YY*
13701331-A-T 11545655-A-T *
13462190-C-A 11306514-C-A *
10974997-C-G *
13473870-A-T 11318194-A-T *
13688205-T-A 11532529-T-A *
5393736-GTA-G 5525695-GTA-G *
28644854-CA-C 26498707-CA-C 10×A*
10906096-G-C *
10906083-C-T *
13474563-T-C 11318887-T-C *
13468048-T-C 11312372-T-C *
13239513-C-CT 11083837-C-CT 17×T*
10914242-C-T *
28588184-C-A 26442037-C-A FTB18389 *
4373595-C-CT 4505554-C-CT 10×T*
4468316-C-CA 4600275-C-CA 12×A*
10975000-G-T *
11027690-C-G *
5314565-GGT-G 5446524-GGT-G *
28600580-C-T 26454433-C-T Y*
7383851-C-CA 7515810-C-CA 24×A*
13463619-T-G 11307943-T-G *
13483983-C-A 11328307-C-A *
13474688-T-C 11319012-T-C *
13468572-T-C 11312896-T-C *
15341188-GA-G 13229307-GA-G 9×A*
56860301-T-C *
56860291-C-T *
56860285-G-A *
56860281-C-T *
4752105-TTGTG-T 4884064-TTGTG-T 17×TG*
13461622-C-A 11305946-C-A *
17822240-G-GA 15710360-G-GA 12×A*
13484842-G-T 11329166-G-T *
2765368-GT-G 2897327-GT-G 10×T*
18997791-A-AT 16885911-A-AT 10×T*
3232253-TAA-T 3364212-TAA-T 13×A*
13474567-C-G 11318891-C-G *
13474557-A-G 11318881-A-G *
13474513-C-G 11318837-C-G *
18036553-G-C 15924673-G-C YY*
28611006-A-AT 26464859-A-AT 10×T*
13461124-G-T 11305448-G-T *
18984861-GA-G 16872981-GA-G 10×A*
13475563-A-T 11319887-A-T *
4688020-A-G 4819979-A-G *
10669559-A-T *
13466483-C-A 11310807-C-A *
13466467-C-A 11310791-C-A *
13711701-A-C 11556025-A-C *
13690070-G-T 11534394-G-T *
13503538-T-C 11347862-T-C *
3929953-G-A 4061912-G-A *
10914252-C-A *
13711568-G-A 11555892-G-A *
13489255-A-T 11333579-A-T *
13489254-G-T 11333578-G-T *
13712767-T-A 11557091-T-A *
13694876-C-T 11539200-C-T *
13483369-C-T 11327693-C-T *
4688514-T-C 4820473-T-C *
13477112-C-A 11321436-C-A *
13466481-G-A 11310805-G-A *
8535204-GTTTTT-G 8667163-GTTTTT-G 19×T*
13450120-C-G 11294444-C-G *
4765550-A-AT 4897509-A-AT 10×T*
22917687-CTT-C 20755801-CTT-C 12×T*
13489282-G-T 11333606-G-T *
9909163-TG-T 10071554-TG-T *
9909135-G-T 10071526-G-T Y*
9909120-T-C 10071511-T-C Y*
9909098-C-G 10071489-C-G Y*
13997767-G-T 11877061-G-T YY*
10895813-CTCCAT-C *
27423940-C-A 25277793-C-A P1_g3 *
10934875-T-C *
13466445-G-T 11310769-G-T *
13487735-G-A 11332059-G-A *
13375563-A-G 11219887-A-G *
17679167-T-TA 15567287-T-TA 11×A*
13475803-T-G 11320127-T-G *
16431821-G-GA 14319941-G-GA 10×A*
22510278-T-A 20348392-T-A DYZ19 *
22510271-C-A 20348385-C-A DYZ19 *
9349502-A-C 9511893-A-C Y*
13460539-A-T 11304863-A-T FT371269 *
8274571-CTT-C 8406530-CTT-C 12×T*
13480921-G-A 11325245-G-A *
58905084-T-C 56685787-A-G *
59005360-T-TAA 56859213-T-TAA 8×A*
9919891-T-C 10082282-T-C Y*
22251108-G-C 20089222-G-C DYZ19 *
16076178-T-TA 13964298-T-TA 11×A*
9231698-AACACACACAC-A 9394089-AACACACACAC-A 22×AC*
17130440-G-T 15018560-G-T YY*
13242241-CTTT-C 11086565-CTTT-C 21×T*
7681924-T-TA 7813883-T-TA 14×A*
13697048-T-A 11541372-T-A *
19511876-A-AT 17399996-A-AT 9×T*
9924574-G-C 10086965-G-C Y*
58998408-CA-C 56852261-CA-C *
3256138-A-ATT 3388097-A-ATT 15×T*
13487760-C-T 11332084-C-T *
13487754-C-A 11332078-C-A *
16598677-GAA-G 14486797-GAA-G 19×A*
16345600-G-GA 14233720-G-GA 11×A*
7456724-C-CA 7588683-C-CA IR1_L 15×A*
17346142-C-CT 15234262-C-CT 18×T*
4545124-GAC-G 4677083-GAC-G 12×AC*
5784062-C-CA 5916021-C-CA 21×A*
4227214-T-C 4359173-T-C *
13447486-T-C 11291810-T-C *
22361993-G-T 20200107-G-T DYZ19 *
22361984-G-A 20200098-G-A DYZ19 *
22477102-A-G 20315216-A-G BY53175 DYZ19 *
58833975-T-C 56756896-A-G *
22270047-G-C 20108161-G-C DYZ19 *
7411156-AT-A 7543115-AT-A 8×T*
22314819-A-T 20152933-A-T DYZ19 *
17437793-CT-C 15325913-CT-C 10×T*
9329221-A-C 9491612-A-C Y*
9962270-G-A 10124661-G-A Y*
3088634-G-GA 3220593-G-GA 10×A*
59022943-G-C 56876796-G-C *
22359654-A-T 20197768-A-T DYZ19 *
22359645-T-A 20197759-T-A DYZ19 *
9909137-C-T 10071528-C-T Y*
13462185-G-C 11306509-G-C *
13487808-C-A 11332132-C-A *
13487772-C-A 11332096-C-A *
58833835-T-C 56757036-A-G *
13347726-A-C 11192050-A-C *
13489361-G-T 11333685-G-T *
9962295-G-A 10124686-G-A Y*
3088180-G-T 3220139-G-T FGC69512 *
13447491-T-C 11291815-T-C *
9985006-G-A 10147397-G-A FT258147 Y*
13476612-G-A 11320936-G-A *
13484085-T-A,C 11328409-T-A,C *
13734091-A-G 11578415-A-G 8×GAATG*
13463750-C-T 11308074-C-T *
9949430-C-A 10111821-C-A Y*
9949413-A-T 10111804-A-T Y*
13256044-GTT-G 11100368-GTT-G 12×T*
14468985-CA-C 12348254-CA-C 10×A*
6800941-C-CT 6932900-C-CT 11×T*
13487462-T-G 11331786-T-G *
13477233-G-A 11321557-G-A *
13257510-T-G 11101834-T-G *
13722069-G-A 11566393-G-A *
13489580-C-A 11333904-C-A *
22010462-CAAA-C 19848576-CAAA-C 16×A*
22510257-T-C 20348371-T-C DYZ19 *
22306441-G-A 20144555-G-A DYZ19 *
13476158-A-T 11320482-A-T *
8491157-AC-A 8623116-AC-A 9×C*
21667323-AT-A 19505437-AT-A 10×T*
13347219-A-AT 11191543-A-AT 13×T*
22447656-C-T 20285770-C-T DYZ19 *
8843536-ATTTT-A 8975495-ATTTT-A 23×T*
13487826-C-A 11332150-C-A *
13487816-G-A 11332140-G-A *
13487815-A-T 11332139-A-T *
13489567-C-A 11333891-C-A *
13489589-T-A 11333913-T-A *
13447488-C-G 11291812-C-G *
13467395-T-C 11311719-T-C *
13447474-G-A 11291798-G-A *
22359469-G-A 20197583-G-A DYZ19 *
22237727-T-G 20075841-T-G DYZ19 *
22237724-A-C 20075838-A-C DYZ19 *
25173412-A-AT 23027265-A-AT g1 9×T*
13712047-T-C 11556371-T-C *
13707391-T-G 11551715-T-G *
13692566-A-G 11536890-A-G *
9880201-GT-G 10042592-GT-G BY11427 10×T*
13721186-CGAATG-C 11565510-CGAATG-C 5×GAATG*
13468160-C-G 11312484-C-G *
13468148-G-A 11312472-G-A *
16327271-A-AT 14215391-A-AT 14×T*
13489200-G-A 11333524-G-A *
13695618-G-C 11539942-G-C BY30501 *
13454903-A-G 11299227-A-G *
10043540-A-G 10205931-A-G *
6865459-C-CA 6997418-C-CA 10×A*
8558485-G-GT 8690444-G-GT 9×T*
16330151-A-AT 14218271-A-AT 10×T*
28796824-G-T 26650677-G-T *
13482495-A-C 11326819-A-C *
3295904-T-TA 3427863-T-TA 10×A*
19532725-C-CT 17420845-C-CT 11×T*
14331131-CTTT-C 12210425-CTTT-C 25×T*
23868170-G-GA 21706284-G-GA 10×A*
59002250-CAAAA-C,CA 56856103-CAAAA-C,CA 14×A*
4534300-G-GT 4666259-G-GT 10×T*
13474484-A-C 11318808-A-C *
10954508-C-T *
13474669-A-T 11318993-A-T *
10998801-A-C *
10998793-A-T *
13461054-A-T 11305378-A-T *
11030237-G-T *
2958213-G-GT 3090172-G-GT 11×T*
19352848-G-GT 17240968-G-GT 9×T*
15882074-CAA-C 13770194-CAA-C 25×A*
10954519-T-A *
10954515-G-C *
10954512-T-A *
10655872-ACCATCCCAAT-A *
13463813-C-A 11308137-C-A *
10820969-T-C FT432665 *
28708179-G-GT 26562032-G-GT 9×T*
10934870-T-C *
3867534-GT-G 3999493-GT-G 12×T*
21172165-TA-T,TAA 19010279-TA-T,TAA 12×A*
56685508-G-A *
10939136-G-C *
17482895-GA-G 15371015-GA-G 11×A*
10846861-T-C *
10846852-C-A *
10846850-C-T *
13489765-T-TCG 11334089-T-TCG *
28719854-CT-C 26573707-CT-C 10×T*
10788166-T-G *
22447691-C-T 20285805-C-T DYZ19 *
3537139-A-AT 3669098-A-AT 10×T*
13463774-G-T 11308098-G-T *
18204985-C-CA 16093105-C-CA 23×A*
17332750-CAA-C,CAAA 15220870-CAA-C,CAAA 22×A*
10949583-C-T *
6414948-C-A 6546907-C-A *
10949595-T-G *
10987351-G-T *
10987349-T-C *
10987345-G-A *
10964902-A-C *
2781125-A-AT 2913084-A-AT 10×T*
11033928-T-C *
18556556-CTGTG-C,CTG 16444676-CTGTG-C,CTG 15×TG*
10788180-G-T *
11027688-C-T *
56829747-A-ATTGCATTCCG *
9405663-AT-A 9568054-AT-A 10×T*
13470588-C-T 11314912-C-T *
13476155-G-C 11320479-G-C *
13269589-A-AAAAC 11113913-A-AAAAC *
14827211-TA-T 12715278-TA-T 10×A*
13461077-A-G 11305401-A-G *
16340147-G-GA,GAA 14228267-G-GA,GAA 22×A*
10954503-A-T *
8970862-T-A 9133253-T-A *
10788181-A-T *
11027697-C-T FT85393 *
10678123-A-G *
5987232-CTT-C 6119191-CTT-C 12×T*
10998778-T-A *
4511683-G-GA 4643642-G-GA 10×A*
16558532-GAA-G 14446652-GAA-G 14×A*
10788176-T-G *
10788173-A-C *
10788163-A-C *
10788146-A-T *
3435302-C-CT 3567261-C-CT 11×T*
10987041-C-A *
13468271-G-T 11312595-G-T *
28559376-A-AT 26413229-A-AT 13×T*
17118412-G-T 15006532-G-T YY*
10998782-C-G *
2830969-AT-A 2962928-AT-A 10×T*
56832789-T-TACTCCACTCC *
17726455-C-CA 15614575-C-CA 11×A*
58866174-A-C 56724697-T-G *
22255980-A-G 20094094-A-G DYZ19 *
13471968-C-T 11316292-C-T *
13469919-T-A 11314243-T-A *
13633302-GT-G 11477626-GT-G 11×T*
13476654-G-A 11320978-G-A *
13471975-G-A 11316299-G-A *
17685339-C-CT 15573459-C-CT 10×T*
8973278-G-GA 9135669-G-GA 11×A*
24108403-GT-G 21962256-GT-G P3_b1 12×T*
13616931-T-TA 11461255-T-TA 11×A*
24904674-G-GTT 22758527-G-GTT g1 21×T*
10934863-C-T *
22508554-G-A 20346668-G-A DYZ19 *
13887416-G-GT 11766710-G-GT 10×T*
13461059-C-A 11305383-C-A *
6673834-TAA-T 6805793-TAA-T 10×A*
56850461-G-T *
15823716-A-AT 13711836-A-AT 9×T*
10964903-A-C *
9784808-G-GA 9947199-G-GA 11×A*
10975800-C-G *
10975795-T-C *
10975782-A-T *
58883633-G-A 56707238-C-T *
6878073-CA-C,CAA 7010032-CA-C,CAA 17×A*
17474772-G-GT 15362892-G-GT 11×T*
13499358-T-TA 11343682-T-TA *
10994456-A-C FT439597 *
13476618-G-A 11320942-G-A *
15778648-CTT-C 13666768-CTT-C 15×T*
10671910-C-G *
7237263-GA-G 7369222-GA-G 11×A*
23045471-CAAA-C 20883585-CAAA-C 16×A*
13489768-CCG-C 11334092-CCG-C *
13253199-G-GTT 11097523-G-GTT 14×T*
18653684-CAAA-C 16541804-CAAA-C 20×A*
10949635-T-C *
13487703-C-A 11332027-C-A *
10788149-T-TTTC *
14511558-GAA-G 12399763-GAA-G 11×A*
56885783-G-A *

In the table above, the meaning of the confidence field depends on whether the data comes from an FTDNA kit or an FGC kit. For FTDNA kits, + implies a "PASS" result with just one possible variant, * indicates a "PASS" but with multiple variants, ** indicates "REJECTED" with just a single variant, and *** indicates "REJECTED" with multiple possible variants. 'A*' are heterozygous variants not called by FTDNA, but still pulled from the VCF file. For FGC kits, + indicates over 99% likely genuine (95% for INDELs); * over 95% likely genuine (90% for INDELs); ** about 40% likely genuine; *** about 10% likely genuine. Manual entries read directly from a BAM file will be either + indicating positive, or * indicating that the data show a mixture of possible variants.

For the FTDNA kits, the BED data is encoded in the background color of the cells. Those cells with a white background have coverage, those with a grey background indicate no coverage in the BED file, and those with a pink background indicate the mutation is on the edge of a coverage region. These pink regions often indicate that the individual may be positive for a SNP even if there is no corresponding entry in the vcf file.

The combBED column indicates whether or not the mutation is a SNP and falls in the combBED region defined in Defining a New Rate Constant for Y-Chromosome SNPs based on Full Sequencing Data by Dmitry Adamov, Vladimir Guryanov, Sergey Karzhavin, Vladimir Tagankin, Vadim Urasin.

The McDonald BED column indicates whether or not the mutation is a SNP and falls in the BED region used by Dr. Iain McDonald in the age analysis he does for R-U106 men.

Age Analysis Information (work in progress)

AllMcDonaldYFull
Kit: MI615441563265593671038186367
Used in age calculations1563265593671038186367
Counts of SNPs17477
Variant counts last updated 2022-07-13 03:00:40.



Big Tree Main Page