Tree Position

R-P312/S116 > Z290 > L21/S145 > S552 > DF13 > Z39589 > DF41/S524 > Z43690 > S775 > L746 > Z38845

Unique Mutations

The mutations unique to this man are summarized in the table below. Those with a '+' or '*' confidence level are considered by FamilyTreeDNA or FullGenomesCorp to be high quality SNPs/INDELs. For completeness, all other mutations of lesser confidence are included as well. These additional mutations may be useful for distinguishing between very closely related men.

Occasionally, some of the mutations listed here will be thought to be shared with other men in which case they might appear in upstream blocks on the tree. When this happens, the 'Blocks' field will indicate what block they appear in. Such a situation might arise with BigY men if the BED data suggests another man may be positive for a SNP, even though it doesn't appear in his VCF data. It might also happen if Chromo2 testing or Sanger sequencing of other men not on the tree show the SNP to be shared.

POS-REF-ALT (hg19) POS-REF-ALT (hg38) Blocks Names Region McDonald BED combBED STRBigY3
IN11448
56876124-CAAAAAAAAAAAAAAAAAAAA-C 50×A**
9909190-A-T 10071581-A-T **
19455854-G-A 17343974-G-A FT105863 **
19516773-G-T 17404893-G-T FT105879 **
58916341-C-G 56674530-G-C **
21806931-G-A 19645045-G-A **
9909153-A-T 10071544-A-T **
22435748-G-GATCTTT 20273862-G-GATCTTT DYZ19 **
10052936-A-T 10215327-A-T **
8167615-T-C 8299574-T-C **
13738978-A-G 11583302-A-G **
10908517-G-GTGACACATCTCTGAACTGATCAACCAATTGATGCAACTCT **
13482804-TAA-T 11327128-TAA-T **
11028340-T-TTCACCATTCCATTGCATTCCATTC **
10961481-CTA-C **
13738951-A-AT 11583275-A-AT **
13481463-A-AGAAG 11325787-A-AGAAG **
8613948-A-G 8745907-A-G FT104673 **
7548005-C-A 7679964-C-A FT104507 **
9909164-G-A 10071555-G-A **
13738929-C-T 11583253-C-T **
5306493-A-AT 5438452-A-AT **
12450522-C-CTTT 41×T**
5240981-T-TCCC 5372940-T-TCCC **
6127646-C-CA 6259605-C-CA **
13814741-T-C 11694035-T-C FT104813 **
13738945-G-A 11583269-G-A **
22341456-G-A 20179570-G-A DYZ19 **
7540578-C-A 7672537-C-A FT104506 **
13738870-G-C 11583194-G-C **
13738913-A-T 11583237-A-T **
13738899-C-A 11583223-C-A **
13738900-A-C 11583224-A-C **
3635081-A-C 3767040-A-C **
7039404-C-T 7171363-C-T FT104410 **
16967287-T-A 14855407-T-A **
23672293-T-TGCCCCCCCCCC 21510407-T-TGCCCCCCCCCC **
13738869-C-G 11583193-C-G **
28239-A-C **
9909183-C-G 10071574-C-G **
13461984-G-C 11306308-G-C ***
6874732-A-C 7006691-A-C ***
13462250-A-AAAGCGCCCCCCTCACCCCTTCCCCCTCGCTCCTTTCCTCT 11306574-A-AAAGCGCCCCCCTCACCCCTTCCCCCTCGCTCCTTTCCTCT ***
7405011-TGATAGATA-T,T 7536970-TGATAGATA-T,T 12×GATA***
7414277-C-CAAA 7546236-C-CAAA 27×A***
13462077-C-A 11306401-C-A BY85610 ***
7485256-CT-C,CTT 7617215-CT-C,CTT IR1_L 23×T***
13462000-C-T 11306324-C-T ***
7730430-T-TGATA,TGATAGATA 7862389-T-TGATA,TGATAGATA 11×GATA***
6633960-CT-C 6765919-CT-C 10×T***
13461967-T-G 11306291-T-G ***
8182240-G-T 8314199-G-T ***
8333480-TTTCTTCTTC-T,TTTCTTC 8465439-TTTCTTCTTC-T,TTTCTTC 31×TTC***
13461129-TATAG-T,T 11305453-TATAG-T,T ***
13461106-G-C 11305430-G-C ***
13461059-C-CAA 11305383-C-CAA ***
9303232-T-A 9465623-T-A ***
6784490-A-G 6916449-A-G ***
6402086-A-ACTGGTGTCGTAAAATACTGACGTATATCTAACT 6534045-A-ACTGGTGTCGTAAAATACTGACGTATATCTAACT ***
9320496-TA-T,T 9482887-TA-T,T 10×A***
13465012-G-T 11309336-G-T ***
5812106-A-C 5944065-A-C ***
13465102-T-A 11309426-T-A ***
13465092-G-T 11309416-G-T ***
6043994-A-T 6175953-A-T ***
6091720-AT-A,A 6223679-AT-A,A 28×T***
13465059-G-A 11309383-G-A ***
13465014-G-A 11309338-G-A ***
13464981-C-T 11309305-C-T ***
13463273-G-A 11307597-G-A ***
13464958-A-C 11309282-A-C ***
13464401-T-G 11308725-T-G ***
6329241-T-C 6461200-T-C IR3_Dst ***
13463862-C-G 11308186-C-G ***
13463830-G-T 11308154-G-T ***
13463643-C-A 11307967-C-A ***
6347638-T-C 6479597-T-C ***
9309001-G-T 9471392-G-T ***
9323553-A-C 9485944-A-C ***
13340936-C-T 11185260-C-T ***
13256436-TG-T 11100760-TG-T ***
13373302-A-G 11217626-A-G ***
13373301-C-A 11217625-C-A ***
13204542-GCGA-G 11048866-GCGA-G ***
13373300-T-G 11217624-T-G FTB55205 ***
13204551-A-G 11048875-A-G ***
13239513-CTTTTT-C,CTTTT 11083837-CTTTTT-C,CTTTT 17×T***
13247261-C-A 11091585-C-A ***
13373295-C-T 11217619-C-T ***
13373305-T-C 11217629-T-C ***
13362061-T-TA 11206385-T-TA ***
13347507-C-G 11191831-C-G ***
13256438-TTTTTTG-T 11100762-TTTTTTG-T ***
13263665-G-GCGGGCCCT 11107989-G-GCGGGCCCT ***
13275155-T-TTTTTTTA 11119479-T-TTTTTTTA ***
13338075-C-T 11182399-C-T ***
13340916-C-T 11185240-C-T ***
10942775-C-G ***
10893525-C-CTCCATTCCATTCCATTCCATTCCAT ***
9323558-A-C 9485949-A-C ***
13448633-GCATTCCATTC-G,GCATTC 11292957-GCATTCCATTC-G,GCATTC 13×CATTC***
9345382-G-C 9507773-G-C ***
13461055-GCA-G 11305379-GCA-G ***
9779296-A-C 9941687-A-C ***
13460653-C-G 11304977-C-G ***
9805023-G-T 9967414-G-T ***
13460634-A-G 11304958-A-G ***
13448886-C-CTCCACTCCATTCCAT 11293210-C-CTCCACTCCATTCCAT ***
10043260-A-G 10205651-A-G ***
5781195-T-A 5913154-T-A ***
13375831-T-G 11220155-T-G ***
10666995-GTTCCATTCCA-G,GTTCCA ***
10669335-T-TTTCAC ***
10669341-T-TCCACTCCTC ***
10669359-C-G ***
10669543-C-G ***
10669549-C-CACTCTACTGT ***
13373312-C-T 11217636-C-T FT443351 ***
10669566-T-A ***
4834245-T-TA,TAAA 4966204-T-TA,TAAA 23×A***
5555644-C-CA 5687603-C-CA ***
56845005-TCATTGTG-GCATTGTG,T ***
13253767-T-G 11098091-T-G ***
13253770-C-T 11098094-C-T ***
13375823-G-GC 11220147-G-GC ***
13375857-G-C 11220181-G-C ***
13470437-C-A 11314761-C-A ***
13476693-C-T 11321017-C-T ***
13489843-C-G 11334167-C-G ***
28805415-G-T 26659268-G-T BY227407 ***
28805430-A-G 26659283-A-G ***
13267613-A-AAAG 11111937-A-AAAG ***
13487920-G-A 11332244-G-A ***
56825979-GCATTCCATTCGAGTTCATTCCATTCGAGTTCCTTCCATTCGAGTTCATTCCATTCGAGTT-G ***
9964081-T-A 10126472-T-A ***
10942751-CATTCCAA-C ***
13418481-T-C 11262805-T-C ***
13479090-C-T 11323414-C-T ***
9931536-G-A 10093927-G-A ***
13269588-CAAAA-C 11113912-CAAAA-C ***
13269594-CAAA-C 11113918-CAAA-C ***
13465996-G-C 11310320-G-C ***
10961463-CATCCAT-C ***
9941682-T-C 10104073-T-C ***
10669571-T-C ***
13372671-T-A 11216995-T-A ***
13483351-A-G 11327675-A-G ***
13591575-T-G 11435899-T-G ***
13591578-A-T 11435902-A-T ***
13718311-G-A 11562635-G-A ***
28584050-C-A 26437903-C-A ***
28734648-T-C 26588501-T-C ***
5682773-CAAAA-C 5814732-CAAAA-C 16×A***
9964911-T-G 10127302-T-G ***
10910876-A-G ***
13241544-T-A 11085868-T-A ***
13474004-TGTAC-T 11318328-TGTAC-T ***
13489790-G-T 11334114-G-T ***
9977973-T-TCA 10140364-T-TCA ***
13694705-T-A 11539029-T-A ***
13706130-A-T 11550454-A-T ***
13734768-CTGGAGTGGAATGGATTCAAATGGAATGGCAAGGAATGGAATGGAATGGAATGGAAAGCAAAGGAATCTACTGGAATAGAATCGAACGGAACAGAAAGGAATGGAATGGAA-C 11579092-CTGGAGTGGAATGGATTCAAATGGAATGGCAAGGAATGGAATGGAATGGAATGGAAAGCAAAGGAATCTACTGGAATAGAATCGAACGGAACAGAAAGGAATGGAATGGAA-C ***
28780939-T-C 26634792-T-C ***
28796860-TG-T 26650713-TG-T ***
28797893-CGGTG-C 26651746-CGGTG-C ***
56724881-C-T ***
56834817-C-CTCCACTCCACTCCACTCCAT ***
56871637-T-A ***
9965080-T-A 10127471-T-A ***
13241802-T-A 11086126-T-A ***
13506246-T-TG 11350570-T-TG ***
5430808-CAAAA-C,CAAAAA 5562767-CAAAA-C,CAAAAA 25×A***
3446607-C-CAAAAAAAA 3578566-C-CAAAAAAAA 25×A***
13470223-C-T 11314547-C-T ***
13488576-TCC-T 11332900-TCC-T ***
13488580-A-AAG 11332904-A-AAG ***
13489873-C-T 11334197-C-T ***
22475302-G-C 20313416-G-C DYZ19 ***
2785931-A-G 2917890-A-G ***
2822894-A-C 2954853-A-C ***
2992436-A-ATT 3124395-A-ATT 15×T***
3389066-A-T 3521025-A-T ***
3424497-TA-T 3556456-TA-T 8×A***
3522966-C-A 3654925-C-A ***
56837164-ATTTTGACCTATCTCTGCACTGATCACCCAAGTGATGTAACACTTGACTATGCTCTGCCTATTGGGGCATAGTGACATATCACTGCATTGATCACTCAGATGTTGTAGCTCTTGCCTAGGCTCTGCCTACATGGGCATTGTGACACATCTCTGAACTGATCAACCAAGTGATGTAACCCTTGTCTAGGCTCTGCCTACAGGAGCT-A ***
3804866-A-G 3936825-A-G ***
3967414-G-A 4099373-G-A ***
4076256-CAA-C,CAAA 4208215-CAA-C,CAAA 21×A***
4134890-T-C 4266849-T-C ***
4200055-C-CA,CA 4332014-C-CA,CA 23×A***
4336695-ATTT-A,ATTTTTTTTTT 4468654-ATTT-A,ATTTTTTTTTT 30×T***
4503310-GTATTAT-G,GTATTATTAT 4635269-GTATTAT-G,GTATTATTAT 16×TAT***
13466502-C-T 11310826-C-T ***
4936053-CAA-C,CAAA 5068012-CAA-C,CAAA 26×A***
5064735-A-T 5196694-A-T ***
13462428-T-G 11306752-T-G ***
56832504-C-CTAAAT ***
56835221-C-CTCCATTCCATTCAAT ***
6402986-ATGTATATATTATATTCCTAGGTGTCGTAAAATAACGTCATATATATTATATTTGTACGTGTTGTAAAATACCGACGTATATAGTATAGGTGTCGTGAAATACCG-A 6534945-ATGTATATATTATATTCCTAGGTGTCGTAAAATAACGTCATATATATTATATTTGTACGTGTTGTAAAATACCGACGTATATAGTATAGGTGTCGTGAAATACCG-A ***
28474965-CAA-C,CAAA 26328818-CAA-C,CAAA 18×A***
13473838-T-C 11318162-T-C ***
13954127-AAAT-A,AAATAATAAT 11833421-AAAT-A,AAATAATAAT 12×AAT***
13487946-G-T 11332270-G-T ***
13469159-A-T 11313483-A-T ***
13476577-C-A 11320901-C-A ***
13487901-C-T 11332225-C-T ***
13478373-G-C 11322697-G-C ***
3271443-CCCT-C 3403402-CCCT-C ***
3712813-T-TGTGAGAGAGAGAGAGAGAGAGAGAGAGA 3844772-T-TGTGAGAGAGAGAGAGAGAGAGAGAGAGA ***
13389093-G-GA 11233417-G-GA ***
28586715-T-C 26440568-T-C ***
16013006-T-C 13901126-T-C ***
13444701-A-T 11289025-A-T ***
13463949-T-TA 11308273-T-TA 8×C***
13463952-C-CCCG 11308276-C-CCCG ***
13469527-G-T 11313851-G-T ***
13485974-G-T 11330298-G-T ***
13485977-T-A 11330301-T-A ***
13607558-G-C 11451882-G-C ***
13607561-T-C 11451885-T-C ***
13607564-A-C 11451888-A-C ***
13465956-C-CACCTGTTTGATCAGTGCAGAGATACGTCACAATACCCCCTGTAGGCGGAGCCTAGAAATGAGTTACATA 11310280-C-CACCTGTTTGATCAGTGCAGAGATACGTCACAATACCCCCTGTAGGCGGAGCCTAGAAATGAGTTACATA ***
13468813-A-G 11313137-A-G ***
13466528-C-T 11310852-C-T ***
22472945-CAG-C 20311059-CAG-C DYZ19 ***
21498556-A-G 19336670-A-G ***
21555254-A-T 19393368-A-T ***
21555255-GACT-G 19393369-GACT-G ***
21556919-CTTTT-C,CTTT 19395033-CTTTT-C,CTTT 23×T***
21569958-TAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA-T,T 19408072-TAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA-T,T 46×A***
22298051-C-T 20136165-C-T BY216625 DYZ19 ***
22298058-A-G 20136172-A-G DYZ19 ***
22438804-T-C 20276918-T-C DYZ19 ***
22470511-T-C 20308625-T-C DYZ19 ***
22472942-C-CAT 20311056-C-CAT DYZ19 ***
22475729-A-G 20313843-A-G DYZ19 ***
20242284-A-AT 18080398-A-AT P5_Dst ***
22479481-C-T 20317595-C-T DYZ19 ***
22490805-T-G 20328919-T-G DYZ19 ***
22509639-T-A 20347753-T-A DYZ19 ***
22509672-T-A 20347786-T-A DYZ19 ***
22510226-G-C 20348340-G-C DYZ19 ***
22511240-T-A 20349354-T-A DYZ19 ***
22520788-CAA-C,CAAA 20358902-CAA-C,CAAA 23×A***
22547505-A-G 20385619-A-G ***
22591637-T-A 20429751-T-A ***
22936288-CT-C,CTT 20774402-CT-C,CTT 25×T***
21124028-A-G 18962142-A-G ***
20242281-CA-C 18080395-CA-C P5_Dst ***
23029664-A-G 20867778-A-G FT411285 ***
16170530-A-G 14058650-A-G ***
15260684-CTTT-C,CTTTTTTTTT 13148768-CTTT-C,CTTTTTTTTT 25×T***
15623344-A-G 13511464-A-G ***
15669970-A-C 13558090-A-C ***
15669974-A-G 13558094-A-G ***
15697067-G-A 13585187-G-A ***
15733768-T-C 13621888-T-C ***
15882074-CA-C,CAA 13770194-CA-C,CAA 25×A***
16012780-A-ATT 13900900-A-ATT ***
16012781-A-AAAT 13900901-A-AAAT ***
16066019-A-G 13954139-A-G ***
16301023-T-A 14189143-T-A ***
19423981-T-C 17312101-T-C ***
16305924-CAA-C,CAAA 14194044-CAA-C,CAAA 24×A***
16480585-TA-T 14368705-TA-T ***
16888117-A-C 14776237-A-C ***
17402527-G-T 15290647-G-T ***
17641985-C-G 15530105-C-G ***
17734039-C-CAA 15622159-C-CAA 10×A***
18456789-A-C 16344909-A-C P6_Dst ***
18679925-CA-C,CAA 16568045-CA-C,CAA 25×A***
19178652-G-A 17066772-G-A ***
19239050-TTATC-T,TTATCTATC 17127170-TTATC-T,TTATCTATC 12×TATC***
22972940-G-T 20811054-G-T ***
23086742-C-A 20924856-C-A ***
15151552-A-C 13039639-A-C ***
56842463-T-A ***
56682013-AATGGAATGGAATGGGATGGAATGGT-A ***
56706894-G-A ***
56756886-A-C ***
56826539-AT-A ***
56826816-C-A ***
56833283-C-CTCCATTCCACTCTACTCCCCTCCACTCCACTCCAT ***
56833286-C-CACTCCATTCCACTCTACTCCTCTCCACTCCACTCCATTCCAGTCCACTCCATTACACTCCACTCCATTCCACTCTATTCCCCTCCACTCCACTCCATTCT ***
56834459-A-ACTCCATTCCT ***
56835814-C-CTCCTCTCCATTCCACTCCAG ***
56835940-A-ACTCCACTCAATTCCACTCCACTCAATTCCACTCCACTCTG ***
56848255-C-T ***
28805989-A-G 26659842-A-G ***
56848257-A-G ***
56848275-T-C ***
56848711-ATAT-A ***
56850472-G-C ***
56850805-G-C ***
56850858-T-A ***
56850892-T-A ***
56850908-C-A ***
56857030-C-T ***
56862524-G-T ***
28814979-G-C 26668832-G-C ***
28792514-G-C 26646367-G-C ***
23098816-CAA-C,CAAA 20936930-CAA-C,CAAA 25×A***
25369450-T-G 23223303-T-G P2_r2 ***
23421043-AT-A,ATTT 21259157-AT-A,ATTT 22×T***
23421065-T-C 21259179-T-C ***
23475583-G-A 21313697-G-A ***
23488834-TA-T,TAAAAAA 21326948-TA-T,TAAAAAA 30×A***
23505495-CA-C,CAA 21343609-CA-C,CAA 23×A***
23695833-C-CT 21533947-C-CT ***
23695835-C-T 21533949-C-T ***
24447123-A-AAAAG,AAAAGAAAG 22300976-A-AAAAG,AAAAGAAAG 6×AAAG***
24668035-A-AT 22521888-A-AT P3_b2 9×T***
24910640-T-A 22764493-T-A g1 ***
27022212-T-C 24876065-T-C P1_r4 ***
28791176-TGG-T 26645029-TGG-T ***
27127657-T-TCTTC,TCTTC 24981510-T-TCTTC,TCTTC P1_g3 7×CTTC***
28482891-C-A 26336744-C-A ***
28583946-A-C 26437799-A-C ***
28586704-T-C 26440557-T-C ***
28614714-C-T 26468567-C-T ***
28614729-G-A 26468582-G-A ***
28701031-C-T 26554884-C-T ***
28734638-T-C 26588491-T-C ***
28734639-G-C 26588492-G-C ***
28778852-C-CTTTT 26632705-C-CTTTT 33×T***
15179010-CAAAAAA-C,CAAAAA 13067096-CAAAAAA-C,CAAAAA 25×A***
15080903-C-CA 12968993-C-CA 8×A***
13466530-C-T 11310854-C-T ***
13479151-G-A 11323475-G-A ***
13476743-G-C 11321067-G-C ***
13478462-T-TGAGCTAGGAATAATACTGGGCTCTGCTCCAGGAGCTTTAGGA 11322786-T-TGAGCTAGGAATAATACTGGGCTCTGCTCCAGGAGCTTTAGGA ***
13478993-TCGCA-T 11323317-TCGCA-T ***
13479001-C-CTACT 11323325-C-CTACT ***
13479024-C-A 11323348-C-A ***
13479111-A-T 11323435-A-T ***
13479112-CCA-C 11323436-CCA-C ***
13479115-C-G 11323439-C-G ***
13479134-C-T 11323458-C-T ***
13479138-C-T 11323462-C-T ***
13480123-C-G 11324447-C-G ***
13476482-C-G 11320806-C-G ***
13480384-A-G 11324708-A-G ***
13480855-A-G 11325179-A-G ***
13481378-C-G 11325702-C-G ***
13481387-C-T 11325711-C-T ***
13482122-G-A 11326446-G-A ***
13482124-G-T 11326448-G-T ***
13482129-G-A 11326453-G-A ***
13482145-A-T 11326469-A-T ***
13482332-G-T 11326656-G-T ***
13482393-A-G 11326717-A-G ***
13476515-C-T 11320839-C-T ***
13476475-G-T 11320799-G-T ***
13482854-T-A 11327178-T-A ***
13469944-C-T 11314268-C-T ***
13466536-C-G 11310860-C-G ***
13466580-C-G 11310904-C-G ***
13468326-T-C,G 11312650-T-C,G ***
13468327-C-G 11312651-C-G ***
13468380-T-G 11312704-T-G ***
13468579-C-T 11312903-C-T ***
13389101-T-A 11233425-T-A ***
13468874-G-A 11313198-G-A ***
13469157-ACATCACCTGGGTGATCAGTGCAGAGATATGTCACAATGCCTCCATAGGCAAATCCAAGTTGAGATTCTGTCACCTGTGTGATCAGTGCAGACATATGTGACCATGCCCCCAGTAGGCAGAGCCTAGAGAATAGTCC-A 11313481-ACATCACCTGGGTGATCAGTGCAGAGATATGTCACAATGCCTCCATAGGCAAATCCAAGTTGAGATTCTGTCACCTGTGTGATCAGTGCAGACATATGTGACCATGCCCCCAGTAGGCAGAGCCTAGAGAATAGTCC-A ***
13469435-A-C 11313759-A-C ***
13470023-G-C 11314347-G-C ***
13474728-A-ACT 11319052-A-ACT ***
13470035-C-A 11314359-C-A ***
13470158-AGGG-A 11314482-AGGG-A ***
13470302-C-T 11314626-C-T ***
13472072-C-T 11316396-C-T ***
13473767-T-A 11318091-T-A ***
13473775-G-A 11318099-G-A ***
13473792-A-T 11318116-A-T ***
13473865-C-T 11318189-C-T ***
13474542-A-C 11318866-A-C ***
13474549-C-CAA 11318873-C-CAA ***
13482420-G-C 11326744-G-C ***
13483713-A-C 11328037-A-C ***
14949981-AT-A 12838055-AT-A 9×T***
13730766-T-A 11575090-T-A ***
13544955-G-T 11389279-G-T ***
13557689-C-T 11402013-C-T ***
13563601-TA-T 11407925-TA-T ***
13564940-AATAT-A 11409264-AATAT-A ***
13566191-A-G 11410515-A-G ***
13661292-C-CATGGA,CATGGA 11505616-C-CATGGA,CATGGA ***
13701980-A-C 11546304-A-C ***
13705499-TGGAATGGAATGGAATGGAATGGAA-T 11549823-TGGAATGGAATGGAATGGAATGGAA-T ***
13730110-G-GAAT 11574434-G-GAAT ***
13730111-G-GGAATGGA 11574435-G-GGAATGGA ***
13855522-GATGGA-G,G 11734816-GATGGA-G,G 11×ATGGA***
13542874-G-T 11387198-G-T ***
13962042-CT-C,C 11841336-CT-C,C 28×T***
14025988-G-GAGAAAGAA,GAGAAAGAAAGAA 11905282-G-GAGAAAGAA,GAGAAAGAAAGAA 13×AGAA***
14102275-G-GTCTA,GTCTA 11981569-G-GTCTA,GTCTA 11×TCTA***
14135994-G-A 12015288-G-A ***
14159520-A-G,G 12038814-A-G,G ***
14242365-CATATG-C,C 12121659-CATATG-C,C 10×ATATG***
14411477-T-TA 12290774-T-TA ***
14575194-T-C 12463394-T-C ***
14639069-T-C 12527138-T-C ***
14931684-G-T 12819749-G-T ***
13544873-C-G 11389197-C-G ***
13540251-TAAACAC-T 11384575-TAAACAC-T ***
13483741-G-A 11328065-G-A ***
13489615-A-ACC 11333939-A-ACC ***
13483758-G-C 11328082-G-C ***
13484197-A-C 11328521-A-C ***
13485996-C-G 11330320-C-G ***
13486010-C-A 11330334-C-A ***
13487868-T-A 11332192-T-A ***
13487900-T-C 11332224-T-C ***
13488384-G-T 11332708-G-T ***
13488909-AC-A 11333233-AC-A ***
13489198-G-A 11333522-G-A ***
13489384-G-T 11333708-G-T ***
13489623-C-CAA 11333947-C-CAA ***
13526498-T-C 11370822-T-C ***
13489645-GA-G 11333969-GA-G ***
13489815-C-G 11334139-C-G ***
13489882-C-T 11334206-C-T ***
13489883-A-G 11334207-A-G ***
13497580-AG-A 11341904-AG-A ***
13502884-T-G 11347208-T-G ***
13503420-A-G 11347744-A-G ***
13504721-T-TGAATC 11349045-T-TGAATC ***
13504901-AT-A 11349225-AT-A ***
13524407-T-G 11368731-T-G ***
13476262-A-T 11320586-A-T ***
58981970-T-A 56835823-T-A ***
13251200-A-G 11095524-A-G ***
13365945-G-A 11210269-G-A FGC61955 ***
9868419-T-TA 10030810-T-TA 10×A***
3154138-T-G 3286097-T-G ***
13717960-G-T 11562284-G-T ***
13460640-G-T 11304964-G-T ***
13473794-C-T 11318118-C-T ***
13469117-C-A 11313441-C-A ***
13393204-A-G 11237528-A-G ***
58971460-G-C 56825313-G-C ***
13701978-G-A 11546302-G-A ***
13375563-A-G 11219887-A-G ***
13595434-T-C 11439758-T-C ***
13504920-A-ATTTG 11349244-A-ATTTG ***
5453911-G-T 5585870-G-T ***
27321513-G-GT 25175366-G-GT P1_g3 15×T***
13456422-GCATTC-G 11300746-GCATTC-G 5×CATTC***
7003116-T-A 7135075-T-A ***
13461736-G-A 11306060-G-A ***
19609676-T-G 17497796-T-G P5_Prx ***
13465068-C-A 11309392-C-A ***
59010654-T-A 56864507-T-A ***
22475724-G-T 20313838-G-T DYZ19 ***
22475730-A-G 20313844-A-G DYZ19 ***
13504934-A-T 11349258-A-T ***
22483764-A-G 20321878-A-G DYZ19 ***
13587406-C-CT 11431730-C-CT 9×T***
13537696-G-A 11382020-G-A ***
13347219-AT-A 11191543-AT-A 13×T***
13375826-ATTT-A 11220150-ATTT-A 12×T***
9316196-C-A 9478587-C-A ***
22359444-C-T 20197558-C-T DYZ19 ***
13252749-A-G 11097073-A-G ***
58883812-C-A 56707059-G-T ***
58883834-A-T 56707037-T-A ***
13461321-G-T 11305645-G-T ***
13461369-G-A 11305693-G-A ***
13442447-T-A 11286771-T-A ***
9909147-G-A 10071538-G-A ***
22483758-A-G 20321872-A-G DYZ19 ***
13465036-C-T 11309360-C-T ***
17186760-C-A 15074880-C-A BY112899 ***
22509606-T-G 20347720-T-G FT90132 DYZ19 ***
22509962-A-T 20348076-A-T DYZ19 ***
13728337-A-G 11572661-A-G ***
9929292-T-C 10091683-T-C ***
13279998-CAAAAAAAAA-C 11124322-CAAAAAAAAA-C 26×A***
13392646-G-T 11236970-G-T ***
13489016-C-T 11333340-C-T ***
13489044-G-A 11333368-G-A ***
13730778-G-T 11575102-G-T ***
13513191-T-A 11357515-T-A ***
59030288-C-T 56884141-C-T ***
13461734-A-T 11306058-A-T ***
13725838-T-A 11570162-T-A ***
13472200-G-GAAA 11316524-G-GAAA ***
13481357-G-C 11325681-G-C ***
13488758-T-A 11333082-T-A ***
13484824-C-A 11329148-C-A ***
5772552-CT-C 5904511-CT-C 10×T***
56850870-C-A ***
56850873-G-A ***
2845821-CAAAA-C 2977780-CAAAA-C 28×A***
8403306-C-A 8535265-C-A ***
10942741-C-A ***
20459042-CAAAAA-C 18297156-CAAAAA-C P5_Dst 21×A***
16905870-CAAAA-C,CAAA 14793990-CAAAA-C,CAAA 25×A***
10028170-G-A 10190561-G-A ***
10028171-T-A 10190562-T-A ***
10028173-G-A 10190564-G-A ***
10028176-G-A 10190567-G-A ***
10669559-A-C ***
25395726-G-T 23249579-G-T P2_r2 ***
10789961-ACATTC-A ***
56850384-T-C ***
13246182-G-C 11090506-G-C ***
56880094-T-C ***
13466301-G-T 11310625-G-T ***
13531770-AAAAAAAC-A 11376094-AAAAAAAC-A ***
7464057-G-T 7596016-G-T IR1_L ***
13531772-AAAAAC-A 11376096-AAAAAC-A ***
13489060-G-T 11333384-G-T ***
9360939-G-A 9523330-G-A ***
3899954-CT-C 4031913-CT-C 9×T***
58865974-A-T 56724897-T-A ***
13730139-C-A 11574463-C-A ***
13473862-C-A 11318186-C-A ***
58866192-C-T 56724679-G-A ***
56830319-A-ATTCCACTCCATTCCT ***
13499358-T-TA 11343682-T-TA ***
13472203-CAGA-C 11316527-CAGA-C ***
56850831-G-A ***
13461348-A-G 11305672-A-G ***
10942760-C-G ***
22486973-C-T 20325087-C-T BY47374 DYZ19 ***
7310596-G-T 7442555-G-T ***
10669541-T-C ***
21425339-CTT-C,CTTT 19263453-CTT-C,CTTT 24×T***
13488701-C-CT 11333025-C-CT ***
7671293-GAC-G 7803252-GAC-G ***
10673078-C-A ***
13461365-C-G 11305689-C-G ***
56833327-A-ATTCCAGTCCT ***
13375630-C-A 11219954-C-A ***
59018832-G-T 56872685-G-T ***
13374084-C-G 11218408-C-G ***
13262831-G-A 11107155-G-A ***
4331520-G-T 4463479-G-T ***
4331543-C-A 4463502-C-A ***
4813344-ACT-A 4945303-ACT-A 9×CT***
4870602-CTG-C 5002561-CTG-C 8×TG***
6607744-C-T 6739703-C-T ***
10028180-A-G 10190571-A-G ***
10047855-A-C 10210246-A-C ***
10047859-C-A 10210250-C-A ***
10047900-T-C 10210291-T-C FT63764 ***
13252626-C-T 11096950-C-T ***
13263625-G-A 11107949-G-A ***
4251033-C-CTT 4382992-C-CTT 24×T***
13263834-G-A 11108158-G-A ***
13266437-G-A 11110761-G-A ***
13273603-C-T 11117927-C-T ***
13287944-C-CAT 11132268-C-CAT ***
13287973-A-C 11132297-A-C ***
13287975-A-C 11132299-A-C ***
13354107-T-C 11198431-T-C ***
13362513-AC-A 11206837-AC-A ***
13367671-C-G 11211995-C-G ***
13372633-C-T 11216957-C-T ***
4302918-A-C 4434877-A-C ***
3845315-G-A 3977274-G-A ***
13389065-CTTAGAGTGAGACT-C 11233389-CTTAGAGTGAGACT-C ***
22298052-A-T 20136166-A-T BY16197 DYZ19 ***
23195368-TTGTG-T 21033482-TTGTG-T 14×TG***
13730124-C-G 11574448-C-G ***
8886122-TCA-T 9018081-TCA-T 9×CA***
13378119-G-C 11222443-G-C ***
13378120-C-T 11222444-C-T ***
9299787-T-G 9462178-T-G ***
13256418-A-G 11100742-A-G ***
26454832-T-TCA 24308685-T-TCA P1_Y1 12×CA***
13241794-G-A 11086118-G-A FGC12941 ***
13298062-T-C 11142386-T-C ***
13745274-C-G 11589598-C-G ***
3412067-T-C 3544026-T-C ***
13745377-A-T 11589701-A-T ***
13482884-G-A 11327208-G-A ***
13482879-A-C 11327203-A-C ***
10064281-C-A 10226672-C-A ***
10064277-G-C 10226668-G-C ***
13375617-G-A 11219941-G-A ***
3909109-CAAAA-C 4041068-CAAAA-C 22×A***
13745416-A-T 11589740-A-T ***
13357224-C-T 11201548-C-T ***
3045212-T-G 3177171-T-G ***
13375848-T-G 11220172-T-G ***
13405142-G-T 11249466-G-T 12×T***
59017911-A-C 56871764-A-C ***
28734667-GTGAA-G 26588520-GTGAA-G ***
13405074-G-T 11249398-G-T ***
13405080-A-G 11249404-A-G ***
13466806-A-G 11311130-A-G ***
13466813-C-T 11311137-C-T ***
13479003-G-T 11323327-G-T ***
13502832-A-T 11347156-A-T ***
13508530-T-A 11352854-T-A ***
13545559-T-C 11389883-T-C ***
22425816-G-C 20263930-G-C DYZ19 ***
22509045-C-A 20347159-C-A DYZ19 ***
59005005-C-T 56858858-C-T ***
13404717-G-A 11249041-G-A FGC35345 ***
59005368-A-AG 56859221-A-AG ***
59008043-G-T 56861896-G-T ***
59008502-G-A 56862355-G-A ***
59008525-G-A 56862378-G-A ***
59011484-C-T 56865337-C-T ***
59014005-T-TCC 56867858-T-TCC ***
59014208-T-C 56868061-T-C ***
59014319-G-T 56868172-G-T ***
59015922-G-A 56869775-G-A ***
59017459-T-A 56871312-T-A ***
13405050-G-A 11249374-G-A FT262864 ***
13384404-A-G 11228728-A-G ***
13439635-C-A 11283959-C-A ***
10064309-C-T 10226700-C-T ***
13439647-C-G 11283971-C-G ***
13451591-AT-A 11295915-AT-A ***
13463770-C-CT 11308094-C-CT ***
13482900-C-T 11327224-C-T ***
13545116-G-C 11389440-G-C ***
13567214-A-C 11411538-A-C ***
13567254-A-C 11411578-A-C ***
13640909-G-T 11485233-G-T ***
28734730-ACTGAG-A 26588583-ACTGAG-A ***
59013018-GA-G 56866871-GA-G 10×A***
4331613-A-G 4463572-A-G Y133346 ***
13371129-C-T 11215453-C-T ***
4338467-T-A 4470426-T-A ***
9299763-A-T 9462154-A-T ***
9964126-A-G 10126517-A-G ***
10047828-A-C 10210219-A-C ***
13259230-C-T 11103554-C-T ***
13259378-T-C 11103702-T-C ***
13261213-T-C 11105537-T-C ***
13263674-G-A 11107998-G-A ***
13285559-C-A 11129883-C-A ***
13370232-C-T 11214556-C-T ***
13370269-C-A 11214593-C-A ***
13468271-G-C 11312595-G-C ***
18384490-CA-C,CAA 16272610-CA-C,CAA P6_Gap 19×A***
13241542-C-T 11085866-C-T ***
13481363-C-T 11325687-C-T ***
13372336-G-C 11216660-G-C ***
5987414-C-A 6119373-C-A ***
13404713-A-T 11249037-A-T ***
13444902-C-T 11289226-C-T ***
13525607-G-A 11369931-G-A ***
7003134-A-G 7135093-A-G ***
13509024-C-A 11353348-C-A ***
13733993-A-G 11578317-A-G ***
13733997-G-A 11578321-G-A ***
28780935-C-T 26634788-C-T ***
4331417-T-G 4463376-T-G ***
9964912-T-G 10127303-T-G ***
13411490-C-T 11255814-C-T ***
13538815-T-C 11383139-T-C ***
13688006-C-T 11532330-C-T ***
3930083-CTT-C 4062042-CTT-C 12×T***
9806702-A-G 9969093-A-G ***
19113723-TAA-T,TA 17001843-TAA-T,TA 28×A***
26101391-C-A 23955244-C-A P1_Y1 ***
23544848-T-C 21382962-T-C ***
3501955-CAAA-C,CAA 3633914-CAAA-C,CAA 22×A***
14747961-CTT-C,CTTT 12636030-CTT-C,CTTT 22×T***
13369989-G-A 11214313-G-A ***
27937836-G-T 25791689-G-T P1_Y2 17×A***
18109358-TA-T,TAA 15997478-TA-T,TAA 23×A***
13470198-G-T 11314522-G-T ***
22486969-T-A 20325083-T-A DYZ19 ***
56849959-AC-A ***
10047948-G-A 10210339-G-A ***
10047935-C-A 10210326-C-A ***
10047953-T-A 10210344-T-A ***
10047939-C-T 10210330-C-T ***
56835830-T-C ***
13375669-T-TAA 11219993-T-TAA ***
13468814-A-T 11313138-A-T ***
22512439-GCA-G 20350553-GCA-G DYZ19 ***
14785532-CT-C,CTT 12673602-CT-C,CTT 18×T***
13733982-G-T 11578306-G-T ***
9964409-T-C 10126800-T-C ***
9964424-G-T 10126815-G-T ***
13272774-C-CTT 11117098-C-CTT 13×T***
13375825-T-A 11220149-T-A ***
13375836-T-A 11220160-T-A ***
13375839-G-T 11220163-G-T ***
13497585-T-A 11341909-T-A ***
13542756-C-T 11387080-C-T ***
13551616-G-A 11395940-G-A ***
13564984-C-A 11409308-C-A ***
13718942-C-T 11563266-C-T ***
4067508-CTTTTTT-C 4199467-CTTTTTT-C 29×T***
13523973-C-T 11368297-C-T ***
16545414-CAAAAA-C,CAAAA 14433534-CAAAAA-C,CAAAA 24×A***
22474902-C-CCTT 20313016-C-CCTT DYZ19 ***
22474904-AGAG-A 20313018-AGAG-A DYZ19 ***
13460689-G-T 11305013-G-T ***
14159486-A-T 12038780-A-T 16×TG***
22011557-CA-C,CAA 19849671-CA-C,CAA 21×A***
13479182-G-C 11323506-G-C ***
14331131-CT-C,CTT 12210425-CT-C,CTT 25×T***
22477777-G-T 20315891-G-T BY223891 DYZ19 ***
13577962-G-A 11422286-G-A ***
56864486-G-T ***
13465110-G-T 11309434-G-T ***
15171226-CT-C,CTTT 13059312-CT-C,CTTT 19×T***
17141709-CAA-C,CAAAA 15029829-CAA-C,CAAAA 21×A***
18743552-TTCTATCTA-T,TTCTA 16631672-TTCTATCTA-T,TTCTA 12×TCTA***
6133266-A-G 6265225-A-G ***
13527830-A-T 11372154-A-T ***
13533372-C-A 11377696-C-A ***
8498731-AT-A 8630690-AT-A 10×T***
5781302-GAA-G 5913261-GAA-G 13×A***
22293622-T-A 20131736-T-A DYZ19 ***
13730733-C-T 11575057-C-T ***
10047782-T-C 10210173-T-C ***
22474894-G-T 20313008-G-T DYZ19 ***
8273970-T-C 8405929-T-C ***
13372652-T-C 11216976-T-C ***
9976830-C-A 10139221-C-A ***
13375659-A-C 11219983-A-C ***
13375810-C-A 11220134-C-A ***
13466800-G-A 11311124-G-A ***
56822627-T-A ***
23435682-CT-C,CTT 21273796-CT-C,CTT 21×T***
22479442-A-T 20317556-A-T BY224250 DYZ19 ***
3532154-T-C 3664113-T-C ***
13965269-CA-C,CAA 11844563-CA-C,CAA 21×A***
13296447-A-C 11140771-A-C ***
56724891-A-G ***
13372625-C-T 11216949-C-T ***
28614728-T-C 26468581-T-C ***
13410388-G-C 11254712-G-C ***
13416513-G-C 11260837-G-C ***
13241786-C-A 11086110-C-A ***
13371778-G-T 11216102-G-T ***
13248878-T-C 11093202-T-C ***
22512435-T-TAC 20350549-T-TAC DYZ19 ***
6694444-CTT-C,CTTT 6826403-CTT-C,CTTT 20×T***
28596698-GT-G,GTT 26450551-GT-G,GTT 24×T***
13377870-A-G 11222194-A-G ***
13515252-G-C 11359576-G-C ***
13509219-G-A 11353543-G-A ***
13733975-C-A 11578299-C-A ***
13506614-A-T 11350938-A-T ***
7567753-CTT-C,CTTT 7699712-CTT-C,CTTT 25×T***
56848263-T-G ***
13487853-G-A 11332177-G-A ***
13463684-G-A 11308008-G-A FT443966 ***
13482887-C-A 11327211-C-A ***
13711376-A-T 11555700-A-T ***
13711386-A-T 11555710-A-T ***
9649513-T-C 9811904-T-C IR3_Prx ***
10942770-C-T ***
28651973-TA-T 26505826-TA-T 8×A***
3912233-C-CT 4044192-C-CT 14×T***
58985109-C-G 56838962-C-G ***
13468284-G-A 11312608-G-A ***
13270288-A-ATTTT 11114612-A-ATTTT 10×T***
13204534-C-T 11048858-C-T ***
23070772-CTTTT-C 20908886-CTTTT-C 29×T***
13484951-G-T 11329275-G-T ***
7305240-G-GA 7437199-G-GA 9×A***
58883918-C-T 56706953-G-A ***
18923983-GA-G,GAA 16812103-GA-G,GAA 22×A***
2651873-C-A 2783832-C-A ***
28780940-G-T 26634793-G-T ***
56707072-T-A ***
5742778-GTCTC-G 5874737-GTCTC-G ***
20500942-GAA-G 18339056-GAA-G P5_Dst 15×A***
13445362-CAAA-C 11289686-CAAA-C 15×A***
17634685-T-G 15522805-T-G ***
17641983-G-T 15530103-G-T ***
9985135-G-A 10147526-G-A ***
13474750-T-A 11319074-T-A ***
13711831-A-G 11556155-A-G ***
3031166-A-G 3163125-A-G ***
27264837-T-TA 25118690-T-TA P1_g3 12×A***
13466470-C-A 11310794-C-A ***
10910866-G-C ***
13689325-C-T 11533649-C-T ***
13253777-T-G 11098101-T-G ***
4505414-ATTTT-A 4637373-ATTTT-A 22×T***
3271448-T-C 3403407-T-C ***
22511286-G-T 20349400-G-T DYZ19 ***
6080638-TTCTC-T 6212597-TTCTC-T 9×TC***
13469970-G-C 11314294-G-C ***
13460835-A-G 11305159-A-G ***
13466370-G-T 11310694-G-T ***
13468268-A-T 11312592-A-T ***
17784271-CTT-C 15672391-CTT-C 13×T***
13488813-C-A 11333137-C-A ***
13462190-C-A 11306514-C-A ***
13438425-T-A 11282749-T-A ***
22510171-T-A 20348285-T-A DYZ19 ***
13489635-ACC-A 11333959-ACC-A ***
3915436-TA-T 4047395-TA-T 9×A***
13465019-G-A 11309343-G-A ***
13498780-A-G 11343104-A-G ***
13405194-G-T 11249518-G-T ***
13405196-C-A 11249520-C-A ***
13405203-A-G 11249527-A-G ***
13405218-G-A 11249542-G-A ***
13418460-C-T 11262784-C-T ***
13439247-A-G 11283571-A-G ***
13439610-A-T 11283934-A-T ***
13460636-A-T 11304960-A-T ***
13484394-C-T 11328718-C-T ***
13487912-C-T 11332236-C-T ***
13498786-C-G 11343110-C-G ***
13405066-G-A 11249390-G-A ***
13540248-C-T 11384572-C-T ***
13540422-T-C 11384746-T-C ***
13556901-A-T 11401225-A-T ***
13706265-A-G 11550589-A-G ***
13745304-A-G 11589628-A-G 7×GAATG***
28804209-A-C 26658062-A-C ***
56838924-G-A ***
9961067-A-T 10123458-A-T ***
10047804-A-C 10210195-A-C ***
13375804-A-G 11220128-A-G ***
13405157-T-C 11249481-T-C ***
13405045-T-C 11249369-T-C ***
13500082-C-A 11344406-C-A ***
9977974-G-GTT 10140365-G-GTT ***
13465128-T-C 11309452-T-C ***
6858592-CT-C,CTT 6990551-CT-C,CTT 25×T***
13489707-A-T 11334031-A-T ***
10669530-ATTCCATTCCATTCCG-A ***
13462049-C-A 11306373-C-A ***
13509102-C-T 11353426-C-T ***
10669548-C-T ***
56848258-C-G ***
56848279-A-C ***
9964061-C-G 10126452-C-G ***
13488714-C-CA 11333038-C-CA ***
13405035-A-G 11249359-A-G ***
20025461-C-G 17913581-C-G P5_Prx ***
13466483-C-T 11310807-C-T ***
18255888-TAAA-T,TAAAA 16144008-TAAA-T,TAAAA 22×A***
13466001-C-T 11310325-C-T ***
13378444-A-ATT 11222768-A-ATT 12×T***
9940801-T-C 10103192-T-C ***
10669346-T-C ***
13248839-G-A 11093163-G-A BY16313 ***
13248847-T-C 11093171-T-C ***
13375625-C-T 11219949-C-T ***
13405030-T-C 11249354-T-C ***
13204533-G-A 11048857-G-A ***

In the table above, the meaning of the confidence field depends on whether the data comes from an FTDNA kit or an FGC kit. For FTDNA kits, + implies a "PASS" result with just one possible variant, * indicates a "PASS" but with multiple variants, ** indicates "REJECTED" with just a single variant, and *** indicates "REJECTED" with multiple possible variants. 'A*' are heterozygous variants not called by FTDNA, but still pulled from the VCF file. For FGC kits, + indicates over 99% likely genuine (95% for INDELs); * over 95% likely genuine (90% for INDELs); ** about 40% likely genuine; *** about 10% likely genuine. Manual entries read directly from a BAM file will be either + indicating positive, or * indicating that the data show a mixture of possible variants.

For the FTDNA kits, the BED data is encoded in the background color of the cells. Those cells with a white background have coverage, those with a grey background indicate no coverage in the BED file, and those with a pink background indicate the mutation is on the edge of a coverage region. These pink regions often indicate that the individual may be positive for a SNP even if there is no corresponding entry in the vcf file.

The combBED column indicates whether or not the mutation is a SNP and falls in the combBED region defined in Defining a New Rate Constant for Y-Chromosome SNPs based on Full Sequencing Data by Dmitry Adamov, Vladimir Guryanov, Sergey Karzhavin, Vladimir Tagankin, Vadim Urasin.

The McDonald BED column indicates whether or not the mutation is a SNP and falls in the BED region used by Dr. Iain McDonald in the age analysis he does for R-U106 men.

Age Analysis Information (work in progress)

AllMcDonaldYFull
Kit: IN114481593828994845548342469
Used in age calculations1593828994845548342469
Counts of SNPs00
Variant counts last updated 2021-12-29 19:38:46.



Big Tree Main Page