Powers

BigY3: MK65186

Tree Position

R-P312/S116 > Z40481 > ZZ11 > DF27/S250 > Z195/S355 > Z272 > BY907 > S1322 > BY1206

Unique Mutations

The mutations unique to this man are summarized in the table below. Those with a '+' or '*' confidence level are considered by FamilyTreeDNA or FullGenomesCorp to be high quality SNPs/INDELs. For completeness, all other mutations of lesser confidence are included as well. These additional mutations may be useful for distinguishing between very closely related men.

Occasionally, some of the mutations listed here will be thought to be shared with other men in which case they might appear in upstream blocks on the tree. When this happens, the 'Blocks' field will indicate what block they appear in. Such a situation might arise with BigY men if the BED data suggests another man may be positive for a SNP, even though it doesn't appear in his VCF data. It might also happen if Chromo2 testing or Sanger sequencing of other men not on the tree show the SNP to be shared.

POS-REF-ALT (hg19) POS-REF-ALT (hg38) Blocks Names Region McDonald BED combBED STRBigY3
MK65186
3620514-A-T 3752473-A-T A+
13488435-G-A 11332759-G-A A*
28816786-C-T 26670639-C-T A*
28790506-G-T 26644359-G-T A*
13204394-G-A 11048718-G-A A*
22232105-T-G 20070219-T-G DYZ19 A*
13451478-C-T 11295802-C-T A*
6220585-A-T 6352544-A-T IR3_Dst A*
20037469-G-A 17925589-G-A P5_Prx A*
25583310-G-A 23437163-G-A P1_gr1 A*
25973313-T-A 23827166-T-A P1_Y1 A*
3211988-A-C 3343947-A-C FT45636 +
2888559-C-A 3020518-C-A BY174553 YY+
3282268-C-G 3414227-C-G FT394884 +
4447810-A-T 4579769-A-T FT197785 +
4505914-T-G 4637873-T-G FT197793 +
5100345-A-G 5232304-A-G FT395131 +
6647328-T-C 6779287-T-C BY174565 YY+
7472817-A-G 7604776-A-G FT395409 IR1_L +
7800202-G-T 7932161-G-T BY174570 YY+
9008336-G-A 9170727-G-A BY174562 Y+
11667723-T-C FT225475 +
14020443-T-A 11899737-T-A FT395738 YY+
14151066-T-G 12030360-T-G BY174563 YY+
14261747-A-C 12141041-A-C BY174561 YY+
14296891-G-T 12176185-G-T FT245909 YY+
14363325-G-A 12242620-G-A FT21304 YY+
14418466-C-T 12297741-C-T BY174560 YY+
15039263-A-G 12927353-A-G BY174552 YY+
16438073-G-C 14326193-G-C BY174567 YY+
16476710-C-T 14364830-C-T YY+
16532045-TC-T 14420165-TC-T +
17077307-T-A 14965427-T-A BY174569 YY+
17194148-A-G 15082268-A-G BY174557 YY+
17313920-G-A 15202040-G-A FT396179 YY+
17328450-G-A 15216570-G-A BY174554 YY+
17386201-G-C 15274321-G-C FT199113 YY+
17386204-A-G 15274324-A-G FT199114 YY+
17386207-A-G 15274327-A-G FT199115 YY+
17879803-C-A 15767923-C-A BY174556 YY+
17985663-T-C 15873783-T-C BY174566 Y+
18075870-C-T 15963990-C-T BY174558 YY+
19157273-G-A 17045393-G-A BY174555 YY+
20473224-GTGA-G 18311338-GTGA-G P5_Dst +
21342060-C-T 19180174-C-T BY174568 YY+
22272746-G-A 20110860-G-A BY215451 DYZ19 +
28497296-T-A 26351149-T-A FT396926 Y+
18639018-A-AGT 16527138-A-AGT 26×GT*
5841991-T-A 5973950-T-A *
11000397-GCATTCCATTC-G *
13448795-ACTCCG-A,ATTCCACTCCACTCCAGTCCG 11293119-ACTCCG-A,ATTCCACTCCACTCCAGTCCG *
10985201-C-CTCCAT *
9094876-A-ATG 9257267-A-ATG *
56843155-G-A *
21287967-CTTTT-C 19126081-CTTTT-C 16×T**
28793802-T-G 26647655-T-G **
13453505-A-G 11297829-A-G **
23315936-C-T 21154050-C-T **
7058019-CTT-C 7189978-CTT-C 11×T**
23315917-A-G 21154031-A-G FGC55771 **
17386185-C-G 15274305-C-G **
23315904-G-A 21154018-G-A **
27967321-C-A 25821174-C-A P1_Y2 **
3303379-GTCTA-G 3435338-GTCTA-G 4×TCTA**
3836918-G-GAA 3968877-G-GAA 9×A**
17028712-A-T 14916832-A-T **
4025906-A-G 4157865-A-G **
4247324-T-C 4379283-T-C **
5602858-T-G 5734817-T-G FT422061 **
6592401-C-T 6724360-C-T **
7061705-G-T 7193664-G-T **
7966706-A-T 8098665-A-T **
8062705-A-G 8194664-A-G **
8237104-G-A 8369063-G-A **
9063132-G-A 9225523-G-A **
15160416-T-G 13048502-T-G **
16570523-C-A 14458643-C-A **
17386191-G-A 15274311-G-A FT199112 **
18058534-A-T 15946654-A-T FT199234 **
20486251-A-AAG 18324365-A-AAG P5_Dst **
21124617-G-A 18962731-G-A FTB55172 **
21602039-G-A 19440153-G-A **
21761275-G-T 19599389-G-T ***
13479209-T-C 11323533-T-C ***
13479211-G-C 11323535-G-C ***
14850651-C-T 12738717-C-T PR1577 ***
4673338-C-A 4805297-C-A ***
22115103-G-A 19953217-G-A YSC0000272 ***
21824255-C-CA 19662369-C-CA 30×A***
5062473-C-CA 5194432-C-CA 21×A***
21146275-CT-C,CTT 18984389-CT-C,CTT 17×T***
6878073-CAA-C,CA 7010032-CAA-C,CA 17×A***
14774253-CTTT-C 12662322-CTTT-C 28×T***
22722112-GA-G 20560226-GA-G 10×A***
21133556-CAAAAAA-C 18971670-CAAAAAA-C 23×A***
13488403-C-A 11332727-C-A ***
13488428-G-T 11332752-G-T ***
2708411-CGAGAGA-C,CGA 2840370-CGAGAGA-C,CGA 23×GA***
15248764-GA-G,GAA 13136850-GA-G,GAA 12×A***
4742850-GT-G 4874809-GT-G 10×T***
28720132-CTTTTT-C 26573985-CTTTTT-C 24×T***
13488401-G-A 11332725-G-A ***
4067508-CTTTT-C 4199467-CTTTT-C 29×T***
14196153-A-C 12075447-A-C ***
13448564-A-C,T 11292888-A-C,T ***
28801449-A-AGTAG 26655302-A-AGTAG ***
13488414-C-A 11332738-C-A ***
13488460-C-T 11332784-C-T ***
13488383-A-T 11332707-A-T ***
14850631-G-T 12738697-G-T ***
14570756-ATTTTT-A,ATTTT 12458956-ATTTTT-A,ATTTT 22×T***
25524684-G-T 23378537-G-T P1_gr1 ***
2942001-A-G 3073960-A-G ***
3792465-A-G 3924424-A-G ***
4408776-C-A 4540735-C-A ***
4745787-T-C 4877746-T-C ***
4899211-T-C 5031170-T-C ***
5871970-C-T 6003929-C-T ***
5871973-TGG-T 6003932-TGG-T ***
7021585-A-G 7153544-A-G ***
7436295-A-G 7568254-A-G ***
8058452-CTTTT-C,CTTT 8190411-CTTTT-C,CTTT 15×T***
9919246-T-C 10081637-T-C ***
13437920-C-T 11282244-C-T ***
13696727-G-A 11541051-G-A ***
14850628-C-T 12738694-C-T ***
15385807-T-C 13273927-T-C ***
15993733-A-C 13881853-A-C ***
17983712-A-G 15871832-A-G ***
18247038-T-C 16135158-T-C ***
19422079-A-G 17310199-A-G ***
20968191-T-A 18806305-T-A P4_Dst ***
22223133-G-A 20061247-G-A DYZ19 ***
22641686-G-A 20479800-G-A ***
22970070-G-T 20808184-G-T ***
23090047-G-GA 20928161-G-GA 9×A***
23730374-TTGTGTG-T,TTG 21568488-TTGTGTG-T,TTG 14×TG***

In the table above, the meaning of the confidence field depends on whether the data comes from an FTDNA kit or an FGC kit. For FTDNA kits, + implies a "PASS" result with just one possible variant, * indicates a "PASS" but with multiple variants, ** indicates "REJECTED" with just a single variant, and *** indicates "REJECTED" with multiple possible variants. 'A*' are heterozygous variants not called by FTDNA, but still pulled from the VCF file. For FGC kits, + indicates over 99% likely genuine (95% for INDELs); * over 95% likely genuine (90% for INDELs); ** about 40% likely genuine; *** about 10% likely genuine. Manual entries read directly from a BAM file will be either + indicating positive, or * indicating that the data show a mixture of possible variants.

For the FTDNA kits, the BED data is encoded in the background color of the cells. Those cells with a white background have coverage, those with a grey background indicate no coverage in the BED file, and those with a pink background indicate the mutation is on the edge of a coverage region. These pink regions often indicate that the individual may be positive for a SNP even if there is no corresponding entry in the vcf file.

The combBED column indicates whether or not the mutation is a SNP and falls in the combBED region defined in Defining a New Rate Constant for Y-Chromosome SNPs based on Full Sequencing Data by Dmitry Adamov, Vladimir Guryanov, Sergey Karzhavin, Vladimir Tagankin, Vadim Urasin.

The McDonald BED column indicates whether or not the mutation is a SNP and falls in the BED region used by Dr. Iain McDonald in the age analysis he does for R-U106 men.