Hussey

BigY3: IN62476
MDKA Birth: Ireland > County Kerry

Tree Position

R-P312/S116 > Z46521 > Z46516 > ZZ11 > DF27/S250 > ZZ12 > Z46512 > FGC78762

Unique Mutations

The mutations unique to this man are summarized in the table below. Those with a '+' or '*' confidence level are considered by FamilyTreeDNA or FullGenomesCorp to be high quality SNPs/INDELs. For completeness, all other mutations of lesser confidence are included as well. These additional mutations may be useful for distinguishing between very closely related men.

Occasionally, some of the mutations listed here will be thought to be shared with other men in which case they might appear in upstream blocks on the tree. When this happens, the 'Blocks' field will indicate what block they appear in. Such a situation might arise with BigY men if the BED data suggests another man may be positive for a SNP, even though it doesn't appear in his VCF data. It might also happen if Chromo2 testing or Sanger sequencing of other men not on the tree show the SNP to be shared.

Position Blocks Names Region McDonald BED combBED STRBigY3
IN62476
hg19:Y:22313707-G-T hg38:Y:20151821-G-T Z16372 DYZ19 A*
hg19:Y:26072829-C-CA hg38:Y:23926682-C-CA Z16372 P1_Y1 A*
hg19:Y:20636070-G-A hg38:Y:18474184-G-A Z16372BY3043 P4_Prx A*
hg19:Y:6110997-C-T hg38:Y:6242956-C-T A*
hg19:Y:6343890-T-C hg38:Y:6475849-T-C A*
hg19:Y:19722007-G-A hg38:Y:17610127-G-A P5_Prx A*
hg19:Y:6219837-C-T hg38:Y:6351796-C-T IR3_Dst A*
hg19:Y:13687271-A-G hg38:Y:11531595-A-G DYZ17 A*
hg19:Y:19614428-A-G hg38:Y:17502548-A-G P5_Prx YA*
hg19:Y:19761105-A-G hg38:Y:17649225-A-G P5_Prx A*
hg19:Y:20665199-T-C hg38:Y:18503313-T-C P4_Prx A*
hg19:Y:25888560-A-G hg38:Y:23742413-A-G P1_Y1 A*
hg19:Y:26320260-C-T hg38:Y:24174113-C-T P1_Y1 A*
hg19:Y:26393146-G-T hg38:Y:24246999-G-T P1_Y1 A*
hg19:Y:26393147-T-G hg38:Y:24247000-T-G P1_Y1 A*
hg19:Y:26393148-A-AG hg38:Y:24247001-A-AG P1_Y1 A*
hg19:Y:26393150-A-T hg38:Y:24247003-A-T P1_Y1 A*
hg19:Y:28790912-T-G hg38:Y:26644765-T-G A*
hg19:Y:15654428-C-G hg38:Y:13542548-C-G L21/S145L21 S145 M529 YY+
hg19:Y:22200784-C-G hg38:Y:20038898-C-G Z290S245 Z245 YY+
hg19:Y:24411932-G-T hg38:Y:22265785-G-T Z290Z260 Y+
hg19:Y:28632468-G-C hg38:Y:26486321-G-C Z290S461 Z290 Y+
hg19:Y:5818205-T-C hg38:Y:5950164-T-C L513/S215/DF1S279 Z249 +
hg19:Y:7340450-C-T hg38:Y:7472409-C-T L513/S215/DF1DF1 L513 S215 YY+
hg19:Y:16250226-T-C hg38:Y:14138346-T-C L513/S215/DF1CTS5396 S5196 YY+
hg19:Y:20832490-T-G hg38:Y:18670604-T-G L513/S215/DF1S5191 P4_Gap +
hg19:Y:22438184-C-G hg38:Y:20276298-C-G L513/S215/DF1S5197 DYZ19 +
hg19:Y:3436073-T-C hg38:Y:3568032-T-C S6365S6365 +
hg19:Y:21128270-A-T hg38:Y:18966384-A-T Z16361Z16361 BY16 Y3553 YY+
hg19:Y:2850547-A-G hg38:Y:2982506-A-G Z16372Z16372 YY+
hg19:Y:8360944-G-A hg38:Y:8492903-G-A Z16372Z16373 YY+
hg19:Y:9142090-C-G hg38:Y:9304481-C-G Z16372Z16374 Y+
hg19:Y:10018618-T-A hg38:Y:10181009-T-A Z16372BY2957 Y+
hg19:Y:13496014-G-A hg38:Y:11340338-G-A Z16372Z16375 +
hg19:Y:15550557-A-G hg38:Y:13438677-A-G Z16372Z16376 YY+
hg19:Y:16525910-G-T hg38:Y:14414030-G-T Z16372Z16377 YY+
hg19:Y:16719156-A-C hg38:Y:14607276-A-C Z16372Z16378 YY+
hg19:Y:17178460-T-C hg38:Y:15066580-T-C Z16372Z16379 YY+
hg19:Y:18666335-G-T hg38:Y:16554455-G-T Z16372Z16380 YY+
hg19:Y:18931336-C-T hg38:Y:16819456-C-T Z16372Z16381 YY+
hg19:Y:19265620-A-G hg38:Y:17153740-A-G Z16372Z16382 YY+
hg19:Y:19473152-A-G hg38:Y:17361272-A-G Z16372Z16383 YY+
hg19:Y:6383816-G-A hg38:Y:6515775-G-A Z16372Z17910 +
hg19:Y:8425899-A-G hg38:Y:8557858-A-G Z18079Z18079 BY182 YY+
hg19:Y:9734880-C-T hg38:Y:9897271-C-T Z18080Z18080 BY183 IR3_Prx +
hg19:Y:18816002-C-T hg38:Y:16704122-C-T Z18080Z18081 BY184 YY+
hg19:Y:22212180-A-C hg38:Y:20050294-A-C Z16372FGC31781 Y+
hg19:Y:5535667-C-T hg38:Y:5667626-C-T S5193 +
hg19:Y:3300069-A-G hg38:Y:3432028-A-G FGC9796 +
hg19:Y:16369090-TCAGCTGCCA-T hg38:Y:14257210-TCAGCTGCCA-T Z16372 +
hg19:Y:13995496-C-T hg38:Y:11874790-C-T FGC75765 Y+
hg19:Y:14418688-C-T hg38:Y:12297963-C-T BY1089 YY+
hg19:Y:14986891-T-A hg38:Y:12874957-T-A A10528Y21576 YY8×A+
hg19:Y:7134251-C-T hg38:Y:7266210-C-T Z16372BY152540 YY+
hg19:Y:17498842-G-A hg38:Y:15386962-G-A Z16372BY115276 YY+
hg19:Y:18194478-C-G hg38:Y:16082598-C-G Z16372FT3100 YY+
hg19:Y:21895134-GA-G hg38:Y:19733248-GA-G +
hg19:Y:2794164-A-G hg38:Y:2926123-A-G BY56429 YY+
hg19:Y:6802750-T-C hg38:Y:6934709-T-C BY61408 YY+
hg38:Y:10782254-A-T FT430970 +
hg19:Y:14317569-G-T hg38:Y:12196863-G-T BY94785 YY+
hg19:Y:15911323-G-A hg38:Y:13799443-G-A BY104870 YY+
hg19:Y:17335169-G-A hg38:Y:15223289-G-A BY113927 YY+
hg19:Y:18871239-A-G hg38:Y:16759359-A-G BY124416 YY+
hg19:Y:19262820-A-G hg38:Y:17150940-A-G BY127751 YY+
hg19:Y:19829535-G-A hg38:Y:17717655-G-A BY211982 P5_Prx +
hg19:Y:22561470-A-G hg38:Y:20399584-A-G YY+
hg19:Y:28550420-G-A hg38:Y:26404273-G-A Z16372FT6568 +
hg19:Y:14224221-G-A hg38:Y:12103515-G-A FT150984 YY+
hg19:Y:22924740-G-A hg38:Y:20762854-G-A FT284644 YY+
hg19:Y:3058275-A-G hg38:Y:3190234-A-G Z16372FT2418 +
hg19:Y:3080484-G-A hg38:Y:3212443-G-A Z16372FT2419 +
hg19:Y:3812144-T-A hg38:Y:3944103-T-A Z16372FT2489 +
hg19:Y:4345975-G-C hg38:Y:4477934-G-C Z16372FT2534 +
hg19:Y:4454323-C-T hg38:Y:4586282-C-T Z16372FT2546 +
hg19:Y:5397864-T-C hg38:Y:5529823-T-C Z16372FT2637 +
hg19:Y:6043578-C-T hg38:Y:6175537-C-T Z16372FT2699 +
hg19:Y:9437095-G-A hg38:Y:9599486-G-A Z16372FT2843 YY+
hg19:Y:3586174-A-G hg38:Y:3718133-A-G FT127952 +
hg19:Y:5122165-G-C hg38:Y:5254124-G-C FT120885 +
hg19:Y:5122253-T-C hg38:Y:5254212-T-C FT120886 +
hg38:Y:10782600-A-T FT430985 +
hg38:Y:10830408-ATCCAC-A +
hg19:Y:2695542-C-G hg38:Y:2827501-C-G FT150335 YY+
hg19:Y:3753544-C-T hg38:Y:3885503-C-T FT94307 +
hg19:Y:3770573-T-C hg38:Y:3902532-T-C FT150429 +
hg19:Y:5235142-G-C hg38:Y:5367101-G-C FT150590 +
hg19:Y:5410428-G-A hg38:Y:5542387-G-A FT150605 +
hg19:Y:6074021-A-G hg38:Y:6205980-A-G FT150663 +
hg19:Y:6084354-CAATA-C hg38:Y:6216313-CAATA-C +
hg19:Y:6717423-T-A hg38:Y:6849382-T-A FT150697 YY+
hg19:Y:8979591-G-A hg38:Y:9141982-G-A FT150877 Y+
hg38:Y:10757105-C-T FT390129 +
hg38:Y:10869621-A-G FT434839 +
hg19:Y:13399702-G-T hg38:Y:11244026-G-T FT443486 +
hg19:Y:13662785-T-A hg38:Y:11507109-T-A FT447577 DYZ17 +
hg19:Y:13845187-A-G hg38:Y:11724481-A-G FT150928 DYZ17 +
hg19:Y:14089478-A-G hg38:Y:11968772-A-G FT150975 Y+
hg19:Y:14312774-C-G hg38:Y:12192068-C-G FT150994 YY+
hg19:Y:14423611-A-G hg38:Y:12302886-A-G FT151023 YY+
hg19:Y:14559285-A-G hg38:Y:12447486-A-G FT151036 YY+
hg19:Y:15415541-C-T hg38:Y:13303661-C-T FT151105 YY+
hg19:Y:15554026-G-A hg38:Y:13442146-G-A FT151119 YY+
hg19:Y:15598424-C-G hg38:Y:13486544-C-G FT151126 Y+
hg19:Y:16205053-G-A hg38:Y:14093173-G-A FT151168 YY+
hg19:Y:16292900-A-C hg38:Y:14181020-A-C FT151179 YY+
hg19:Y:16664559-A-T hg38:Y:14552679-A-T FT151214 Y+
hg19:Y:16671881-G-A hg38:Y:14560001-G-A FT151215 YY+
hg19:Y:16835880-A-G hg38:Y:14724000-A-G FT151234 YY+
hg19:Y:17186380-G-A hg38:Y:15074500-G-A FT151250 YY+
hg19:Y:17341823-G-C hg38:Y:15229943-G-C FT151262 YY+
hg19:Y:17419218-T-C hg38:Y:15307338-T-C FT151274 YY+
hg19:Y:17874345-T-TA hg38:Y:15762465-T-TA +
hg19:Y:18607182-C-A hg38:Y:16495302-C-A FT151357 YY+
hg19:Y:18613291-A-C hg38:Y:16501411-A-C FT151359 YY+
hg19:Y:18720056-T-A hg38:Y:16608176-T-A FT151368 YY+
hg19:Y:19070238-G-T hg38:Y:16958358-G-T FT151411 YY+
hg19:Y:20832354-T-G hg38:Y:18670468-T-G FT283934 P4_Gap +
hg19:Y:21105083-T-C hg38:Y:18943197-T-C FT151452 YY+
hg19:Y:22460434-G-A hg38:Y:20298548-G-A DYZ19 +
hg19:Y:23747592-G-A hg38:Y:21585706-G-A FT3269 Y+
hg19:Y:23755634-C-A hg38:Y:21593748-C-A FT151622 Y+
hg19:Y:24001692-C-G hg38:Y:21855545-C-G FT332714 Y+
hg19:Y:24436032-T-G hg38:Y:22289885-T-G FT151647 Y+
hg19:Y:13823517-AAATGG-A hg38:Y:11702811-AAATGG-A DYZ17 6×AATGG*
hg19:Y:22438289-T-A hg38:Y:20276403-T-A A4256 DYZ19 *
hg19:Y:13867502-A-AAATGGAATGG hg38:Y:11746796-A-AAATGGAATGG DYZ17 10×AATGG*
hg19:Y:13196247-T-TCACTC hg38:Y:11040571-T-TCACTC 5×CACTC*
hg19:Y:16056494-T-G hg38:Y:13944614-T-G Y*
hg19:Y:22287978-A-T hg38:Y:20126092-A-T BY84352BY34852 DYZ19 **
hg19:Y:4619767-C-A hg38:Y:4751726-C-A S552FGC3218 S552 Y2598 **
hg19:Y:24278189-A-G hg38:Y:22132042-A-G FGC81559 FGC42754 P3_b1 **
hg19:Y:28796742-G-A hg38:Y:26650595-G-A Z16372BY155819 **
hg19:Y:22303510-T-A hg38:Y:20141624-T-A Z16372BY217013 DYZ19 **
hg19:Y:23807597-AAAG-A hg38:Y:21645711-AAAG-A **
hg19:Y:5179515-GATATAT-G hg38:Y:5311474-GATATAT-G 13×AT**
hg19:Y:28751325-A-G hg38:Y:26605178-A-G **
hg19:Y:20623403-A-C hg38:Y:18461517-A-C P4_Prx **
hg38:Y:56714075-T-C **
hg19:Y:13222409-AAGGGAGGCACTGAG-A hg38:Y:11066733-AAGGGAGGCACTGAG-A **
hg38:Y:56714067-G-T **
hg19:Y:21450713-TG-T hg38:Y:19288827-TG-T **
hg19:Y:21450718-T-TC hg38:Y:19288832-T-TC **
hg19:Y:3584950-A-G hg38:Y:3716909-A-G **
hg19:Y:3755202-AT-A hg38:Y:3887161-AT-A **
hg19:Y:10092937-A-C hg38:Y:10255328-A-C **
hg19:Y:13455822-T-A hg38:Y:11300146-T-A **
hg19:Y:13455842-T-A hg38:Y:11300166-T-A **
hg19:Y:13455869-G-A hg38:Y:11300193-G-A BY156163 **
hg19:Y:13455871-G-A hg38:Y:11300195-G-A **
hg19:Y:13455873-C-G hg38:Y:11300197-C-G **
hg19:Y:14123758-TA-T hg38:Y:12003052-TA-T **
hg19:Y:24387084-A-G hg38:Y:22240937-A-G **
hg19:Y:24461865-A-G hg38:Y:22315718-A-G **
hg38:Y:56714090-T-TGGTATCATCC **
hg19:Y:6672154-T-C hg38:Y:6804113-T-C **
hg19:Y:9887866-A-G hg38:Y:10050257-A-G **
hg19:Y:13222052-T-C hg38:Y:11066376-T-C **
hg19:Y:15116691-A-T hg38:Y:13004778-A-T **
hg19:Y:16503138-G-T hg38:Y:14391258-G-T **
hg19:Y:16884907-C-T hg38:Y:14773027-C-T **
hg19:Y:17847230-G-GT hg38:Y:15735350-G-GT **
hg19:Y:20481124-A-G hg38:Y:18319238-A-G P5_Dst **
hg19:Y:21278484-T-C hg38:Y:19116598-T-C **
hg19:Y:22298619-T-C hg38:Y:20136733-T-C DYZ19 ***
hg19:Y:22316917-C-G hg38:Y:20155031-C-G DC329 DYZ19 ***
hg19:Y:22320151-G-C hg38:Y:20158265-G-C DYZ19 ***
hg19:Y:14324537-A-AAAAAT hg38:Y:12203831-A-AAAAAT 5×AAAAT***
hg19:Y:21227375-CTTTT-C hg38:Y:19065489-CTTTT-C 22×T***
hg19:Y:13457741-C-CATTACGGATG hg38:Y:11302065-C-CATTACGGATG ***
hg38:Y:10946813-C-A ***
hg19:Y:27967308-G-GTA hg38:Y:25821161-G-GTA P1_Y2 ***
hg38:Y:11002108-C-T Z16372BY84123 ***
hg38:Y:56851274-A-T ***
hg19:Y:17996127-TACACAC-T hg38:Y:15884247-TACACAC-T P7_Gap 20×AC***
hg19:Y:21747664-C-T hg38:Y:19585778-C-T ***
hg19:Y:13222434-G-GGT hg38:Y:11066758-G-GGT ***
hg19:Y:13222436-A-AG hg38:Y:11066760-A-AG ***
hg19:Y:17453472-C-CT hg38:Y:15341592-C-CT Z16372 ***
hg38:Y:10946806-C-G ***
hg38:Y:10946821-C-G ***
hg19:Y:28686423-CAAAAAA-C hg38:Y:26540276-CAAAAAA-C 21×A***
hg19:Y:4370594-TACAC-T,TAC hg38:Y:4502553-TACAC-T,TAC 19×AC***
hg19:Y:13489615-ACCCACCCCCACCACCACCCA-A,ACCCCGTCCTCACCCTCACCAC hg38:Y:11333939-ACCCACCCCCACCACCACCCA-A,ACCCCGTCCTCACCCTCACCAC ***
hg19:Y:6708940-T-A hg38:Y:6840899-T-A ***
hg19:Y:6806837-T-A hg38:Y:6938796-T-A ***
hg19:Y:15385817-A-G hg38:Y:13273937-A-G ***
hg19:Y:16687686-C-A hg38:Y:14575806-C-A ***
hg19:Y:6686403-G-T hg38:Y:6818362-G-T ***
hg19:Y:21846452-CTTTTTTTT-C hg38:Y:19684566-CTTTTTTTT-C 26×T***
hg19:Y:22129458-A-AT hg38:Y:19967572-A-AT ***
hg19:Y:22468512-C-G hg38:Y:20306626-C-G DYZ19 ***

In the table above, the meaning of the confidence field depends on whether the data comes from an FTDNA kit or an FGC kit. For FTDNA kits, + implies a "PASS" result with just one possible variant, * indicates a "PASS" but with multiple variants, ** indicates "REJECTED" with just a single variant, and *** indicates "REJECTED" with multiple possible variants. 'A*' are heterozygous variants not called by FTDNA, but still pulled from the VCF file. For FGC kits, + indicates over 99% likely genuine (95% for INDELs); * over 95% likely genuine (90% for INDELs); ** about 40% likely genuine; *** about 10% likely genuine. Manual entries read directly from a BAM file will be either + indicating positive, or * indicating that the data show a mixture of possible variants.

For the FTDNA kits, the BED data is encoded in the background color of the cells. Those cells with a white background have coverage, those with a grey background indicate no coverage in the BED file, and those with a pink background indicate the mutation is on the edge of a coverage region. These pink regions often indicate that the individual may be positive for a SNP even if there is no corresponding entry in the vcf file.

The combBED column indicates whether or not the mutation is a SNP and falls in the combBED region defined in Defining a New Rate Constant for Y-Chromosome SNPs based on Full Sequencing Data by Dmitry Adamov, Vladimir Guryanov, Sergey Karzhavin, Vladimir Tagankin, Vadim Urasin.

The McDonald BED column indicates whether or not the mutation is a SNP and falls in the BED region used by Dr. Iain McDonald in the age analysis he does for R-U106 men.

Age Analysis Information (work in progress)

AllMcDonaldYFull
Kit: IN624761060000077000007800000
Used in age calculations1511202994634088348414
Counts of SNPs6159
Variant counts last updated 2026-03-02 02:35:03.


Big Tree Main Page