Gray

BigY3: 634250
MDKA Birth: United States > Massachusetts

Tree Position

A0-T-YP2191 > P305[A1] > A1b > BT/A1b2 > M168/PF1416[CT] > M145/P205/PF144 > M96/PF1823 > P147 > P177 > M215 > M35 > L539 > Exact position not yet finalized.

Unique Mutations

The mutations unique to this man are summarized in the table below. Those with a '+' or '*' confidence level are considered by FamilyTreeDNA or FullGenomesCorp to be high quality SNPs/INDELs. For completeness, all other mutations of lesser confidence are included as well. These additional mutations may be useful for distinguishing between very closely related men.

Occasionally, some of the mutations listed here will be thought to be shared with other men in which case they might appear in upstream blocks on the tree. When this happens, the 'Blocks' field will indicate what block they appear in. Such a situation might arise with BigY men if the BED data suggests another man may be positive for a SNP, even though it doesn't appear in his VCF data. It might also happen if Chromo2 testing or Sanger sequencing of other men not on the tree show the SNP to be shared.

POS-REF-ALT (hg19) POS-REF-ALT (hg38) Blocks Names Region McDonald BED combBED STRBigY3
634250
22420353-T-A 20258467-T-A DYZ19 A+
56835381-C-A A*
13687822-G-A 11532146-G-A A*
56829720-C-A A*
56830845-C-T A*
56834532-C-A A*
5357890-A-T 5489849-A-T A*
56870957-G-A A*
4309195-C-A 4441154-C-A A*
13450897-A-G 11295221-A-G A*
9577174-G-A 9739565-G-A IR3_Prx A*
20649301-T-A 18487415-T-A P4_Prx A*
26238221-C-T 24092074-C-T P1_Y1 A*
26314354-C-G 24168207-C-G P1_Y1 A*
26398687-A-G 24252540-A-G P1_Y1 A*
56834033-A-G A*
22234045-A-T 20072159-A-T A40FT252923 DYZ19 +
18655256-T-C 16543376-T-C BY3869 YY+
7548242-G-A 7680201-G-A 7522818-A-GBY19390 YY+
10660126-C-A FT252881 +
3231367-G-A 3363326-G-A FT214124 +
3328245-C-G 3460204-C-G FT214169 +
3685978-A-T 3817937-A-T FT214293 +
4142627-C-A 4274586-C-A FT214467 +
4591734-A-C 4723693-A-C FT214622 +
5721456-GCAAAAAGCTA-G 5853415-GCAAAAAGCTA-G +
5767523-A-G 5899482-A-G FT215071 +
6778328-G-C 6910287-G-C YY+
7205320-C-T 7337279-C-T FT215448 YY+
7419563-A-G 7551522-A-G FT215521 YY+
7739676-A-G 7871635-A-G FT215604 YY+
8441134-T-C 8573093-T-C YY+
8445374-T-A 8577333-T-A FT215793 YY+
8793419-C-G 8925378-C-G FT206952 YY+
9048361-A-G 9210752-A-G FT215974 Y+
9080621-G-C 9243012-G-C +
9470151-A-C 9632542-A-C BY6203 +
9995085-A-G 10157476-A-G FT252925 Y+
10033381-G-T 10195772-G-T FT252924 Y+
13570704-G-A 11415028-G-A FT252926 +
14294824-C-T 12174118-C-T BY6349 YY+
14861823-G-A 12749889-G-A FT216498 YY+
15096449-T-C 12984537-T-C FT216550 YY+
15360139-CTA-C 13248259-CTA-C +
15507129-T-C 13395249-T-C FT216652 YY+
15728070-G-T 13616190-G-T BY6357 YY+
17038235-T-C 14926355-T-C BY6425 YY+
17721383-T-C 15609503-T-C FT217304 YY+
17789904-G-T 15678024-G-T BY6204 YY+
18612199-G-A 16500319-G-A FT217526 YY+
18754510-C-T 16642630-C-T FT217566 YY+
21463185-G-A 19301299-G-A FT217943 YY+
21533454-A-G 19371568-A-G FT217970 YY+
21599784-C-T 19437898-C-T FT218000 Y+
22254446-T-A 20092560-T-A BY6423 DYZ19 +
22469534-C-T 20307648-C-T BY40535 DYZ19 +
23484763-G-C 21322877-G-C FT218465 YY+
24335385-T-C 22189238-T-C BY49375 P3_t1 +
25876612-T-C 23730465-T-C P1_Y1 +
13853128-AAATGGAATGG-A 11732422-AAATGGAATGG-A 7×AATGG*
10669303-C-A *
10801762-TATTCC-T *
10679424-G-A *
6293205-C-T 6425164-C-T IR3_Dst *
16957754-CATAT-C,CAT 14845874-CATAT-C,CAT 10×AT*
27844541-T-TA 25698394-T-TA P1_Y2 **
13480485-A-T 11324809-A-T **
56750011-C-T **
14245211-AGAAGGAAGGAAGGAAGGAAG-A 12124505-AGAAGGAAGGAAGGAAGGAAG-A 13×GAAG**
21880827-C-T 19718941-C-T **
28420682-A-AGT 26274535-A-AGT P1_gr2 **
19926955-CTTT-C 17815075-CTTT-C P5_Prx 23×T**
24417019-A-G 22270872-A-G **
2675675-G-T 2807634-G-T **
3640528-TTTCTTTCCTTCC-T 3772487-TTTCTTTCCTTCC-T **
5683970-C-A 5815929-C-A **
5683976-G-T 5815935-G-T **
5976049-A-G 6108008-A-G **
6179583-AGT-A 6311542-AGT-A IR3_Dst **
13480451-C-T 11324775-C-T **
13480484-A-T 11324808-A-T **
13620256-G-A 11464580-G-A **
13709614-G-T 11553938-G-T **
13810984-T-C 11690278-T-C BY90238 **
14292561-T-C 12171855-T-C **
17123501-T-A 15011621-T-A **
18959283-G-A 16847403-G-A **
21476130-G-C 19314244-G-C **
22346449-AG-A 20184563-AG-A DYZ19 **
22477332-C-G 20315446-C-G DYZ19 **
24689755-C-T 22543608-C-T P3_b2 **
13977284-C-T 11856578-C-T Z37CTS1595 ***
6020679-G-T 6152638-G-T 8×T***
16244792-GGTGTGTGT-G 14132912-GGTGTGTGT-G 16×GT***
10901614-CTCCAT-C ***
13977290-A-G 11856584-A-G ***
10904161-G-C ***
6074769-G-T 6206728-G-T ***
13977300-T-C 11856594-T-C ***
3949406-CAAAAAA-C 4081365-CAAAAAA-C 20×A***
13489621-CCCCACCACCACCCACCACCCCC-C,CCTCACCAACCCCACCACCCACCCAA 11333945-CCCCACCACCACCCACCACCCCC-C,CCTCACCAACCCCACCACCCACCCAA ***
2651883-CTTTTTT-C,CTTTTTTT 2783842-CTTTTTT-C,CTTTTTTT 19×T***
3253841-AAAA-A,AAAAT 3385800-AAAA-A,AAAAT ***
4794855-CTTT-C,CT 4926814-CTTT-C,CT 21×T***
6775420-C-CAAAAA 6907379-C-CAAAAA 12×A***
13476639-C-CG,T 11320963-C-CG,T ***
15742251-T-A 13630371-T-A ***
16096267-A-AG 13984387-A-AG ***
19377435-GAAGGAAGA-G,GAAGGAAGG 17265555-GAAGGAAGA-G,GAAGGAAGG ***
22634820-CTTT-C,CTT 20472934-CTTT-C,CTT 14×T***

In the table above, the meaning of the confidence field depends on whether the data comes from an FTDNA kit or an FGC kit. For FTDNA kits, + implies a "PASS" result with just one possible variant, * indicates a "PASS" but with multiple variants, ** indicates "REJECTED" with just a single variant, and *** indicates "REJECTED" with multiple possible variants. 'A*' are heterozygous variants not called by FTDNA, but still pulled from the VCF file. For FGC kits, + indicates over 99% likely genuine (95% for INDELs); * over 95% likely genuine (90% for INDELs); ** about 40% likely genuine; *** about 10% likely genuine. Manual entries read directly from a BAM file will be either + indicating positive, or * indicating that the data show a mixture of possible variants.

For the FTDNA kits, the BED data is encoded in the background color of the cells. Those cells with a white background have coverage, those with a grey background indicate no coverage in the BED file, and those with a pink background indicate the mutation is on the edge of a coverage region. These pink regions often indicate that the individual may be positive for a SNP even if there is no corresponding entry in the vcf file.

The combBED column indicates whether or not the mutation is a SNP and falls in the combBED region defined in Defining a New Rate Constant for Y-Chromosome SNPs based on Full Sequencing Data by Dmitry Adamov, Vladimir Guryanov, Sergey Karzhavin, Vladimir Tagankin, Vadim Urasin.

The McDonald BED column indicates whether or not the mutation is a SNP and falls in the BED region used by Dr. Iain McDonald in the age analysis he does for R-U106 men.