Tree Position

R-P312/S116 > Z290 > L21/S145 > DF13 > DF21/S192 > FGC3213 > ZZ1 > S3058 > S424 > S426 > S190

Unique Mutations

The mutations unique to this man are summarized in the table below. Those with a '+' or '*' confidence level are considered by FamilyTreeDNA or FullGenomesCorp to be high quality SNPs/INDELs. For completeness, all other mutations of lesser confidence are included as well. These additional mutations may be useful for distinguishing between very closely related men.

Occasionally, some of the mutations listed here will be thought to be shared with other men in which case they might appear in upstream blocks on the tree. When this happens, the 'Blocks' field will indicate what block they appear in. Such a situation might arise with BigY men if the BED data suggests another man may be positive for a SNP, even though it doesn't appear in his VCF data. It might also happen if Chromo2 testing or Sanger sequencing of other men not on the tree show the SNP to be shared.

POS-REF-ALT (hg19) POS-REF-ALT (hg38) Blocks Names Region McDonald BED combBED STRFB38
H2290-A
FTDNA
H2290
BigY3
H2290
BigY2
H2290
Manual
Edits
18302648-G-A 16190768-G-A P6_Prx ****A*A*
18375731-G-C 16263851-G-C P6_Prx *A*
28817165-G-T 26671018-G-T A*A*
28817787-G-T 26671640-G-T A*A*
18364159-G-T 16252279-G-T P6_Prx *A*
25849756-T-C 23703609-T-C P1_Y1 ****A*A*
56831342-G-T A*
19813578-T-G 17701698-T-G P5_Prx ****A*A*
5331254-A-C 5463213-A-C A*
20714020-G-A 18552134-G-A P4_Prx ****A*A*
26167000-T-C 24020853-T-C P1_Y1 ****A*
13449436-T-A 11293760-T-A A*
18382284-C-T 16270404-C-T BY121490 P6_Gap ++++
21415411-G-T 19253525-G-T BY132775 YY++++
21254508-C-T 19092622-C-T Y23630 YY++++
27821122-G-C 25674975-G-C P1_Y2 +
21902848-C-A 19740962-C-A BY136346 YY++++
4393678-G-A 4525637-G-A +**
4827184-T-G 4959143-T-G FT82920 ++
15819861-TATTA-T 13707981-TATTA-T *+***+
5263238-A-G 5395197-A-G FT83034 ++
6532366-T-C 6664325-T-C FT83324 ++
5666374-T-G 5798333-T-G FT83136 ++
5936744-A-T 6068703-A-T FT83216 ++
16510666-T-C 14398786-T-C BY108268 YY++++
2894657-G-C 3026616-G-C BY57179 YY++++
14982769-C-T 12870837-C-T BY98897 YY++++
8649001-A-T 8780960-A-T BY74923 YY++++
13994272-G-T 11873566-G-T FT83570 Y++
3253842-A-T 3385801-A-T Y1999 ++
15500680-T-C 13388800-T-C FT83703 YY++**
13544145-G-T 11388469-G-T +**
9513595-T-A 9675986-T-A FT83489 ++
18688514-A-AC 16576634-A-AC +**
3306217-GTATATA-G 3438176-GTATATA-G 10×TA++
4026168-C-T 4158127-C-T FT82684 ++
24881630-G-A 22735483-G-A BY226244 g1 +**++
7161657-GC-G 7293616-GC-G ++++
8083778-A-T 8215737-A-T BY69810 YY++++
23775227-G-A 21613341-G-A BY147608 Y++++
13489701-CCGCA-TCGCG 11334025-CCGCA-TCGCG *
17109091-AACACAC-A,AACAC 14997211-AACACAC-A,AACAC 25×AC*
6402275-GTAC-ATAG 6534234-GTAC-ATAG *
16099087-CTGTG-C,CTG 13987207-CTGTG-C,CTG P8_Prx 23×TG*
22361386-TT-G,T 20199500-TT-G,T DYZ19 *
10925496-C-CTCCAT,T *
27795431-A-G 25649284-A-G P1_Y2 *
21464187-G-A,GGAAAGAAAGAAA 19302301-G-A,GGAAAGAAAGAAA 12×GAAA*
9854343-CTT-C,CT 10016734-CTT-C,CT 19×T****
6402918-T-A 6534877-T-A *
56842957-G-T **
9825002-C-T 9987393-C-T Y***
25239088-C-T 23092941-C-T P2_r1 *
24082133-G-A 21935986-G-A P3_b1 *
25198857-ATT-A,AT 23052710-ATT-A,AT g1 25×T*
24796556-C-T 22650409-C-T P3_b2 *
22844395-T-A 20682509-T-A YY*****
10662945-C-CACTCT,CATTCT *
27792636-C-G 25646489-C-G P1_Y2 *
10965566-TTCCATTCCATTCCATTCCATTCCATTCC-ATCCATTGCTTTCCATTCCATTCCATTCC,ATCCATTGCTTTCCATTCCATTCCATTCCATTCCATTAG *
26141313-C-G 23995166-C-G P1_Y1 *
24946544-G-A 22800397-G-A g1 ****
22455302-T-A 20293416-T-A DYZ19 ****
22303872-T-A 20141986-T-A DYZ19 ****
22251486-T-A 20089600-T-A DYZ19 ****
22249481-G-T 20087595-G-T DYZ19 ****
21477805-GAGAGAA-AAGAAAG,GAGAGAAAAAGAAAG 19315919-GAGAGAA-AAGAAAG,GAGAGAAAAAGAAAG *
9176977-C-T 9339368-C-T Y*
19749309-CTT-C,CT 17637429-CTT-C,CT P5_Prx 22×T*
26193591-G-T 24047444-G-T P1_Y1 ****
56850995-GT-AG,GG *
56861817-AAAAAAAAAAAAAAAAAAAAAACCTG-CAAACAAACAAACAAACAAAAAAAACCTA,CAAACAAACAAACAAACAAACAAACAAAAAAAACCTA *
18506455-C-T 16394575-C-T P6_Dst *
6604084-CTTT-C 6736043-CTTT-C 17×T****
25599575-T-TA 23453428-T-TA P1_gr1 14×A*
9211271-CACAC-A 9373662-CACAC-A *
13448400-GTCACG-GTCATG,TTCACA 11292724-GTCACG-GTCATG,TTCACA *
26169795-G-C 24023648-G-C P1_Y1 ****
22427903-GC-AG 20266017-GC-AG DYZ19 *
13451484-TATTCTG-CA,TATTCCA 11295808-TATTCTG-CA,TATTCCA *
13452374-TTCCATTCCATTCCATTCCATTCAAATACACTCCTTGC-GTCAAATCCACTCCATGA,TTCCATTCCATTCCATTCCAGTCAAATCCACTCCATGA 11296698-TTCCATTCCATTCCATTCCATTCAAATACACTCCTTGC-GTCAAATCCACTCCATGA,TTCCATTCCATTCCATTCCAGTCAAATCCACTCCATGA *
13452432-GA-AT,GT 11296756-GA-AT,GT *
13452327-CCAC-ACAG,CCAG 11296651-CCAC-ACAG,CCAG *
13452704-TCCTCTCCACTACTC-GCCTC,TCCTA 11297028-TCCTCTCCACTACTC-GCCTC,TCCTA *
18410848-G-T 16298968-G-T P6_Gap **
18447623-T-TC 16335743-T-TC P6_Dst **
18512577-G-T 16400697-G-T P6_Dst **
18688512-A-C 16576632-A-C **
18789697-A-G 16677817-A-G **
18728855-C-A 16616975-C-A **
18390137-C-A 16278257-C-A P6_Gap **
18795123-T-G 16683243-T-G **
18858626-TG-T 16746746-TG-T **
18872153-T-A 16760273-T-A ****
21963858-C-A 19801972-C-A **
18407304-C-A 16295424-C-A P6_Gap **
21125229-C-A 18963343-C-A **
22056439-A-C 19894553-A-C **
21963808-C-A 19801922-C-A **
18270414-C-T 16158534-C-T **
18263667-C-A 16151787-C-A **
18190578-C-A 16078698-C-A **
22100974-G-A 19939088-G-A **
18186039-A-G 16074159-A-G **
18185961-G-C 16074081-G-C **
18086375-G-T 15974495-G-T **
17930019-A-G 15818139-A-G **
17617433-C-A 15505553-C-A **
17589161-C-A 15477281-C-A **
17548189-G-A 15436309-G-A **
17433843-G-A 15321963-G-A **
25020601-T-C 22874454-T-C g1 **
19079129-C-A 16967249-C-A **
19062233-C-A 16950353-C-A **
21456052-C-A 19294166-C-A **
20989114-C-T 18827228-C-T P4_Dst **
20645749-T-A 18483863-T-A P4_Prx **
21139525-C-A 18977639-C-A **
21208851-C-A 19046965-C-A **
20387279-A-AG 18225393-A-AG P5_Dst **
21208939-C-A 19047053-C-A **
20001984-C-A 17890104-C-A P5_Prx **
19732406-T-C 17620526-T-C P5_Prx **
19622003-T-C 17510123-T-C P5_Prx **
21269195-A-T 19107309-A-T **
19560762-A-G 17448882-A-G **
19418311-T-C 17306431-T-C **
14358396-C-A 12237691-C-A **
21522492-A-T 19360606-A-T **
19418241-C-A 17306361-C-A **
19393140-T-C 17281260-T-C **
19388198-T-G 17276318-T-G **
21543370-CTTTGTAAT-C 19381484-CTTTGTAAT-C **
19388090-C-A 17276210-C-A **
19331418-C-A 17219538-C-A **
19312371-A-T 17200491-A-T **
19155902-C-A 17044022-C-A **
19129105-C-A 17017225-C-A **
21597172-C-A 19435286-C-A **
21672164-T-A 19510278-T-A **
17382340-C-G 15270460-C-G **
16423742-T-A 14311862-T-A **
14398334-C-A 12277630-C-A **
15220982-T-A 13109068-T-A **
22146542-G-A 19984656-G-A **
14474611-C-A 12353880-C-A **
14531398-A-C 12419599-A-C **
15394498-G-A 13282618-G-A **
14531399-CT-C 12419600-CT-C **
15342646-CTG-C 13230765-CTG-C **
14537921-C-A 12426122-C-A **
14620178-C-A 12508376-C-A **
14620331-T-A 12508529-T-A **
15260717-A-T 13148801-A-T **
14718366-C-A 12606434-C-A **
15231104-T-C 13119190-T-C **
15202271-C-A 13090357-C-A **
15423176-G-T 13311296-G-T **
15179034-A-AC 13067120-A-AC **
15177916-A-G 13066002-A-G **
14994140-AT-A 12882225-AT-A **
14994101-C-A 12882186-C-A **
14990753-G-T 12878838-G-T **
14959748-C-A 12847823-C-A **
14844425-C-A 12732491-C-A **
14799897-G-A 12687968-G-A **
14786372-G-A 12674442-G-A **
14760827-T-C 12648896-T-C **
14754121-T-C 12642190-T-C **
14742182-AT-A 12630250-AT-A **
14720353-C-A 12608421-C-A **
25409998-C-T 23263851-C-T P2_r2 **
15424336-T-G 13312456-T-G **
17363031-C-A 15251151-C-A **
16118600-T-C 14006720-T-C P8_Prx **
17122426-C-A 15010546-C-A **
17053184-A-G 14941304-A-G **
16904661-C-T 14792781-C-T **
16848497-G-A 14736617-G-A FT139281 **
16676823-C-T 14564943-C-T **
16662456-G-C 14550576-G-C **
14422588-C-A 12301863-C-A **
16506080-C-A 14394200-C-A **
16493130-C-A 14381250-C-A **
16357114-C-A 14245234-C-A **
16277871-C-A 14165991-C-A **
16241671-T-C 14129791-T-C **
16074986-C-A 13963106-C-A **
15442441-T-C 13330561-T-C **
16055595-G-A 13943715-G-A **
16053670-C-A 13941790-C-A **
16050112-C-A 13938232-C-A **
16033671-C-A 13921791-C-A **
16027461-G-A 13915581-G-A **
16007273-C-A 13895393-C-A **
15931725-C-A 13819845-C-A **
15893980-G-T 13782100-G-T **
15882047-C-G 13770167-C-G **
14425529-C-A 12304804-C-A **
14430340-C-A 12309613-C-A **
15749113-C-T 13637233-C-T **
15730488-C-A 13618608-C-A **
22132819-C-A 19970933-C-A **
16624539-C-A 14512659-C-A **
22166618-C-A 20004732-C-A **
56880437-C-A **
22356092-G-C 20194206-G-C DYZ19 **
22360349-G-T 20198463-G-T DYZ19 **
18479589-A-AT 16367709-A-AT P6_Dst **
20886779-TAA-T 18724893-TAA-T P4_Dst 32×A**
22295992-G-T 20134106-G-T DYZ19 **
22422025-GTC-TGT 20260139-GTC-TGT DYZ19 **
10949553-A-G *****
27873290-C-A 25727143-C-A P1_Y2 **
20652995-CAAAA-C 18491109-CAAAA-C P4_Prx 18×A**
36736-A-T FGC80565 **
13464-T-A **
13461-C-T **
56845893-A-G **
5248486-A-C 5380445-A-C **
56845866-C-T **
56843576-A-T **
56843413-A-C **
56843400-T-C **
56843392-C-T **
56843387-C-A **
56843385-C-G **
56843380-A-ATG **
56843380-A-T **
56843378-G-T **
56843369-C-A **
56843341-C-A **
56843333-A-C **
16096771-T-G 13984891-T-G **
20757361-CATTT-AA 18595475-CATTT-AA P4_Prx **
56841071-C-A **
6123582-G-T 6255541-G-T **
9605871-T-TAA 9768262-T-TAA IR3_Prx 16×A**
17543756-G-A 15431876-G-A **
17543767-A-G 15431887-A-G **
18483374-TAAA-T 16371494-TAAA-T P6_Dst 27×A**
6204075-T-C 6336034-T-C IR3_Dst **
20083963-A-T 17972083-A-T P5_Dst **
21743848-G-T 19581962-G-T **
19326923-A-G 17215043-A-G **
18872153-TCTTTTTCTTTC-ACTT 16760273-TCTTTTTCTTTC-ACTT **
13726354-CCAA-TGAC 11570678-CCAA-TGAC **
13724122-G-T 11568446-G-T **
20247241-G-T 18085355-G-T P5_Dst **
6119254-G-T 6251213-G-T **
13608401-G-A 11452725-G-A **
5905918-GAATC-AGAATA 6037877-GAATC-AGAATA **
4619860-G-A 4751819-G-A **
20366202-A-C 18204316-A-C P5_Dst **
20373182-G-A 18211296-G-A P5_Dst **
20478953-CAA-C 18317067-CAA-C P5_Dst 15×A**
20510959-GGATTT-TGA 18349073-GGATTT-TGA P5_Dst **
13608437-C-T 11452761-C-T **
13608423-T-C 11452747-T-C **
13608422-T-A 11452746-T-A **
13608417-G-A 11452741-G-A **
13608416-T-C 11452740-T-C **
13608408-G-A 11452732-G-A **
13608406-C-A 11452730-C-A **
56843329-C-G **
56840716-G-T **
22198804-TG-T 20036918-TG-T **
22851445-G-A 20689559-G-A **
23563930-T-C 21402044-T-C **
23438879-C-T 21276993-C-T 21×T**
23438868-C-T 21276982-C-T **
23395900-T-C 21234014-T-C **
23358722-C-A 21196836-C-A **
23341664-C-T 21179778-C-T **
23276522-C-A 21114636-C-A **
23199873-C-T 21037987-C-T FT229760 **
23079183-G-A 20917297-G-A **
23036695-AAAAAG-A 20874809-AAAAAG-A **
23009761-C-A 20847875-C-A **
23007842-C-T 20845956-C-T **
22810808-T-C 20648922-T-C **
24590318-C-T 22444171-C-T P3_t2 **
22801028-C-A 20639142-C-A **
22800170-C-A 20638284-C-A **
22782371-A-G 20620485-A-G **
22765814-A-T 20603928-A-T **
22765809-A-T 20603923-A-T **
22765806-G-T 20603920-G-T **
22765800-T-A 20603914-T-A **
22696222-A-T 20534336-A-T **
22662289-GTT-G 20500403-GTT-G 13×T**
22637682-A-G 20475796-A-G **
22545425-G-T 20383539-G-T **
22314768-A-G 20152882-A-G DYZ19 **
22211468-G-A 20049582-G-A **
23603174-C-A 21441288-C-A **
21764182-C-A **
56840148-G-A **
28513606-G-A 26367459-G-A **
56835401-C-A **
56824708-T-A **
28774824-G-T 26628677-G-T **
28773973-G-A 26627826-G-A **
28711955-G-A 26565808-G-A **
28711953-C-G 26565806-C-G **
28700751-A-T 26554604-A-T **
28666972-TG-T 26520825-TG-T **
28640032-T-G 26493885-T-G **
28567371-C-G 26421224-C-G **
28546943-G-A 26400796-G-A **
28521855-T-A 26375708-T-A **
28513652-C-A 26367505-C-A **
28513599-A-G 26367452-A-G **
23953343-C-A 21807196-C-A **
28513585-G-A 26367438-G-A **
28513584-T-C 26367437-T-C **
28509524-T-C 26363377-T-C **
28480377-C-A 26334230-C-A **
28391033-A-G 26244886-A-G P1_gr2 **
27821121-G-GC 25674974-G-GC P1_Y2 **
27562059-C-G 25415912-C-G P1_Y2 **
14227530-C-A 12106824-C-A **
25804789-C-A 23658642-C-A P1_b3 **
24550023-G-A 22403876-G-A P3_t2 **
24513249-C-A 22367102-C-A **
24389894-CTTTTT-C 22243747-CTTTTT-C 26×T**
23997057-C-A 21850910-C-A **
26565651-C-T 24419504-C-T P1_g2 **
14235992-C-A 12115286-C-A **
14196214-C-A 12075508-C-A **
5887638-T-G 6019597-T-G **
6641144-A-G 6773103-A-G **
6641100-G-T 6773059-G-T **
6576649-C-A 6708608-C-A **
6516316-C-A 6648275-C-A **
6445452-C-A 6577411-C-A **
6384537-A-T 6516496-A-T **
6208078-A-G 6340037-A-G IR3_Dst **
6090375-T-G 6222334-T-G **
6025254-C-T 6157213-C-T **
6013038-A-G 6144997-A-G **
5983454-C-A 6115413-C-A **
5947479-C-A 6079438-C-A **
5941765-G-T 6073724-G-T **
5926664-T-C 6058623-T-C **
5861662-C-T 5993621-C-T **
6654529-C-A 6786488-C-A **
5786069-A-G 5918028-A-G **
5785440-C-A 5917399-C-A **
5710722-T-C 5842681-T-C **
5676363-C-A 5808322-C-A **
5606851-G-C 5738810-G-C **
5605955-C-A 5737914-C-A **
5465322-G-T 5597281-G-T **
5367777-G-T 5499736-G-T **
5359083-G-T 5491042-G-T **
5336107-G-T 5468066-G-T **
5292695-A-T 5424654-A-T **
5221043-CTTT-C 5353002-CTTT-C 14×T**
5200193-G-T 5332152-G-T **
4785248-C-A 4917207-C-A **
6646672-T-C 6778631-T-C **
6664481-T-C 6796440-T-C **
4580507-T-C 4712466-T-C **
7829525-C-A 7961484-C-A **
9181210-C-A 9343601-C-A **
9162887-G-T 9325278-G-T **
9057496-C-A **
9057463-C-A **
8734222-C-CAAA 8866181-C-CAAA 14×A**
27663819-C-A 25517672-C-A P1_Y2 **
8671906-C-A 8803865-C-A **
8379566-G-T 8511525-G-T **
8290977-C-A 8422936-C-A **
8159096-C-A 8291055-C-A **
8130554-A-G 8262513-A-G **
7996225-C-T 8128184-C-T **
7986070-GA-G 8118029-GA-G **
7861427-C-A 7993386-C-A **
7664666-T-A 7796625-T-A **
6729460-C-T 6861419-C-T **
7650452-C-A 7782411-C-A **
7422409-C-A 7554368-C-A **
7391870-C-A 7523829-C-A **
7371818-G-T 7503777-G-T **
7360568-A-T 7492527-A-T FT192339 **
7298492-C-A 7430451-C-A **
7243531-C-A 7375490-C-A **
7237774-C-A 7369733-C-A **
14135235-CT-C 12014529-CT-C **
7127648-C-A 7259607-C-A **
7039214-T-C 7171173-T-C **
7016271-T-G 7148230-T-G **
7012618-C-A 7144577-C-A **
6765787-C-A 6897746-C-A **
4604421-C-A 4736380-C-A **
4549335-C-A 4681294-C-A **
9398059-C-A 9560450-C-A **
20022432-C-A 17910552-C-A P5_Prx **
22694141-G-A 20532255-G-A FGC49054 **
27901152-G-A 25755005-G-A P1_Y2 **
27972426-T-C 25826279-T-C P1_Y2 **
13347932-T-TACAC 11192256-T-TACAC 21×AC**
20654981-AATATAT-A 18493095-AATATAT-A P4_Prx 21×AT**
20510855-G-T 18348969-G-T P5_Dst **
28016701-T-C 25870554-T-C P1_Y2 **
6756908-C-A 6888867-C-A 26×A**
22360134-TT-G 20198248-TT-G DYZ19 **
26344423-CT-C 24198276-CT-C P1_Y1 28×T**
5785352-C-CA 5917311-C-CA 9×A**
59022271-C-A 56876124-C-A 50×A**
10015012-G-T 10177403-G-T **
13138818-T-C 10628304-T-C **
58984359-A-T 56838212-A-T **
58989545-A-G 56843398-A-G **
23881876-C-A 21719990-C-A 18×A**
13564408-G-C 11408732-G-C **
24290749-G-GCA 22144602-G-GCA P3_t1 20×CA**
24420879-A-ATT 22274732-A-ATT 43×T**
59033258-A-AGTT 56887111-A-AGTT 10×GTT**
19126436-C-CAAAAA 17014556-C-CAAAAA 25×A**
28398433-T-A 26252286-T-A P1_gr2 **
27375800-ATT-A 25229653-ATT-A P1_g3 19×T**
27335305-AAAAT-A 25189158-AAAAT-A P1_g3 5×AAAT**
8153691-T-C 8285650-T-C Y614 **
6671563-C-A 6803522-C-A **
19775302-C-CTT 17663422-C-CTT P5_Prx 32×T**
25441211-ATT-A 23295064-ATT-A P2_r2 22×T**
16292595-G-T 14180715-G-T **
15080781-C-A 12968871-C-A **
5563117-TACAC-T 5695076-TACAC-T 16×AC**
4472327-G-A 4604286-G-A **
3857997-T-G 3989956-T-G **
4470883-T-C 4602842-T-C **
4412188-A-G 4544147-A-G **
4409011-C-A 4540970-C-A **
4380114-T-C 4512073-T-C **
4270718-G-T 4402677-G-T **
4270696-G-T 4402655-G-T **
4242932-C-A 4374891-C-A **
27731538-C-T 25585391-C-T P1_Y2 **
4179263-C-A 4311222-C-A **
4115213-TG-T 4247172-TG-T **
4088442-A-G 4220401-A-G **
4077354-C-A 4209313-C-A **
3876027-A-G 4007986-A-G **
3864925-C-A 3996884-C-A **
3820860-G-T 3952819-G-T **
18210984-C-A 16099104-C-A **
3000028-G-A 3131987-G-A **
4417570-A-AT 4549529-A-AT 10×T**
7160586-CTTTT-C 7292545-CTTTT-C 15×T**
19829262-G-T 17717382-G-T P5_Prx **
16989162-C-A 14877282-C-A **
19829286-G-T 17717406-G-T P5_Prx **
2772300-T-A 2904259-T-A **
3146671-C-A 3278630-C-A **
3820824-G-T 3952783-G-T **
3147950-T-C 3279909-T-C **
3328952-T-C 3460911-T-C **
3440407-C-A 3572366-C-A **
3501151-G-A 3633110-G-A **
3652014-T-C 3783973-T-C **
3689280-A-G 3821239-A-G **
27616494-CT-C 25470347-CT-C P1_Y2 9×T**
7138427-A-G 7270386-A-G **
9402658-C-A 9565049-C-A **
10994324-T-C **
13200356-C-A 11044680-C-A **
11037138-C-CCATTAG **
11037135-C-G **
11037127-C-A **
11037097-C-G **
11034130-T-C **
11032432-C-A **
11027790-C-T **
11027785-C-T **
11027782-G-C **
11027780-C-T **
9501176-T-A 9663567-T-A **
11016271-C-A **
10998184-A-G **
10991337-T-A **
26099825-TTGTCTCTC-GTG 23953678-TTGTCTCTC-GTG P1_Y1 **
10987578-C-A **
10983932-TTCCAC-T **
10980352-T-A **
10975743-C-T **
10961589-C-T **
10961586-C-A **
10961373-T-C **
10956453-A-C **
10954321-CAT-C **
10954302-A-C **
10954298-T-TTGCTC **
10950350-C-A **
10950349-A-C **
10948386-C-T **
13206451-C-A 11050775-C-A **
13229491-C-A 11073815-C-A **
10929837-G-T **
13888564-G-T 11767858-G-T **
14108787-T-G 11988081-T-G **
14107187-A-G 11986481-A-G **
14100385-G-A 11979679-G-A **
14076766-C-A 11956060-C-A **
14073444-C-A 11952738-C-A **
14029244-C-A 11908538-C-A **
13993549-C-A 11872843-C-A **
13975077-A-T 11854371-A-T **
13949021-G-T 11828315-G-T **
13945877-G-T 11825171-G-T **
13942341-C-A 11821635-C-A **
13941637-G-A 11820931-G-A **
13940459-A-T 11819753-A-T **
13920109-C-A 11799403-C-A **
13885885-G-T 11765179-G-T **
13239409-T-A 11083733-T-A **
13884891-C-T 11764185-C-T **
13873893-C-A 11753187-C-A **
13857715-C-A 11737009-C-A **
13800912-G-T 11680206-G-T **
13610782-T-C 11455106-T-C **
13523474-T-A 11367798-T-A **
13523454-T-A 11367778-T-A **
25906264-A-G 23760117-A-G P1_Y1 **
25954084-CTTT-C 23807937-CTTT-C P1_Y1 **
13472234-G-A 11316558-G-A **
13327838-C-A 11172162-C-A **
13304343-T-A 11148667-T-A **
13298549-C-T 11142873-C-T **
13295834-T-G 11140158-T-G **
10932463-G-T **
11027768-A-C **
10929828-T-C **
10026244-C-A 10188635-C-A **
10827290-C-A **
10824208-A-T **
10812635-T-C **
10628271-C-G **
10797677-C-T **
9986142-T-C 10148533-T-C **
10784431-C-A **
10780839-C-A **
10769086-T-A **
10759348-A-T **
10755386-CCACT-C **
10754879-C-A **
10754335-AACTCCATCCC-A **
10034217-T-G 10196608-T-G **
10844433-C-A **
10683450-A-C **
10037712-G-T 10200103-G-T **
10924436-T-C **
10678256-C-A **
27525761-CA-C 25379614-CA-C P1_Y2 **
10656731-C-A **
10654329-C-A **
10653398-G-T **
10648157-C-A **
10628304-T-TTCCAG **
10628288-A-G **
10628282-C-A **
10618418-C-A **
10624117-G-A **
10836145-C-A **
10808526-C-A **
27539324-CGCC-TGCT 25393177-CGCC-TGCT P1_Y2 **
10866401-C-A **
9502541-G-T 9664932-G-T **
27162988-T-TA 25016841-T-TA P1_g3 22×A**
10880572-C-A **
10883808-AT-A **
10885372-C-T **
10890395-G-C **
10872914-G-T **
9839445-C-A 10001836-C-A **
10879322-C-A **
27165197-ATT-A 25019050-ATT-A P1_g3 11×T**
27058790-C-A 24912643-C-A P1_r4 **
10917756-A-G **
10861795-C-A **
10918439-G-T **
9940191-C-A 10102582-C-A **
10919701-G-T **
9962580-T-C 10124971-T-C **
10921386-C-T **
24617915-T-C 22471768-T-C P3_t2 ***
28421153-C-T 26275006-C-T P1_gr2 ***
28119835-C-T 25973688-C-T P1_b4 ***
28245714-ATT-A 26099567-ATT-A P1_b4 15×T***
28418303-G-T 26272156-G-T P1_gr2 ***
24607321-CT-C,CTT 22461174-CT-C,CTT P3_t2 12×T***
20273852-C-T 18111966-C-T P5_Dst ***
28120095-T-C 25973948-T-C P1_b4 ***
16143491-A-T 14031611-A-T P8_Dst ***
16126277-A-G 14014397-A-G P8_Prx ***
28408558-T-C 26262411-T-C P1_gr2 ***
19917917-T-C 17806037-T-C P5_Prx ***
28404622-G-C 26258475-G-C P1_gr2 ***
18521396-T-C 16409516-T-C P6_Dst ***
28401420-T-C 26255273-T-C P1_gr2 ***
28400905-C-A 26254758-C-A P1_gr2 ***
27559900-C-T 25413753-C-T P1_Y2 ***
28399091-G-A 26252944-G-A P1_gr2 ***
20088126-T-C 17976246-T-C P5_Dst ***
25662890-C-CA,CAA 23516743-C-CA,CAA P1_b3 15×A***
28351496-A-G 26205349-A-G P1_gr2 ***
28412330-A-G 26266183-A-G P1_gr2 ***
20114701-A-G 18002821-A-G P5_Dst ***
28416927-A-G 26270780-A-G P1_gr2 ***
28418294-C-T 26272147-C-T P1_gr2 ***
20196323-CA-C,CAA 18034437-CA-C,CAA P5_Dst 10×A***
28358909-T-C 26212762-T-C P1_gr2 ***
28358888-A-G 26212741-A-G P1_gr2 ***
28404648-CT-TG 26258501-CT-TG P1_gr2 ***
28112612-A-G 25966465-A-G P1_Y2 ***
28003350-G-C 25857203-G-C P1_Y2 ***
28080112-G-T 25933965-G-T P1_Y2 ***
22473882-GTA-ATT 20311996-GTA-ATT DYZ19 ***
22357841-AGTGT-TGTGG 20195955-AGTGT-TGTGG DYZ19 ***
24627276-G-T 22481129-G-T P3_t2 ***
22422007-TCCA-ACAT 20260121-TCCA-ACAT DYZ19 ***
27380076-T-C 25233929-T-C P1_g3 ***
27362559-G-A 25216412-G-A P1_g3 ***
27342704-G-T 25196557-G-T P1_g3 ***
22431402-T-C 20269516-T-C DYZ19 ***
22448043-T-A 20286157-T-A DYZ19 ***
22488201-CTGA-GTGT 20326315-CTGA-GTGT DYZ19 ***
21014685-A-G 18852799-A-G P4_Dst ***
22502688-GCACG-ACACT,CCACT 20340802-GCACG-ACACT,CCACT DYZ19 ***
22503330-A-C,G 20341444-A-C,G DYZ19 ***
24015709-G-T 21869562-G-T ***
27245617-A-T 25099470-A-T P1_g3 ***
24778870-T-C 22632723-T-C P3_b2 ***
24534541-T-C 22388394-T-C P3_t2 ***
26884389-GTGTC-C,GTG 24738242-GTGTC-C,GTG P1_r3 4×TGTC***
25177326-CAA-C 23031179-CAA-C g1 24×A***
22235693-AAT-ACA,CCT 20073807-AAT-ACA,CCT DYZ19 ***
20995974-A-G 18834088-A-G P4_Dst ***
20274131-T-C 18112245-T-C P5_Dst ***
27497800-C-T 25351653-C-T P1_Y2 ***
20295499-CT-C,CTT 18133613-CT-C,CTT P5_Dst 11×T***
27709844-C-T 25563697-C-T P1_Y2 ***
20307241-A-G 18145355-A-G P5_Dst ***
28027095-C-A 25880948-C-A P1_Y2 ***
20432597-C-G 18270711-C-G P5_Dst ***
20439755-A-G 18277869-A-G P5_Dst ***
20472047-G-T 18310161-G-T P5_Dst ***
20506131-C-A 18344245-C-A P5_Dst ***
28003339-CT-C 25857192-CT-C P1_Y2 ***
20989625-A-G 18827739-A-G P4_Dst ***
27430999-G-T 25284852-G-T P1_g3 ***
27382114-C-T 25235967-C-T P1_g3 ***
20581782-AT-A 18419896-AT-A P5_Dst 17×T***
27890433-T-TA 25744286-T-TA P1_Y2 ***
20876592-A-T 18714706-A-T P4_Dst ***
27882520-T-A 25736373-T-A P1_Y2 ***
27867901-A-G 25721754-A-G P1_Y2 ***
25291085-G-A 23144938-G-A P2_r1 ***
27817228-C-A 25671081-C-A P1_Y2 ***
16102884-GT-G 13991004-GT-G P8_Prx 13×T***
22363261-TG-T 20201375-TG-T DYZ19 ***
9662670-T-C 9825061-T-C IR3_Prx ***
10693259-CT-C ***
18370847-CT-C 16258967-CT-C P6_Prx 25×T***
15749575-C-CTT 13637695-C-CTT 15×T***
2860279-C-T 2992238-C-T ***
4241587-C-A 4373546-C-A ***
7897255-G-T 8029214-G-T ***
8705698-C-CTT 8837657-C-CTT 16×T***
9334618-C-T 9497009-C-T ***
9852489-C-A 10014880-C-A ***
9963466-T-G 10125857-T-G ***
10662845-C-A ***
10667029-C-A ***
10752521-C-A ***
22454880-A-G 20292994-A-G DYZ19 ***
10845721-C-T ***
10845727-A-C ***
10845729-T-A ***
10879028-C-A ***
10879046-C-A ***
10880366-C-A ***
10899962-A-G ***
10958382-T-C ***
13225929-C-T 11070253-C-T ***
13487752-C-A 11332076-C-A ***
13488892-C-G 11333216-C-G ***
14502084-T-TAA 12390289-T-TAA 10×A***
22431382-G-A 20269496-G-A DYZ19 ***
59013640-TTTTTT-A 56867493-TTTTTT-A ***
15430569-C-A 13318689-C-A ***
22427904-C-G 20266018-C-G DYZ19 ***
22423083-G-T 20261197-G-T DYZ19 ***
58976452-T-C 56830305-T-C ***
27785784-TA-T 25639637-TA-T P1_Y2 10×A***
22362547-G-A 20200661-G-A DYZ19 ***
18480300-GTT-G 16368420-GTT-G P6_Dst 25×T***
22484137-C-G 20322251-C-G DYZ19 ***
24686428-C-CT 22540281-C-CT P3_b2 23×T***
22486076-G-T 20324190-G-T FGC45793 DYZ19 ***
26318196-G-GT 24172049-G-GT P1_Y1 12×T***
22431331-A-G 20269445-A-G DYZ19 ***
22431358-G-T 20269472-G-T DYZ19 ***
22427903-G-A 20266017-G-A DYZ19 ***
22435596-C-A 20273710-C-A DYZ19 ***
22300619-T-G 20138733-T-G DYZ19 ***
26286101-AT-A 24139954-AT-A P1_Y1 ***
9030492-AG-A 9192883-AG-A ***
13486715-A-G 11331039-A-G ***
22255778-T-C 20093892-T-C DYZ19 ***
22455657-C-G 20293771-C-G BY22806 DYZ19 ***
22443895-T-C 20282009-T-C DYZ19 ***
22431313-G-A 20269427-G-A DYZ19 ***
15305843-AAATAAT-A,AAAT 13193942-AAATAATAAT-A,AAAT 15×AAT***
24069806-T-C 21923659-T-C FGC45243 P3_b1 ***
22507425-C-T 20345539-C-T DYZ19 ***
13378444-AT-A 11222768-AT-A 12×T***
25513737-CA-C 23367590-CA-C P1_gr1 12×A***
15404329-G-GAA 13292449-G-GAA 13×A***
15865620-C-A 13753740-C-A ***
9652158-TTA-T 9814549-TTA-T IR3_Prx 11×TA***
13486743-TACCTG-CACTTA 11331067-TACCTG-CACTTA ***
14121165-T-C 12000459-T-C ***
12372815-ATTTTT-A,ATT ***
18040347-TA-T 15928467-TA-T ******
18040352-ATTAT-A 15928472-ATTAT-A ***
18568071-T-A 16456191-T-A ***
19183814-CTTTTTTTT-C,CTTTTTTT 17071934-CTTTTTTTT-C,CTTTTTTT 28×T***
19546258-A-AT 17434378-A-AT ***
23019500-G-A 20857614-G-A ***
27847931-G-GT 25701784-G-GT P1_Y2 11×T***
9967013-CAATA-TAATT 10129404-CAATA-TAATT ***
3181857-CAAA-C,CAAAA 3313816-CAAA-C,CAAAA 20×A***
10079819-T-G 10242210-T-G ***
13965269-CA-C,CAAA 11844563-CA-C,CAAA 21×A***
7939472-TAAAAAAAAAAA-T,TA 8071431-TAAAAAAAAAAA-T,TA 35×A******
17632570-GTTT-G,GTTTT 15520690-GTTT-G,GTTTT 22×T***
19469877-AC-A,C 17357997-AC-A,C 12×C***
21980001-CAA-C,CA 19818115-CAA-C,CA 27×A***
23197360-CAA-C,CAAA 21035474-CAA-C,CAAA 17×A***
28700764-TAC-T,TAT 26554617-TAC-T,TAT 13×AC***
56856389-CCTA-ACTC ***
56862619-ATCTTTTTTTTTTTTTT-ATCTTTTTTTTTTTTTG,CTCTTTTTTTTTTT ***
6447774-G-GT,GTT 6579733-G-GT,GTT 16×T***
7003246-C-A 7135205-C-A ***
7123183-C-G 7255142-C-G ***
7123194-T-G 7255153-T-G ***
7123217-GAC-AAT 7255176-GAC-AAT ***
9804830-C-A 9967221-C-A ******
7142395-C-T 7274354-C-T ***
19792489-AT-A 17680609-AT-A P5_Prx 13×T***
18013954-ATG-A 15902074-ATG-A P7_Dst 9×TG***
16707544-G-T 14595664-G-T ***
18271018-GTTT-G,GTTTT 16159138-GTTT-G,GTTTT 17×T***
18354245-GAA-G,GAG 16242365-GAA-G,GAG P6_Prx ***
18354249-GAA-G 16242369-GAA-G P6_Prx ***
18972998-C-A 16861118-C-A ***
21737903-G-A 19576017-G-A ***
22849491-CTTT-C,CT 20687605-CTTT-C,CT 20×T***
23742122-C-T 21580236-C-T ***
28496348-C-CA 26350201-C-CA 18×A***
13246880-GAAAAA-G 27×A***
28816020-G-T 26669873-G-T ***
9075188-C-CTT 9237579-C-CTT 20×T***
10955258-TTCAAC-T ***
2856782-CTT-C,CT 2988741-CTT-C,CT 24×T***
18615932-CTTTTT-C 16504052-CTTTTT-C 27×T***
2752415-TAAA-T,TAAAA 2884374-TAAA-T,TAAAA 23×A***
24336793-CTT-C 22190646-CTT-C P3_t1 20×T***
2888870-CAAAA-C 3020829-CAAAA-C 32×A***
17361058-CAA-C,CA 15249178-CAA-C,CA 25×A***
22970282-CAAAA-C,CAAA 20808396-CAAAA-C,CAAA 27×A***
14413210-CAA-C,CAAA 12292507-CAA-C,CAAA 23×A***
15410664-G-T 13298784-G-T ***
21827606-C-CAA 19665720-C-CAA 21×A***
4848425-CA-C 4980384-CA-C 9×A******
24668883-AT-A 22522736-AT-A P3_b2 12×T***
5231890-CT-C,CTT 5363849-CT-C,CTT 22×T***
27617980-CAAA-C 25471833-CAAA-C P1_Y2 29×A***

In the table above, the meaning of the confidence field depends on whether the data comes from an FTDNA kit or an FGC kit. For FTDNA kits, + implies a "PASS" result with just one possible variant, * indicates a "PASS" but with multiple variants, ** indicates "REJECTED" with just a single variant, and *** indicates "REJECTED" with multiple possible variants. 'A*' are heterozygous variants not called by FTDNA, but still pulled from the VCF file. For FGC kits, + indicates over 99% likely genuine (95% for INDELs); * over 95% likely genuine (90% for INDELs); ** about 40% likely genuine; *** about 10% likely genuine. Manual entries read directly from a BAM file will be either + indicating positive, or * indicating that the data show a mixture of possible variants.

For the FTDNA kits, the BED data is encoded in the background color of the cells. Those cells with a white background have coverage, those with a grey background indicate no coverage in the BED file, and those with a pink background indicate the mutation is on the edge of a coverage region. These pink regions often indicate that the individual may be positive for a SNP even if there is no corresponding entry in the vcf file.

The combBED column indicates whether or not the mutation is a SNP and falls in the combBED region defined in Defining a New Rate Constant for Y-Chromosome SNPs based on Full Sequencing Data by Dmitry Adamov, Vladimir Guryanov, Sergey Karzhavin, Vladimir Tagankin, Vadim Urasin.

The McDonald BED column indicates whether or not the mutation is a SNP and falls in the BED region used by Dr. Iain McDonald in the age analysis he does for R-U106 men.

Mutation Notes:

Kit POSITION-REF-ALT (hg19) POSITION-REF-ALT (hg38) Note
Manual6274770-G-A6406729-G-A2A 2G

Haplotype Progression

The data below reveals the progression of changes in the haplotype. The bottom row is the haplotype for this man and above him are the inferred ancestral haplotypes for various upstream blocks. These inferred haplotypes are very much a work in progress, and any suggested modifications are appreciated. I think we can use our vast collection of haplotype data to refine these haplotypes. Mutations made from each upstream block are shown in sequence. The cell color is determined by the block in which the mutation took place.

DYS393
DYS390
DYS19
DYS391
DYS385
DYS426
DYS388
DYS439
DYS389i
DYS392
DYS389ii
DYS458
DYS459
DYS455
DYS454
DYS447
DYS437
DYS448
DYS449
DYS464
DYS460
Y-GATA-H4
YCAII
DYS456
DYS607
DYS576
DYS570
CDY
DYS442
DYS438
DYS531
DYS578
DYF395S1
DYS590
DYS537
DYS641
DYS472
DYF406S1
DYS511
DYS425
DYS413
DYS557
DYS594
DYS436
DYS490
DYS534
DYS450
DYS444
DYS481
DYS520
DYS446
DYS617
DYS568
DYS487
DYS572
DYS640
DYS492
DYS565
DYS710
DYS485
DYS632
DYS495
DYS540
DYS714
DYS716
DYS717
DYS505
DYS556
DYS549
DYS589
DYS522
DYS494
DYS533
DYS636
DYS575
DYS638
DYS462
DYS452
DYS445
Y-GATA-A10
DYS463
DYS441
Y-GGAAT-1B07
DYS525
DYS712
DYS593
DYS650
DYS532
DYS715
DYS504
DYS513
DYS561
DYS552
DYS726
DYS635
DYS587
DYS643
DYS497
DYS510
DYS434
DYS461
DYS435
P312/S1161324141111-14121212131329179-1011112515192915-15-17-17111119-231615181736-38121211915-1681010810101223-231610121215812222013121113111112123315916122626191211131210912121011113012132413101020151913241712152412231810141791211
L21/S1451324141111-14121212131329179-1011112515192915-15-17-17111119-231615181736-38121211915-1681010810101223-231610121215812222013121113111112123515916122526191211131211912121011113012132413101020151913241712152412231810141791211
DF21/S1921324141111-14121212131329179-1011112515192915-15-17-17111119-231615181836-38121211915-1681010810101223-231610121215812222013121113111112123515916122526191211131211912121011113012132413101020151913241712152412231810141791211
S30581324141011-14121212131329179-1011112515192915-15-17-17111119-231615181836-38121211915-1681010810101223-231610121215812222013121113111112123515916122526191211121211912121011113012132413101020151913241712152412231810141791211
S4261324141011-14121212131329179-1011112515193015-15-17-17111019-231615181838-38121211915-1691010810101222-231610121215811222014121113111112123115915122526191311121211912121011113012132413101020151913231712152412231810141791211
S1901324141011-14121212131329179-1011112515193013-15-17-17111019-231615181838-38121211915-1691010810101222-231610121215811222014121113111112123115915122526201311121211912121011113012132413101020151913231712152412231810141791211
Oakes1325151011-14121212131329179-911112514193213-15-16-1711919-231615191838-39121212915-1691010810101221-221610121216811222014121113111112123015915122526201311121211912121011113012132413101019151812231712152412231811141791211

Age Analysis Information (work in progress)

AllMcDonaldYFull
Kit: H22901098165680061668089833
Kit: H22901011541882011438055316
Kit: H22901508946294423938354130
Kit: H2290-A*16000000100000008300000
Used in age calculations1508946294423938354130
Counts of SNPs1311
Variant counts last updated 2020-03-02 03:07:31.

* BED data not available. Using default values.


Big Tree Main Page