Tree Position

R-P312/S116 > Z290 > L21/S145 > S552 > DF13 > DF21/S192 > FGC3213 > ZZ1 > S3058 > S424 > S426 > S190

Unique Mutations

The mutations unique to this man are summarized in the table below. Those with a '+' or '*' confidence level are considered by FamilyTreeDNA or FullGenomesCorp to be high quality SNPs/INDELs. For completeness, all other mutations of lesser confidence are included as well. These additional mutations may be useful for distinguishing between very closely related men.

Occasionally, some of the mutations listed here will be thought to be shared with other men in which case they might appear in upstream blocks on the tree. When this happens, the 'Blocks' field will indicate what block they appear in. Such a situation might arise with BigY men if the BED data suggests another man may be positive for a SNP, even though it doesn't appear in his VCF data. It might also happen if Chromo2 testing or Sanger sequencing of other men not on the tree show the SNP to be shared.

POS-REF-ALT (hg19) POS-REF-ALT (hg38) Blocks Names Region McDonald BED combBED STRFB38
H2290-A
FTDNA
H2290
BigY3
H2290
BigY2
H2290
Manual
Edits
18302648-G-A 16190768-G-A P6_Prx ****A*A*
19813578-T-G 17701698-T-G P5_Prx ****A*A*
20714020-G-A 18552134-G-A P4_Prx ****A*A*
25849756-T-C 23703609-T-C P1_Y1 ****A*A*
26167000-T-C 24020853-T-C P1_Y1 ****A*
28817165-G-T 26671018-G-T A*A*
28817787-G-T 26671640-G-T A*A*
56831342-G-T A*
18364159-G-T 16252279-G-T P6_Prx *A*
18375731-G-C 16263851-G-C P6_Prx *A*
2894657-G-C 3026616-G-C BY57179 YY++++
7161657-GC-G 7293616-GC-G ++++
8083778-A-T 8215737-A-T BY69810 YY++++
8649001-A-T 8780960-A-T BY74923 YY++++
14982769-C-T 12870837-C-T BY98897 YY++++
15819861-TATTA-T 13707981-TATTA-T Y61478 *+***+
16510666-T-C 14398786-T-C BY108268 YY++++
18382284-C-T 16270404-C-T BY121490 P6_Gap ++++
21254508-C-T 19092622-C-T Y23630 YY++++
21415411-G-T 19253525-G-T BY132775 YY++++
21902848-C-A 19740962-C-A BY136346 YY++++
23775227-G-A 21613341-G-A BY147608 Y++++
24881630-G-A 22735483-G-A BY226244 g1 +**++
3253842-A-T 3385801-A-T Y1999 ++
15500680-T-C 13388800-T-C FT83703 YY++**
18688514-A-AC 16576634-A-AC +**
3306217-GTATATA-G 3438176-GTATATA-G 10×TA++
4026168-C-T 4158127-C-T FT82684 ++
4393678-G-A 4525637-G-A +**
4827184-T-G 4959143-T-G FT82920 ++
5263238-A-G 5395197-A-G FT83034 ++
5666374-T-G 5798333-T-G FT83136 ++
5936744-A-T 6068703-A-T FT83216 ++
6532366-T-C 6664325-T-C FT83324 ++
9513595-T-A 9675986-T-A FT83489 ++
13544145-G-T 11388469-G-T +**
13994272-G-T 11873566-G-T FT83570 Y++
27821122-G-C 25674975-G-C P1_Y2 +
22249481-G-T 20087595-G-T DYZ19 ****
22251486-T-A 20089600-T-A DYZ19 ****
22303872-T-A 20141986-T-A DYZ19 ****
22455302-T-A 20293416-T-A DYZ19 ****
24946544-G-A 22800397-G-A g1 ****
26169795-G-C 24023648-G-C P1_Y1 ****
26193591-G-T 24047444-G-T P1_Y1 ****
17109091-AACACAC-A,AACAC 14997211-AACACAC-A,AACAC 25×AC*
13489701-CCGCA-TCGCG 11334025-CCGCA-TCGCG *
22361386-TT-G,T 20199500-TT-G,T DYZ19 *
22844395-T-A 20682509-T-A YY*****
9825002-C-T 9987393-C-T Y***
56842957-G-T **
6402918-T-A 6534877-T-A FT285919 *
6402275-GTAC-ATAG 6534234-GTAC-ATAG *
10662945-C-CACTCT,CATTCT *
10925496-C-CTCCAT,T *
10965566-TTCCATTCCATTCCATTCCATTCCATTCC-ATCCATTGCTTTCCATTCCATTCCATTCC,ATCCATTGCTTTCCATTCCATTCCATTCCATTCCATTAG *
13448400-GTCACG-GTCATG,TTCACA 11292724-GTCACG-GTCATG,TTCACA *
13451484-TATTCTG-CA,TATTCCA 11295808-TATTCTG-CA,TATTCCA *
13452327-CCAC-ACAG,CCAG 11296651-CCAC-ACAG,CCAG *
13452374-TTCCATTCCATTCCATTCCATTCAAATACACTCCTTGC-GTCAAATCCACTCCATGA,TTCCATTCCATTCCATTCCAGTCAAATCCACTCCATGA 11296698-TTCCATTCCATTCCATTCCATTCAAATACACTCCTTGC-GTCAAATCCACTCCATGA,TTCCATTCCATTCCATTCCAGTCAAATCCACTCCATGA *
13452432-GA-AT,GT 11296756-GA-AT,GT *
13452704-TCCTCTCCACTACTC-GCCTC,TCCTA 11297028-TCCTCTCCACTACTC-GCCTC,TCCTA *
21477805-GAGAGAA-AAGAAAG,GAGAGAAAAAGAAAG 19315919-GAGAGAA-AAGAAAG,GAGAGAAAAAGAAAG *
22427903-GC-AG 20266017-GC-AG DYZ19 *
26141313-C-G 23995166-C-G P1_Y1 *
56850995-GT-AG,GG *
56861817-AAAAAAAAAAAAAAAAAAAAAACCTG-CAAACAAACAAACAAACAAAAAAAACCTA,CAAACAAACAAACAAACAAACAAACAAAAAAAACCTA *
25599575-T-TA 23453428-T-TA P1_gr1 14×A*
9176977-C-T 9339368-C-T Y*
9211271-CACAC-A 9373662-CACAC-A *
16099087-CTGTG-C,CTG 13987207-CTGTG-C,CTG P8_Prx 23×TG*
18506455-C-T 16394575-C-T P6_Dst *
19749309-CTT-C,CT 17637429-CTT-C,CT P5_Prx 22×T*
21464187-G-A,GGAAAGAAAGAAA 19302301-G-A,GGAAAGAAAGAAA 12×GAAA*
24082133-G-A 21935986-G-A P3_b1 *
24796556-C-T 22650409-C-T P3_b2 *
25198857-ATT-A,AT 23052710-ATT-A,AT g1 25×T*
25239088-C-T 23092941-C-T P2_r1 *
27792636-C-G 25646489-C-G P1_Y2 *
27795431-A-G 25649284-A-G P1_Y2 *
16292595-G-T 14180715-G-T **
25441211-ATT-A 23295064-ATT-A P2_r2 22×T**
19775302-C-CTT 17663422-C-CTT P5_Prx 32×T**
6671563-C-A 6803522-C-A **
8153691-T-C 8285650-T-C Y614 **
27335305-AAAAT-A 25189158-AAAAT-A P1_g3 5×AAAT**
27375800-ATT-A 25229653-ATT-A P1_g3 19×T**
19126436-C-CAAAAA 17014556-C-CAAAAA 25×A**
59033258-A-AGTT 56887111-A-AGTT 10×GTT**
24420879-A-ATT 22274732-A-ATT 43×T**
23881876-C-A 21719990-C-A 18×A**
58984359-A-T 56838212-A-T **
20022432-C-A 17910552-C-A P5_Prx **
13138818-T-C 10628304-T-C **
10015012-G-T 10177403-G-T **
59022271-C-A 56876124-C-A 50×A**
5785352-C-CA 5917311-C-CA 9×A**
22360134-TT-G 20198248-TT-G DYZ19 **
6756908-C-A 6888867-C-A 26×A**
20510855-G-T 18348969-G-T P5_Dst **
20654981-AATATAT-A 18493095-AATATAT-A P4_Prx 21×AT**
13347932-T-TACAC 11192256-T-TACAC 21×AC**
22694141-G-A 20532255-G-A FGC49054 **
15080781-C-A 12968871-C-A **
58989545-A-G 56843398-A-G **
5563117-TACAC-T 5695076-TACAC-T 16×AC**
18210984-C-A 16099104-C-A **
4417570-A-AT 4549529-A-AT 10×T**
7160586-CTTTT-C 7292545-CTTTT-C 15×T**
19829262-G-T 17717382-G-T P5_Prx **
16989162-C-A 14877282-C-A **
2772300-T-A 2904259-T-A **
3000028-G-A 3131987-G-A **
3146671-C-A 3278630-C-A **
3147950-T-C 3279909-T-C **
3328952-T-C 3460911-T-C **
3440407-C-A 3572366-C-A **
3501151-G-A 3633110-G-A FTB69275 **
3652014-T-C 3783973-T-C **
3689280-A-G 3821239-A-G **
3820824-G-T 3952783-G-T **
3820860-G-T 3952819-G-T **
3857997-T-G 3989956-T-G **
3864925-C-A 3996884-C-A **
3876027-A-G 4007986-A-G **
4077354-C-A 4209313-C-A **
4088442-A-G 4220401-A-G **
4115213-TG-T 4247172-TG-T **
4179263-C-A 4311222-C-A **
4242932-C-A 4374891-C-A **
4270696-G-T 4402655-G-T **
4270718-G-T 4402677-G-T **
4380114-T-C 4512073-T-C **
4409011-C-A 4540970-C-A **
4412188-A-G 4544147-A-G **
4470883-T-C 4602842-T-C **
4472327-G-A 4604286-G-A **
4549335-C-A 4681294-C-A **
4580507-T-C 4712466-T-C **
4604421-C-A 4736380-C-A **
4785248-C-A 4917207-C-A **
5200193-G-T 5332152-G-T **
5221043-CTTT-C 5353002-CTTT-C 14×T**
5292695-A-T 5424654-A-T **
5336107-G-T 5468066-G-T **
5359083-G-T 5491042-G-T **
5367777-G-T 5499736-G-T **
5465322-G-T 5597281-G-T **
5605955-C-A 5737914-C-A **
5606851-G-C 5738810-G-C **
5676363-C-A 5808322-C-A **
5710722-T-C 5842681-T-C **
5785440-C-A 5917399-C-A **
5786069-A-G 5918028-A-G **
5861662-C-T 5993621-C-T **
5887638-T-G 6019597-T-G **
5926664-T-C 6058623-T-C **
5941765-G-T 6073724-G-T **
5947479-C-A 6079438-C-A **
5983454-C-A 6115413-C-A **
6013038-A-G 6144997-A-G **
6025254-C-T 6157213-C-T **
6090375-T-G 6222334-T-G **
6208078-A-G 6340037-A-G IR3_Dst **
6384537-A-T 6516496-A-T **
6445452-C-A 6577411-C-A **
6516316-C-A 6648275-C-A **
6576649-C-A 6708608-C-A **
6641100-G-T 6773059-G-T **
6641144-A-G 6773103-A-G **
6646672-T-C 6778631-T-C **
6654529-C-A 6786488-C-A **
6664481-T-C 6796440-T-C **
6729460-C-T 6861419-C-T **
6765787-C-A 6897746-C-A **
7012618-C-A 7144577-C-A **
7016271-T-G 7148230-T-G **
7039214-T-C 7171173-T-C **
7127648-C-A 7259607-C-A **
7138427-A-G 7270386-A-G **
7237774-C-A 7369733-C-A **
7243531-C-A 7375490-C-A **
7298492-C-A 7430451-C-A **
7360568-A-T 7492527-A-T FT192339 **
7371818-G-T 7503777-G-T **
7391870-C-A 7523829-C-A **
7422409-C-A 7554368-C-A **
7650452-C-A 7782411-C-A **
7664666-T-A 7796625-T-A **
7829525-C-A 7961484-C-A **
7861427-C-A 7993386-C-A **
7986070-GA-G 8118029-GA-G **
7996225-C-T 8128184-C-T **
8130554-A-G 8262513-A-G **
8159096-C-A 8291055-C-A **
8290977-C-A 8422936-C-A **
8379566-G-T 8511525-G-T **
8671906-C-A 8803865-C-A **
8734222-C-CAAA 8866181-C-CAAA 14×A**
9057463-C-A **
9057496-C-A FTB54151 **
9162887-G-T 9325278-G-T **
9181210-C-A 9343601-C-A **
9398059-C-A 9560450-C-A **
9402658-C-A 9565049-C-A **
9501176-T-A 9663567-T-A **
9502541-G-T 9664932-G-T **
9839445-C-A 10001836-C-A **
9940191-C-A 10102582-C-A **
9962580-T-C 10124971-T-C **
9986142-T-C 10148533-T-C **
10026244-C-A 10188635-C-A **
10034217-T-G 10196608-T-G **
10037712-G-T 10200103-G-T **
10618418-C-A **
10624117-G-A **
10628271-C-G **
10628282-C-A **
10628288-A-G **
10628304-T-TTCCAG **
10648157-C-A **
10653398-G-T **
10654329-C-A **
10656731-C-A **
10678256-C-A **
10683450-A-C **
10754335-AACTCCATCCC-A **
10754879-C-A **
10755386-CCACT-C **
10759348-A-T **
10769086-T-A **
10780839-C-A **
10784431-C-A **
10797677-C-T **
10808526-C-A **
10812635-T-C **
10824208-A-T **
10827290-C-A **
10836145-C-A **
10844433-C-A **
10861795-C-A **
10866401-C-A **
10872914-G-T **
10879322-C-A **
10880572-C-A **
10883808-AT-A **
10885372-C-T **
10890395-G-C **
10917756-A-G **
10918439-G-T **
10919701-G-T **
10921386-C-T **
10924436-T-C **
10929828-T-C **
10929837-G-T **
10932463-G-T **
10948386-C-T **
10950349-A-C **
10950350-C-A **
10954298-T-TTGCTC **
10954302-A-C **
10954321-CAT-C **
10956453-A-C **
10961373-T-C **
10961586-C-A **
10961589-C-T **
10975743-C-T **
10980352-T-A **
10983932-TTCCAC-T **
10987578-C-A **
10991337-T-A **
10994324-T-C **
10998184-A-G **
11016271-C-A **
11027768-A-C **
11027780-C-T **
11027782-G-C **
11027785-C-T **
11027790-C-T **
11032432-C-A **
11034130-T-C **
11037097-C-G **
11037135-C-G **
11037138-C-CCATTAG **
13200356-C-A 11044680-C-A **
13206451-C-A 11050775-C-A **
13229491-C-A 11073815-C-A **
13239409-T-A 11083733-T-A **
13295834-T-G 11140158-T-G **
13298549-C-T 11142873-C-T **
13304343-T-A 11148667-T-A **
13327838-C-A 11172162-C-A **
13523454-T-A 11367778-T-A **
13523474-T-A 11367798-T-A **
13610782-T-C 11455106-T-C **
13800912-G-T 11680206-G-T **
13857715-C-A 11737009-C-A **
13873893-C-A 11753187-C-A **
13884891-C-T 11764185-C-T **
13885885-G-T 11765179-G-T **
13888564-G-T 11767858-G-T **
13920109-C-A 11799403-C-A **
13940459-A-T 11819753-A-T **
13941637-G-A 11820931-G-A **
13942341-C-A 11821635-C-A **
13945877-G-T 11825171-G-T **
13949021-G-T 11828315-G-T **
13975077-A-T 11854371-A-T **
13993549-C-A 11872843-C-A **
14029244-C-A 11908538-C-A **
14073444-C-A 11952738-C-A **
14076766-C-A 11956060-C-A **
14100385-G-A 11979679-G-A **
14107187-A-G 11986481-A-G **
14108787-T-G 11988081-T-G **
14135235-CT-C 12014529-CT-C **
14196214-C-A 12075508-C-A **
14227530-C-A 12106824-C-A **
14235992-C-A 12115286-C-A **
14358396-C-A 12237691-C-A **
14398334-C-A 12277630-C-A **
14422588-C-A 12301863-C-A **
14425529-C-A 12304804-C-A **
14430340-C-A 12309613-C-A **
14474611-C-A 12353880-C-A **
14531398-A-C 12419599-A-C **
14531399-CT-C 12419600-CT-C **
14537921-C-A 12426122-C-A **
14620178-C-A 12508376-C-A **
14620331-T-A 12508529-T-A **
14718366-C-A 12606434-C-A **
14720353-C-A 12608421-C-A **
14742182-AT-A 12630250-AT-A **
14754121-T-C 12642190-T-C **
14760827-T-C 12648896-T-C **
14786372-G-A 12674442-G-A **
14799897-G-A 12687968-G-A **
14844425-C-A 12732491-C-A **
14959748-C-A 12847823-C-A **
14990753-G-T 12878838-G-T **
14994101-C-A 12882186-C-A **
14994140-AT-A 12882225-AT-A **
15177916-A-G 13066002-A-G **
15179034-A-AC 13067120-A-AC **
15202271-C-A 13090357-C-A **
15220982-T-A 13109068-T-A **
15231104-T-C 13119190-T-C **
15260717-A-T 13148801-A-T **
15342646-CTG-C 13230765-CTG-C **
15394498-G-A 13282618-G-A **
15423176-G-T 13311296-G-T **
15424336-T-G 13312456-T-G **
15442441-T-C 13330561-T-C **
15730488-C-A 13618608-C-A **
15749113-C-T 13637233-C-T **
15882047-C-G 13770167-C-G **
15893980-G-T 13782100-G-T **
15931725-C-A 13819845-C-A **
16007273-C-A 13895393-C-A **
16027461-G-A 13915581-G-A **
16033671-C-A 13921791-C-A **
16050112-C-A 13938232-C-A **
16053670-C-A 13941790-C-A **
16055595-G-A 13943715-G-A **
16074986-C-A 13963106-C-A **
16118600-T-C 14006720-T-C P8_Prx **
16241671-T-C 14129791-T-C **
16277871-C-A 14165991-C-A **
16357114-C-A 14245234-C-A **
16423742-T-A 14311862-T-A **
16493130-C-A 14381250-C-A **
16506080-C-A 14394200-C-A **
16624539-C-A 14512659-C-A **
16662456-G-C 14550576-G-C **
16676823-C-T 14564943-C-T **
16848497-G-A 14736617-G-A FT139281 **
16904661-C-T 14792781-C-T **
17053184-A-G 14941304-A-G **
17122426-C-A 15010546-C-A **
17363031-C-A 15251151-C-A **
17382340-C-G 15270460-C-G **
17433843-G-A 15321963-G-A **
17548189-G-A 15436309-G-A **
17589161-C-A 15477281-C-A **
17617433-C-A 15505553-C-A **
17930019-A-G 15818139-A-G **
18086375-G-T 15974495-G-T **
18185961-G-C 16074081-G-C **
18186039-A-G 16074159-A-G **
18190578-C-A 16078698-C-A **
18263667-C-A 16151787-C-A **
18270414-C-T 16158534-C-T **
18390137-C-A 16278257-C-A P6_Gap **
18407304-C-A 16295424-C-A P6_Gap **
18410848-G-T 16298968-G-T P6_Gap **
18447623-T-TC 16335743-T-TC P6_Dst **
18512577-G-T 16400697-G-T P6_Dst **
18688512-A-C 16576632-A-C **
18728855-C-A 16616975-C-A **
18789697-A-G 16677817-A-G **
18795123-T-G 16683243-T-G **
18858626-TG-T 16746746-TG-T **
18872153-T-A 16760273-T-A ****
19062233-C-A 16950353-C-A **
19079129-C-A 16967249-C-A **
19129105-C-A 17017225-C-A **
19155902-C-A 17044022-C-A **
19312371-A-T 17200491-A-T **
19331418-C-A 17219538-C-A **
19388090-C-A 17276210-C-A **
19388198-T-G 17276318-T-G FT423846 **
19393140-T-C 17281260-T-C FT298064 **
19418241-C-A 17306361-C-A **
19418311-T-C 17306431-T-C **
19560762-A-G 17448882-A-G **
19622003-T-C 17510123-T-C P5_Prx **
19732406-T-C 17620526-T-C P5_Prx **
20001984-C-A 17890104-C-A P5_Prx **
20387279-A-AG 18225393-A-AG P5_Dst **
20645749-T-A 18483863-T-A P4_Prx **
20989114-C-T 18827228-C-T P4_Dst **
21125229-C-A 18963343-C-A **
21139525-C-A 18977639-C-A **
21208851-C-A 19046965-C-A **
21208939-C-A 19047053-C-A **
21269195-A-T 19107309-A-T **
21456052-C-A 19294166-C-A **
21522492-A-T 19360606-A-T **
21543370-CTTTGTAAT-C 19381484-CTTTGTAAT-C **
21597172-C-A 19435286-C-A **
21672164-T-A 19510278-T-A **
21963808-C-A 19801922-C-A **
21963858-C-A 19801972-C-A **
22056439-A-C 19894553-A-C **
22100974-G-A 19939088-G-A **
22132819-C-A 19970933-C-A **
22146542-G-A 19984656-G-A **
22166618-C-A 20004732-C-A **
22198804-TG-T 20036918-TG-T **
22211468-G-A 20049582-G-A **
22314768-A-G 20152882-A-G DYZ19 **
22545425-G-T 20383539-G-T **
22637682-A-G 20475796-A-G **
22696222-A-T 20534336-A-T **
22765800-T-A 20603914-T-A **
22765806-G-T 20603920-G-T **
22765809-A-T 20603923-A-T **
22765814-A-T 20603928-A-T **
22782371-A-G 20620485-A-G **
22800170-C-A 20638284-C-A **
22801028-C-A 20639142-C-A **
22810808-T-C 20648922-T-C **
22851445-G-A 20689559-G-A **
23007842-C-T 20845956-C-T **
23009761-C-A 20847875-C-A **
23036695-AAAAAG-A 20874809-AAAAAG-A **
23079183-G-A 20917297-G-A **
23199873-C-T 21037987-C-T FT229760 **
23276522-C-A 21114636-C-A **
23341664-C-T 21179778-C-T **
23358722-C-A 21196836-C-A **
23395900-T-C 21234014-T-C **
23438868-C-T 21276982-C-T **
23438879-C-T 21276993-C-T 21×T**
23563930-T-C 21402044-T-C **
23603174-C-A 21441288-C-A **
21764182-C-A **
23953343-C-A 21807196-C-A **
23997057-C-A 21850910-C-A **
24513249-C-A 22367102-C-A **
24550023-G-A 22403876-G-A P3_t2 **
25804789-C-A 23658642-C-A P1_b3 **
26565651-C-T 24419504-C-T P1_g2 **
27562059-C-G 25415912-C-G P1_Y2 **
27821121-G-GC 25674974-G-GC P1_Y2 **
28391033-A-G 26244886-A-G P1_gr2 **
28480377-C-A 26334230-C-A **
28509524-T-C 26363377-T-C **
28513584-T-C 26367437-T-C **
28513585-G-A 26367438-G-A **
28513599-A-G 26367452-A-G **
28513606-G-A 26367459-G-A FT340674 **
28513652-C-A 26367505-C-A **
28521855-T-A 26375708-T-A **
28546943-G-A 26400796-G-A **
28567371-C-G 26421224-C-G **
28640032-T-G 26493885-T-G **
28666972-TG-T 26520825-TG-T **
28700751-A-T 26554604-A-T **
28711953-C-G 26565806-C-G **
28711955-G-A 26565808-G-A **
28773973-G-A 26627826-G-A **
28774824-G-T 26628677-G-T **
56824708-T-A **
56835401-C-A **
56840148-G-A **
56840716-G-T **
56841071-C-A **
56843329-C-G **
56843333-A-C **
56843341-C-A **
56843369-C-A **
56843378-G-T **
56843380-A-T **
56843380-A-ATG **
56843385-C-G **
56843387-C-A **
56843392-C-T **
56843400-T-C **
56843413-A-C **
56843576-A-T **
56845866-C-T **
56845893-A-G **
56880437-C-A **
13461-C-T **
13464-T-A **
36736-A-T FGC80565 **
20652995-CAAAA-C 18491109-CAAAA-C P4_Prx 18×A**
27873290-C-A 25727143-C-A P1_Y2 **
10949553-A-G *****
22295992-G-T 20134106-G-T DYZ19 **
20886779-TAA-T 18724893-TAA-T P4_Dst 32×A**
18479589-A-AT 16367709-A-AT P6_Dst **
16096771-T-G 13984891-T-G **
5248486-A-C 5380445-A-C **
13608401-G-A 11452725-G-A **
13608406-C-A 11452730-C-A **
13608408-G-A 11452732-G-A **
13608416-T-C 11452740-T-C **
13608417-G-A 11452741-G-A **
13608422-T-A 11452746-T-A **
13608423-T-C 11452747-T-C **
13608437-C-T 11452761-C-T **
4619860-G-A 4751819-G-A **
5905918-GAATC-AGAATA 6037877-GAATC-AGAATA **
6119254-G-T 6251213-G-T **
6123582-G-T 6255541-G-T **
13724122-G-T 11568446-G-T **
13726354-CCAA-TGAC 11570678-CCAA-TGAC **
18872153-TCTTTTTCTTTC-ACTT 16760273-TCTTTTTCTTTC-ACTT **
19326923-A-G 17215043-A-G **
21743848-G-T 19581962-G-T **
6204075-T-C 6336034-T-C IR3_Dst **
9605871-T-TAA 9768262-T-TAA IR3_Prx 16×A**
17543756-G-A 15431876-G-A **
17543767-A-G 15431887-A-G **
18483374-TAAA-T 16371494-TAAA-T P6_Dst 27×A**
20083963-A-T 17972083-A-T P5_Dst **
20247241-G-T 18085355-G-T P5_Dst **
20366202-A-C 18204316-A-C P5_Dst **
20373182-G-A 18211296-G-A P5_Dst **
20478953-CAA-C 18317067-CAA-C P5_Dst 15×A**
20510959-GGATTT-TGA 18349073-GGATTT-TGA P5_Dst **
20757361-CATTT-AA 18595475-CATTT-AA P4_Prx **
22356092-G-C 20194206-G-C DYZ19 **
22360349-G-T 20198463-G-T DYZ19 **
22422025-GTC-TGT 20260139-GTC-TGT DYZ19 **
24590318-C-T 22444171-C-T P3_t2 **
25020601-T-C 22874454-T-C g1 **
25409998-C-T 23263851-C-T P2_r2 **
25906264-A-G 23760117-A-G P1_Y1 **
25954084-CTTT-C 23807937-CTTT-C P1_Y1 **
26099825-TTGTCTCTC-GTG 23953678-TTGTCTCTC-GTG P1_Y1 **
27058790-C-A 24912643-C-A P1_r4 **
27162988-T-TA 25016841-T-TA P1_g3 22×A**
27165197-ATT-A 25019050-ATT-A P1_g3 11×T**
27525761-CA-C 25379614-CA-C P1_Y2 **
27539324-CGCC-TGCT 25393177-CGCC-TGCT P1_Y2 **
27616494-CT-C 25470347-CT-C P1_Y2 9×T**
27663819-C-A 25517672-C-A P1_Y2 **
27731538-C-T 25585391-C-T P1_Y2 **
27901152-G-A 25755005-G-A P1_Y2 **
27972426-T-C 25826279-T-C P1_Y2 **
28016701-T-C 25870554-T-C P1_Y2 **
28398433-T-A 26252286-T-A P1_gr2 **
22363261-TG-T 20201375-TG-T DYZ19 ***
19792489-AT-A 17680609-AT-A P5_Prx 13×T***
58976452-T-C 56830305-T-C ***
27785784-TA-T 25639637-TA-T P1_Y2 10×A***
22362547-G-A 20200661-G-A DYZ19 ***
18480300-GTT-G 16368420-GTT-G P6_Dst 25×T***
22484137-C-G 20322251-C-G DYZ19 ***
24686428-C-CT 22540281-C-CT P3_b2 23×T***
22486076-G-T 20324190-G-T FGC45793 DYZ19 ***
26318196-G-GT 24172049-G-GT P1_Y1 12×T***
22431331-A-G 20269445-A-G DYZ19 ***
22431358-G-T 20269472-G-T DYZ19 ***
22427903-G-A 20266017-G-A DYZ19 ***
22427904-C-G 20266018-C-G DYZ19 ***
22435596-C-A 20273710-C-A DYZ19 ***
26286101-AT-A 24139954-AT-A P1_Y1 ***
9030492-AG-A 9192883-AG-A ***
22255778-T-C 20093892-T-C DYZ19 ***
22455657-C-G 20293771-C-G BY22806 DYZ19 ***
22443895-T-C 20282009-T-C DYZ19 ***
22431313-G-A 20269427-G-A DYZ19 ***
15305843-AAATAAT-A,AAAT 13193942-AAATAATAAT-A,AAAT 15×AAT***
24069806-T-C 21923659-T-C FGC45243 P3_b1 ***
22507425-C-T 20345539-C-T DYZ19 ***
13378444-AT-A 11222768-AT-A 12×T***
25513737-CA-C 23367590-CA-C P1_gr1 12×A***
22300619-T-G 20138733-T-G DYZ19 ***
59013640-TTTTTT-A 56867493-TTTTTT-A ***
22454880-A-G 20292994-A-G DYZ19 ***
22431382-G-A 20269496-G-A DYZ19 ***
18370847-CT-C 16258967-CT-C P6_Prx 25×T***
2860279-C-T 2992238-C-T ***
4241587-C-A 4373546-C-A ***
7897255-G-T 8029214-G-T ***
8705698-C-CTT 8837657-C-CTT 16×T***
9334618-C-T 9497009-C-T ***
9852489-C-A 10014880-C-A ***
9963466-T-G 10125857-T-G ***
10662845-C-A ***
10667029-C-A ***
10693259-CT-C ***
10752521-C-A ***
10845721-C-T ***
10845727-A-C ***
10845729-T-A ***
10879028-C-A ***
10879046-C-A ***
10880366-C-A ***
10899962-A-G ***
10958382-T-C ***
13225929-C-T 11070253-C-T FT396994 ***
13488892-C-G 11333216-C-G ***
14502084-T-TAA 12390289-T-TAA 10×A***
15404329-G-GAA 13292449-G-GAA 13×A***
15430569-C-A 13318689-C-A ***
15865620-C-A 13753740-C-A ***
16707544-G-T 14595664-G-T ***
18271018-GTTT-G,GTTTT 16159138-GTTT-G,GTTTT 17×T***
18354245-GAA-G,GAG 16242365-GAA-G,GAG P6_Prx ***
18354249-GAA-G 16242369-GAA-G P6_Prx ***
18972998-C-A 16861118-C-A ***
21737903-G-A 19576017-G-A ***
22849491-CTTT-C,CT 20687605-CTTT-C,CT 20×T***
23742122-C-T 21580236-C-T ***
13246880-GAAAAA-G 27×A***
28816020-G-T 26669873-G-T ***
9075188-C-CTT 9237579-C-CTT 20×T***
18013954-ATG-A 15902074-ATG-A P7_Dst 9×TG***
10955258-TTCAAC-T ***
2752415-TAAA-T,TAAAA 2884374-TAAA-T,TAAAA 23×A***
24336793-CTT-C 22190646-CTT-C P3_t1 20×T***
2888870-CAAAA-C 3020829-CAAAA-C 32×A***
17361058-CAA-C,CA 15249178-CAA-C,CA 25×A***
22970282-CAAAA-C,CAAA 20808396-CAAAA-C,CAAA 27×A***
14413210-CAA-C,CAAA 12292507-CAA-C,CAAA 23×A***
15410664-G-T 13298784-G-T ***
21827606-C-CAA 19665720-C-CAA 21×A***
24668883-AT-A 22522736-AT-A P3_b2 12×T***
5231890-CT-C,CTT 5363849-CT-C,CTT 22×T***
7142395-C-T 7274354-C-T ***
7939472-TAAAAAAAAAAA-T,TA 8071431-TAAAAAAAAAAA-T,TA 35×A******
9804830-C-A 9967221-C-A ******
14121165-T-C 12000459-T-C ***
12372815-ATTTTT-A,ATT ***
18040347-TA-T 15928467-TA-T ******
18040352-ATTAT-A 15928472-ATTAT-A ***
18568071-T-A 16456191-T-A ***
19183814-CTTTTTTTT-C,CTTTTTTT 17071934-CTTTTTTTT-C,CTTTTTTT 28×T***
19546258-A-AT 17434378-A-AT ***
23019500-G-A 20857614-G-A ***
27847931-G-GT 25701784-G-GT P1_Y2 11×T***
9967013-CAATA-TAATT 10129404-CAATA-TAATT ***
3181857-CAAA-C,CAAAA 3313816-CAAA-C,CAAAA 20×A***
10079819-T-G 10242210-T-G ***
13486743-TACCTG-CACTTA 11331067-TACCTG-CACTTA ***
13965269-CA-C,CAAA 11844563-CA-C,CAAA 21×A***
17632570-GTTT-G,GTTTT 15520690-GTTT-G,GTTTT 22×T***
19469877-AC-A,C 17357997-AC-A,C 12×C***
21980001-CAA-C,CA 19818115-CAA-C,CA 27×A***
23197360-CAA-C,CAAA 21035474-CAA-C,CAAA 17×A***
28700764-TAC-T,TAT 26554617-TAC-T,TAT 13×AC***
56856389-CCTA-ACTC ***
56862619-ATCTTTTTTTTTTTTTT-ATCTTTTTTTTTTTTTG,CTCTTTTTTTTTTT ***
6447774-G-GT,GTT 6579733-G-GT,GTT 16×T***
7003246-C-A 7135205-C-A ***
7123183-C-G 7255142-C-G ***
7123194-T-G 7255153-T-G ***
7123217-GAC-AAT 7255176-GAC-AAT ***
9652158-TTA-T 9814549-TTA-T IR3_Prx 11×TA***
9662670-T-C 9825061-T-C IR3_Prx ***
16102884-GT-G 13991004-GT-G P8_Prx 13×T***
16126277-A-G 14014397-A-G P8_Prx ***
16143491-A-T 14031611-A-T P8_Dst ***
18521396-T-C 16409516-T-C P6_Dst ***
19917917-T-C 17806037-T-C P5_Prx ***
20088126-T-C 17976246-T-C P5_Dst ***
20114701-A-G 18002821-A-G P5_Dst ***
20196323-CA-C,CAA 18034437-CA-C,CAA P5_Dst 10×A***
20273852-C-T 18111966-C-T P5_Dst ***
20274131-T-C 18112245-T-C P5_Dst ***
20295499-CT-C,CTT 18133613-CT-C,CTT P5_Dst 11×T***
20307241-A-G 18145355-A-G P5_Dst ***
20432597-C-G 18270711-C-G P5_Dst ***
20439755-A-G 18277869-A-G P5_Dst ***
20472047-G-T 18310161-G-T P5_Dst ***
20506131-C-A 18344245-C-A P5_Dst ***
20581782-AT-A 18419896-AT-A P5_Dst 17×T***
20876592-A-T 18714706-A-T P4_Dst ***
20989625-A-G 18827739-A-G P4_Dst ***
20995974-A-G 18834088-A-G P4_Dst ***
21014685-A-G 18852799-A-G P4_Dst ***
22235693-AAT-ACA,CCT 20073807-AAT-ACA,CCT DYZ19 ***
22357841-AGTGT-TGTGG 20195955-AGTGT-TGTGG DYZ19 ***
22422007-TCCA-ACAT 20260121-TCCA-ACAT DYZ19 ***
22431402-T-C 20269516-T-C DYZ19 ***
22448043-T-A 20286157-T-A DYZ19 ***
22473882-GTA-ATT 20311996-GTA-ATT DYZ19 ***
22488201-CTGA-GTGT 20326315-CTGA-GTGT DYZ19 ***
22502688-GCACG-ACACT,CCACT 20340802-GCACG-ACACT,CCACT DYZ19 ***
22503330-A-C,G 20341444-A-C,G DYZ19 ***
24015709-G-T 21869562-G-T ***
24534541-T-C 22388394-T-C P3_t2 ***
24607321-CT-C,CTT 22461174-CT-C,CTT P3_t2 12×T***
24617915-T-C 22471768-T-C P3_t2 ***
24627276-G-T 22481129-G-T P3_t2 ***
24778870-T-C 22632723-T-C P3_b2 ***
25177326-CAA-C 23031179-CAA-C g1 24×A***
25291085-G-A 23144938-G-A P2_r1 ***
25662890-C-CA,CAA 23516743-C-CA,CAA P1_b3 15×A***
26884389-GTGTC-C,GTG 24738242-GTGTC-C,GTG P1_r3 4×TGTC***
27245617-A-T 25099470-A-T P1_g3 ***
27342704-G-T 25196557-G-T P1_g3 ***
27362559-G-A 25216412-G-A P1_g3 ***
27380076-T-C 25233929-T-C P1_g3 ***
27382114-C-T 25235967-C-T P1_g3 ***
27430999-G-T 25284852-G-T P1_g3 ***
27497800-C-T 25351653-C-T P1_Y2 ***
27559900-C-T 25413753-C-T P1_Y2 ***
27709844-C-T 25563697-C-T P1_Y2 ***
27817228-C-A 25671081-C-A P1_Y2 ***
27867901-A-G 25721754-A-G P1_Y2 ***
27882520-T-A 25736373-T-A P1_Y2 ***
27890433-T-TA 25744286-T-TA P1_Y2 ***
28003339-CT-C 25857192-CT-C P1_Y2 ***
28003350-G-C 25857203-G-C P1_Y2 ***
28027095-C-A 25880948-C-A P1_Y2 ***
28080112-G-T 25933965-G-T P1_Y2 ***
28112612-A-G 25966465-A-G P1_Y2 ***
28119835-C-T 25973688-C-T P1_b4 ***
28120095-T-C 25973948-T-C P1_b4 ***
28245714-ATT-A 26099567-ATT-A P1_b4 15×T***
28351496-A-G 26205349-A-G P1_gr2 ***
28358888-A-G 26212741-A-G P1_gr2 ***
28358909-T-C 26212762-T-C P1_gr2 ***
28399091-G-A 26252944-G-A P1_gr2 ***
28400905-C-A 26254758-C-A P1_gr2 ***
28401420-T-C 26255273-T-C P1_gr2 ***
28404622-G-C 26258475-G-C P1_gr2 ***
28404648-CT-TG 26258501-CT-TG P1_gr2 ***
28408558-T-C 26262411-T-C P1_gr2 ***
28412330-A-G 26266183-A-G P1_gr2 ***
28416927-A-G 26270780-A-G P1_gr2 ***
28418294-C-T 26272147-C-T P1_gr2 ***
28418303-G-T 26272156-G-T P1_gr2 ***
28421153-C-T 26275006-C-T P1_gr2 ***
27617980-CAAA-C 25471833-CAAA-C P1_Y2 29×A***

In the table above, the meaning of the confidence field depends on whether the data comes from an FTDNA kit or an FGC kit. For FTDNA kits, + implies a "PASS" result with just one possible variant, * indicates a "PASS" but with multiple variants, ** indicates "REJECTED" with just a single variant, and *** indicates "REJECTED" with multiple possible variants. 'A*' are heterozygous variants not called by FTDNA, but still pulled from the VCF file. For FGC kits, + indicates over 99% likely genuine (95% for INDELs); * over 95% likely genuine (90% for INDELs); ** about 40% likely genuine; *** about 10% likely genuine. Manual entries read directly from a BAM file will be either + indicating positive, or * indicating that the data show a mixture of possible variants.

For the FTDNA kits, the BED data is encoded in the background color of the cells. Those cells with a white background have coverage, those with a grey background indicate no coverage in the BED file, and those with a pink background indicate the mutation is on the edge of a coverage region. These pink regions often indicate that the individual may be positive for a SNP even if there is no corresponding entry in the vcf file.

The combBED column indicates whether or not the mutation is a SNP and falls in the combBED region defined in Defining a New Rate Constant for Y-Chromosome SNPs based on Full Sequencing Data by Dmitry Adamov, Vladimir Guryanov, Sergey Karzhavin, Vladimir Tagankin, Vadim Urasin.

The McDonald BED column indicates whether or not the mutation is a SNP and falls in the BED region used by Dr. Iain McDonald in the age analysis he does for R-U106 men.

Mutation Notes:

Kit POSITION-REF-ALT (hg19) POSITION-REF-ALT (hg38) Note
Manual6274770-G-A6406729-G-A2A 2G