Crist

BigY3: 917646
MDKA Birth: Switzerland > JU

Tree Position

R-P312/S116 > Z40481 > ZZ11 > DF27/S250 > Z195/S355 > Z272 > S450

Unique Mutations

The mutations unique to this man are summarized in the table below. Those with a '+' or '*' confidence level are considered by FamilyTreeDNA or FullGenomesCorp to be high quality SNPs/INDELs. For completeness, all other mutations of lesser confidence are included as well. These additional mutations may be useful for distinguishing between very closely related men.

Occasionally, some of the mutations listed here will be thought to be shared with other men in which case they might appear in upstream blocks on the tree. When this happens, the 'Blocks' field will indicate what block they appear in. Such a situation might arise with BigY men if the BED data suggests another man may be positive for a SNP, even though it doesn't appear in his VCF data. It might also happen if Chromo2 testing or Sanger sequencing of other men not on the tree show the SNP to be shared.

POS-REF-ALT (hg19) POS-REF-ALT (hg38) Blocks Names Region McDonald BED combBED STRBigY3
917646
25587242-C-T 23441095-C-T P1_gr1 14×TA*
5581941-A-AT 5713900-A-AT 12×TA*
56835155-A-T A*
14559921-C-G 12448122-C-G YA*
13687692-G-A 11532016-G-A A*
13448984-C-A 11293308-C-A A*
13449944-C-A 11294268-C-A A*
13687234-A-G 11531558-A-G A*
19693549-T-G 17581669-T-G P5_Prx A*
19767079-G-A 17655199-G-A P5_Prx A*
19810373-G-GT 17698493-G-GT P5_Prx A*
20222945-T-A 18061059-T-A P5_Dst A*
25535872-G-T 23389725-G-T P1_gr1 A*
28817654-G-A 26671507-G-A A*
18861458-T-G 16749578-T-G L1335/S530M10953 S738 AM01356 Y+
4103186-T-A 4235145-T-A FT191567 +
2746441-C-T 2878400-C-T FT191241 YY+
3601561-G-A 3733520-G-A FT191439 +
3987767-A-G 4119726-A-G FT191545 +
5354342-G-A 5486301-G-A FT191904 +
5855743-T-G 5987702-T-G FT192045 +
6383028-C-A 6514987-C-A FT192121 +
7009647-C-G 7141606-C-G FT192258 YY+
7104307-C-T 7236266-C-T FT192289 YY+
7176933-G-A 7308892-G-A FT192304 YY+
7305719-TA-T 7437678-TA-T +
7315584-G-A 7447543-G-A YY+
7350085-G-A 7482044-G-A YY+
7823539-C-T 7955498-C-T FT192437 YY+
8285078-A-G 8417037-A-G FT192540 YY+
8404367-T-A 8536326-T-A FT192563 YY+
8465187-G-A 8597146-G-A FT192577 YY+
8854621-C-T 8986580-C-T FT192662 YY+
8870421-G-A 9002380-G-A BY76479 Y+
9077217-C-A 9239608-C-A FT192697 +
13219409-G-A 11063733-G-A FT441110 +
13238658-A-G 11082982-A-G FT441654 +
13831816-G-T 11711110-G-T FT192784 +
15493181-C-G 13381301-C-G FT193150 YY+
15703746-A-T 13591866-A-T BY103406 YY+
16170153-G-T 14058273-G-T FT285493 Y+
16227576-T-C 14115696-T-C FT193275 YY+
16551028-G-C 14439148-G-C FT193338 YY+
16953547-G-A 14841667-G-A FT193410 YY+
17804685-T-C 15692805-T-C YY+
19165067-G-A 17053187-G-A Y+
19498363-C-T 17386483-C-T BY129574 YY+
21177748-A-G 19015862-A-G FT193990 YY+
21620767-A-G 19458881-A-G YY+
21951522-A-C 19789636-A-C BY136641 YY+
22475131-G-A 20313245-G-A FT459715 DYZ19 +
22564274-C-T 20402388-C-T FT194256 YY+
22609429-C-T 20447543-C-T YY+
23278709-ACCCAT-A 21116823-ACCCAT-A +
23974016-G-A 21827869-G-A Y+
28503737-CAT-C 26357590-CAT-C +
21620494-G-GTACTA 19458608-G-GTACTA 12×TACTA*
22751973-G-GGA 20590087-G-GGA 12×GA*
3326616-G-C 3458575-G-C *
3712993-A-G 3844952-A-G BY57800 *
10877315-C-CTCCAT *
16345132-CTCCTCTTCT-C,CTCTTCTTCT 14233252-CTCCTCTTCT-C,CTCTTCTTCT *
13347932-TACAC-T 11192256-TACAC-T 21×AC**
16364135-T-C 14252255-T-C Z34248 **
13468990-A-G 11313314-A-G **
10654588-C-A **
19949650-C-A 17837770-C-A P5_Prx **
10871897-N-C **
16503475-A-G 14391595-A-G **
10002885-T-C 10165276-T-C **
10654584-C-T **
13611746-C-CT 11456070-C-CT 8×T**
19318206-T-G 17206326-T-G **
19949639-C-A 17837759-C-A P5_Prx **
21915607-G-A 19753721-G-A **
21915713-T-C 19753827-T-C **
22271231-G-A 20109345-G-A FT454290 DYZ19 **
22437900-G-A 20276014-G-A BY218451 DYZ19 **
22462173-C-A 20300287-C-A FT285494 DYZ19 **
23029343-C-T 20867457-C-T **
25604239-T-A 23458092-T-A P1_gr1 **
15890-A-G **
16250623-TG-T 14138743-TG-T ***
12730473-ATTTT-A 21×T***
23194817-CTTTT-C 21032931-CTTTT-C 24×T***
3916934-CAAAA-C 4048893-CAAAA-C 20×A***
4693388-TA-T 4825347-TA-T 10×A***
10987851-TTCCATTCCATTCCACTCCAC-T,TTCCATTCCATTCCATTCCAT ***
13489619-ACCCCCACCACCACCCACCACCC-A,ACACTCCACACACAAACCCCACCC 11333943-ACCCCCACCACCACCCACCACCC-A,ACACTCCACACACAAACCCCACCC ***
18863609-AT-A 16751729-AT-A 11×T***
5670104-CT-C 5802063-CT-C 11×T***
13453213-C-G 11297537-C-G ***
22624885-T-C 20462999-T-C ***
22936288-CTTTTTTTTTT-C 20774402-CTTTTTTTTTT-C 25×T***
15698321-G-GA 13586441-G-GA 8×A***
5388261-TA-T,TAA 5520220-TA-T,TAA 18×A***
16307702-T-A 14195822-T-A ***
7716479-T-A 7848438-T-A ***
7716481-T-G 7848440-T-G ***
4067369-TAAAA-T 4199328-TAAAA-T 26×A***
16883255-A-T 14771375-A-T ***
16883256-A-T 14771376-A-T ***
2866450-G-A 2998409-G-A ***
3244040-TA-T 3375999-TA-T ***
4134480-T-TC 4266439-T-TC ***
4286878-T-C 4418837-T-C ***
5557238-CAA-C,CAAA 5689197-CAA-C,CAAA 23×A***
7347401-A-G 7479360-A-G ***
13460551-T-C 11304875-T-C ***
16625282-G-T 14513402-G-T ***
17141709-CA-C,CAAA 15029829-CA-C,CAAA 21×A***
21196776-G-A 19034890-G-A ***
22202925-A-G 20041039-A-G ***
56850471-T-C ***

In the table above, the meaning of the confidence field depends on whether the data comes from an FTDNA kit or an FGC kit. For FTDNA kits, + implies a "PASS" result with just one possible variant, * indicates a "PASS" but with multiple variants, ** indicates "REJECTED" with just a single variant, and *** indicates "REJECTED" with multiple possible variants. 'A*' are heterozygous variants not called by FTDNA, but still pulled from the VCF file. For FGC kits, + indicates over 99% likely genuine (95% for INDELs); * over 95% likely genuine (90% for INDELs); ** about 40% likely genuine; *** about 10% likely genuine. Manual entries read directly from a BAM file will be either + indicating positive, or * indicating that the data show a mixture of possible variants.

For the FTDNA kits, the BED data is encoded in the background color of the cells. Those cells with a white background have coverage, those with a grey background indicate no coverage in the BED file, and those with a pink background indicate the mutation is on the edge of a coverage region. These pink regions often indicate that the individual may be positive for a SNP even if there is no corresponding entry in the vcf file.

The combBED column indicates whether or not the mutation is a SNP and falls in the combBED region defined in Defining a New Rate Constant for Y-Chromosome SNPs based on Full Sequencing Data by Dmitry Adamov, Vladimir Guryanov, Sergey Karzhavin, Vladimir Tagankin, Vadim Urasin.

The McDonald BED column indicates whether or not the mutation is a SNP and falls in the BED region used by Dr. Iain McDonald in the age analysis he does for R-U106 men.