Tree Position

R-M269 > L23 > L51 > P310 > L151 > Z46522 > S1194 > S1200 > S14328 > A8469

Unique Mutations

The mutations unique to this man are summarized in the table below. Those with a '+' or '*' confidence level are considered by FamilyTreeDNA or FullGenomesCorp to be high quality SNPs/INDELs. For completeness, all other mutations of lesser confidence are included as well. These additional mutations may be useful for distinguishing between very closely related men.

Occasionally, some of the mutations listed here will be thought to be shared with other men in which case they might appear in upstream blocks on the tree. When this happens, the 'Blocks' field will indicate what block they appear in. Such a situation might arise with BigY men if the BED data suggests another man may be positive for a SNP, even though it doesn't appear in his VCF data. It might also happen if Chromo2 testing or Sanger sequencing of other men not on the tree show the SNP to be shared.

Position Blocks Names Region McDonald BED combBED STRBigY3
7399
hg19:Y:19864174-T-C hg38:Y:17752294-T-C P5_Prx A+
hg19:Y:20315601-A-G hg38:Y:18153715-A-G P5_Dst A+
hg19:Y:20717077-C-A hg38:Y:18555191-C-A P4_Prx A*
hg19:Y:20340720-T-TA hg38:Y:18178834-T-TA P5_Dst 15×AA*
hg19:Y:2973568-G-A hg38:Y:3105527-G-A FT38164 A*
hg19:Y:3035139-G-A hg38:Y:3167098-G-A A*
hg19:Y:3927608-T-C hg38:Y:4059567-T-C A*
hg19:Y:21030546-T-TA hg38:Y:18868660-T-TA P4_Dst 13×AA*
hg19:Y:25998964-A-C hg38:Y:23852817-A-C P1_Y1 A*
hg19:Y:19798564-C-T hg38:Y:17686684-C-T P5_Prx A*
hg19:Y:13867427-G-A hg38:Y:11746721-G-A DYZ17 A*
hg19:Y:28817433-C-A hg38:Y:26671286-C-A A*
hg19:Y:13478056-G-A hg38:Y:11322380-G-A A*
hg38:Y:56833573-C-T A*
hg19:Y:13450676-G-A hg38:Y:11295000-G-A A*
hg19:Y:21031185-T-G hg38:Y:18869299-T-G P4_Dst YA*
hg19:Y:18353140-G-A hg38:Y:16241260-G-A P6_Prx A*
hg19:Y:18353141-T-C hg38:Y:16241261-T-C P6_Prx A*
hg19:Y:19762360-G-A hg38:Y:17650480-G-A P5_Prx A*
hg19:Y:20417417-C-T hg38:Y:18255531-C-T P5_Dst A*
hg19:Y:20765314-G-C hg38:Y:18603428-G-C P4_Prx A*
hg19:Y:26207663-C-T hg38:Y:24061516-C-T P1_Y1 A*
hg19:Y:9519801-T-G hg38:Y:9682192-T-G PF3202Y17271 +
hg19:Y:8845437-G-A hg38:Y:8977396-G-A Y88161 YY+
hg19:Y:14612335-TGATAGATAGATA-T hg38:Y:12500541-TGATAGATAGATA-T 12×GATA+
hg19:Y:22443775-A-T hg38:Y:20281889-A-T ZP110BY24483 DYZ19 +
hg19:Y:21398583-A-T hg38:Y:19236697-A-T BY1746 FGC50142 YY9×T+
hg38:Y:10796028-C-T FT120200 +
hg38:Y:11011492-C-A BY82517 BY158512FGC77964 +
hg19:Y:13858732-CTGGAATGGAATGGAA-C hg38:Y:11738026-CTGGAATGGAATGGAA-C DYZ17 5×TGGAA+
hg19:Y:2695891-G-A hg38:Y:2827850-G-A BY55845 YY+
hg19:Y:2998403-C-T hg38:Y:3130362-C-T FT88218 +
hg19:Y:3646040-T-C hg38:Y:3777999-T-C FT88347 +
hg19:Y:3754919-C-A hg38:Y:3886878-C-A FT88376 +
hg19:Y:3826956-C-T hg38:Y:3958915-C-T FT88398 +
hg19:Y:3846134-G-A hg38:Y:3978093-G-A FT98808 +
hg19:Y:3947129-C-T hg38:Y:4079088-C-T FT88425 +
hg19:Y:4648198-C-T hg38:Y:4780157-C-T FT88618 +
hg19:Y:5294966-T-C hg38:Y:5426925-T-C FT88760 +
hg19:Y:5343654-G-T hg38:Y:5475613-G-T FT98982 +
hg19:Y:5680939-A-G hg38:Y:5812898-A-G FT88858 +
hg19:Y:6101149-C-A hg38:Y:6233108-C-A FT99070 +
hg19:Y:7013031-A-G hg38:Y:7144990-A-G BY62849 YY+
hg19:Y:7063732-C-T hg38:Y:7195691-C-T FT89027 YY+
hg19:Y:7157340-C-T hg38:Y:7289299-C-T YY+
hg19:Y:7367388-A-T hg38:Y:7499347-A-T YY+
hg19:Y:7374970-C-T hg38:Y:7506929-C-T FT89054 YY+
hg19:Y:7546772-G-A hg38:Y:7678731-G-A YY+
hg19:Y:7886521-T-C hg38:Y:8018480-T-C FT89084 YY+
hg19:Y:7928278-CT-C hg38:Y:8060237-CT-C +
hg19:Y:8019757-G-A hg38:Y:8151716-G-A YY+
hg19:Y:8148439-G-GT hg38:Y:8280398-G-GT +
hg19:Y:8366339-G-C hg38:Y:8498298-G-C YY+
hg19:Y:8446574-A-G hg38:Y:8578533-A-G YY+
hg19:Y:8462120-C-T hg38:Y:8594079-C-T BY176579 YY+
hg19:Y:8474417-G-T hg38:Y:8606376-G-T BY73146 YY+
hg19:Y:8643380-C-T hg38:Y:8775339-C-T BY74861 YY+
hg19:Y:8997793-T-A hg38:Y:9160184-T-A BY77145 Y+
hg19:Y:9155455-A-T hg38:Y:9317846-A-T BY78624 Y+
hg38:Y:10793008-T-G FT120201 +
hg38:Y:10831458-C-A FT120199 +
hg38:Y:10923720-A-C FT120198 +
hg19:Y:13218571-G-A hg38:Y:11062895-G-A FT120197 +
hg19:Y:13657813-G-A hg38:Y:11502137-G-A BY39514 DYZ17 +
hg19:Y:13824711-G-A hg38:Y:11704005-G-A FT89171 DYZ17 +
hg19:Y:14263774-C-G hg38:Y:12143068-C-G YY+
hg38:Y:12376046-TA-T +
hg19:Y:14498412-G-C hg38:Y:12386617-G-C YY+
hg19:Y:14712924-C-T hg38:Y:12600991-C-T YY+
hg19:Y:14719718-C-A hg38:Y:12607786-C-A FT89295 Y+
hg19:Y:15775534-G-A hg38:Y:13663654-G-A FT89357 Y+
hg19:Y:16765244-C-T hg38:Y:14653364-C-T BY109935 YY+
hg19:Y:16945900-A-C hg38:Y:14834020-A-C BY111305 YY+
hg19:Y:17156507-T-C hg38:Y:15044627-T-C BY112712 YY+
hg19:Y:17420772-T-C hg38:Y:15308892-T-C YY+
hg19:Y:17688639-C-T hg38:Y:15576759-C-T BY116684 YY+
hg19:Y:17801033-T-C hg38:Y:15689153-T-C BY117476 YY+
hg19:Y:18093686-G-C hg38:Y:15981806-G-C BY119950 Y+
hg19:Y:18708737-G-A hg38:Y:16596857-G-A BY123298 YY+
hg19:Y:19033837-G-A hg38:Y:16921957-G-A BY125648 YY+
hg19:Y:19448078-C-T hg38:Y:17336198-C-T YY+
hg19:Y:21269996-G-A hg38:Y:19108110-G-A FT99600 Y+
hg19:Y:21685640-T-C hg38:Y:19523754-T-C YY+
hg19:Y:21695707-G-A hg38:Y:19533821-G-A YY+
hg19:Y:22078396-C-T hg38:Y:19916510-C-T FT99651 YY+
hg19:Y:22141456-A-G hg38:Y:19979570-A-G YY+
hg19:Y:22513509-G-C hg38:Y:20351623-G-C FT89689 Y+
hg19:Y:22601047-C-T hg38:Y:20439161-C-T YY+
hg19:Y:22756152-C-G hg38:Y:20594266-C-G YY+
hg19:Y:22760099-G-A hg38:Y:20598213-G-A YY+
hg19:Y:22816850-G-C hg38:Y:20654964-G-C YY+
hg19:Y:23350432-T-C hg38:Y:21188546-T-C BY144767 YY+
hg19:Y:23383341-G-C hg38:Y:21221455-G-C YY+
hg19:Y:27863579-A-T hg38:Y:25717432-A-T BY177740 P1_Y2 +
hg19:Y:18115059-G-GTCTA hg38:Y:16003179-G-GTCTA 7×TCTA*
hg19:Y:22234031-A-G hg38:Y:20072145-A-G DYZ19 *
hg19:Y:9418243-TTGTG-T hg38:Y:9580634-TTGTG-T 17×TG*
hg38:Y:11015866-ACCATT-A *
hg38:Y:10661389-T-C *
hg38:Y:10694044-C-A *
hg19:Y:5051401-G-T hg38:Y:5183360-G-T *
hg19:Y:4813248-G-A hg38:Y:4945207-G-A FT88652 *
hg19:Y:6458992-CT-C,CTGTCACGACAATCAACAATTTCAAC hg38:Y:6590951-CT-C,CTGTCACGACAATCAACAATTTCAAC *
hg19:Y:18270619-G-GT hg38:Y:16158739-G-GT *
hg19:Y:26098001-TA-T hg38:Y:23951854-TA-T P1_Y1 22×A**
hg19:Y:6148749-C-A hg38:Y:6280708-C-A IR3_Dst 8×A**
hg19:Y:13466318-T-G hg38:Y:11310642-T-G **
hg19:Y:20778781-TTG-T hg38:Y:18616895-TTG-T P4_Prx 18×TG**
hg19:Y:26421474-CTG-C hg38:Y:24275327-CTG-C P1_Y1 24×TG**
hg19:Y:19187446-C-A hg38:Y:17075566-C-A 34×T**
hg19:Y:28818230-T-A hg38:Y:26672083-T-A **
hg19:Y:13466329-G-A hg38:Y:11310653-G-A **
hg19:Y:26199685-T-A hg38:Y:24053538-T-A P1_Y1 **
hg19:Y:19575932-CCTCT-C hg38:Y:17464052-CCTCT-C P5_Prx 10×CT**
hg38:Y:12372544-T-A A19225 **
hg19:Y:20486773-A-AG hg38:Y:18324887-A-AG P5_Dst **
hg19:Y:20280106-TC-T hg38:Y:18118220-TC-T P5_Dst **
hg19:Y:3451559-A-G hg38:Y:3583518-A-G **
hg19:Y:4698834-A-G hg38:Y:4830793-A-G FTB54781 **
hg19:Y:4841573-G-A hg38:Y:4973532-G-A **
hg19:Y:6818975-A-T hg38:Y:6950934-A-T **
hg19:Y:9916805-A-G hg38:Y:10079196-A-G **
hg19:Y:13433992-G-T hg38:Y:11278316-G-T **
hg19:Y:13668556-GAATGGAATGGAATCA-G hg38:Y:11512880-GAATGGAATGGAATCA-G DYZ17 **
hg38:Y:11671893-C-T DYZ17 **
hg19:Y:17839630-T-C hg38:Y:15727750-T-C **
hg19:Y:19608738-A-C hg38:Y:17496858-A-C P5_Prx **
hg19:Y:19609884-C-A hg38:Y:17498004-C-A P5_Prx **
hg19:Y:19675630-T-G hg38:Y:17563750-T-G P5_Prx **
hg19:Y:22298427-T-A hg38:Y:20136541-T-A BY177739 DYZ19 **
hg19:Y:22443087-C-T hg38:Y:20281201-C-T BY39515 DYZ19 **
hg19:Y:22466709-G-T hg38:Y:20304823-G-T BY177558 DYZ19 **
hg19:Y:26407093-T-G hg38:Y:24260946-T-G P1_Y1 **
hg19:Y:28669536-ACTC-A hg38:Y:26523389-ACTC-A **
hg38:Y2:12349-C-T **
hg19:Y:8125009-GAAGA-G hg38:Y:8256968-GAAGA-G 11×AAGA***
hg19:Y:9503771-A-ATATCTATC hg38:Y:9666162-A-ATATCTATC 12×TATC***
hg19:Y:13469182-G-A hg38:Y:11313506-G-A ***
hg19:Y:18393038-G-T hg38:Y:16281158-G-T P6_Gap ***
hg19:Y:14372869-T-TC hg38:Y:12252165-T-TC 12×C***
hg19:Y:2968166-GA-G hg38:Y:3100125-GA-G 13×A***
hg19:Y:4834281-C-A hg38:Y:4966240-C-A FT321849 ***
hg19:Y:4031513-CAA-C hg38:Y:4163472-CAA-C 16×A***
hg19:Y:13465977-C-A,T hg38:Y:11310301-C-A,T ***
hg19:Y:5047618-C-T hg38:Y:5179577-C-T ***
hg19:Y:13468563-T-G hg38:Y:11312887-T-G ***
hg19:Y:13468569-G-T hg38:Y:11312893-G-T ***
hg19:Y:13488453-G-A hg38:Y:11332777-G-A ***
hg19:Y:13461102-C-T hg38:Y:11305426-C-T ***
hg19:Y:13478048-C-T hg38:Y:11322372-C-T ***
hg19:Y:18981421-G-GA hg38:Y:16869541-G-GA 9×A***
hg19:Y:3514522-C-CT hg38:Y:3646481-C-CT 16×T***
hg19:Y:7135386-ATTTTT-A hg38:Y:7267345-ATTTTT-A 22×T***
hg19:Y:17926534-CA-C hg38:Y:15814654-CA-C 25×A***
hg38:Y:10763152-A-C ***
hg38:Y:10804780-T-TATTCC ***
hg19:Y:15406939-T-TA hg38:Y:13295059-T-TA 20×A***
hg19:Y:28724174-ATT-A hg38:Y:26578027-ATT-A 20×T***
hg38:Y:10691353-A-T ***
hg19:Y:19107403-TAA-T hg38:Y:16995523-TAA-T 14×A***
hg19:Y:15468678-C-CA hg38:Y:13356798-C-CA 23×A***
hg19:Y:15581093-C-CTT hg38:Y:13469213-C-CTT 16×T***
hg19:Y:14656154-CAAA-C hg38:Y:12544219-CAAA-C 24×A***
hg19:Y:23455053-ATTT-A hg38:Y:21293167-ATTT-A 14×T***
hg19:Y:9524019-GTATATATATATA-G,GTATATATA hg38:Y:9686410-GTATATATATATA-G,GTATATATA 21×TA***
hg19:Y:20213159-C-T hg38:Y:18051273-C-T P5_Dst ***
hg19:Y:5931916-CT-C hg38:Y:6063875-CT-C 32×T***
hg19:Y:15252803-CAAAAA-C hg38:Y:13140889-CAAAAA-C 19×A***
hg19:Y:14101081-C-T hg38:Y:11980375-C-T ***
hg19:Y:8181175-ATTTTTTTTTTTTTTTTTTTTTT-A,AT hg38:Y:8313134-ATTTTTTTTTTTTTTTTTTTTTT-A,AT 38×T***
hg19:Y:18035783-T-G hg38:Y:15923903-T-G ***
hg19:Y:14031744-TTCTTTC-T,TTCTT hg38:Y:11911038-TTCTTTC-T,TTCTT ***
hg19:Y:13469176-T-A hg38:Y:11313500-T-A ***
hg19:Y:19037742-A-ATTT hg38:Y:16925862-A-ATTT ***
hg19:Y:18762039-T-C hg38:Y:16650159-T-C ***
hg19:Y:18762042-G-A hg38:Y:16650162-G-A ***
hg19:Y:3603654-C-A hg38:Y:3735613-C-A ***
hg19:Y:5592779-TA-T hg38:Y:5724738-TA-T ***
hg19:Y:10081285-A-G hg38:Y:10243676-A-G ***
hg38:Y:10946586-G-A,T ***
hg38:Y:12374605-AC-A ***
hg19:Y:16318190-A-G hg38:Y:14206310-A-G ***
hg19:Y:20213138-C-CCTT hg38:Y:18051252-C-CCTT P5_Dst 6×CTT***
hg19:Y:21747704-C-CT hg38:Y:19585818-C-CT ***
hg19:Y:21796287-T-C hg38:Y:19634401-T-C ***
hg19:Y:22304199-C-A hg38:Y:20142313-C-A DYZ19 ***
hg19:Y:22319215-T-C hg38:Y:20157329-T-C DYZ19 ***
hg19:Y:22447155-T-A hg38:Y:20285269-T-A DYZ19 ***

In the table above, the meaning of the confidence field depends on whether the data comes from an FTDNA kit or an FGC kit. For FTDNA kits, + implies a "PASS" result with just one possible variant, * indicates a "PASS" but with multiple variants, ** indicates "REJECTED" with just a single variant, and *** indicates "REJECTED" with multiple possible variants. 'A*' are heterozygous variants not called by FTDNA, but still pulled from the VCF file. For FGC kits, + indicates over 99% likely genuine (95% for INDELs); * over 95% likely genuine (90% for INDELs); ** about 40% likely genuine; *** about 10% likely genuine. Manual entries read directly from a BAM file will be either + indicating positive, or * indicating that the data show a mixture of possible variants.

For the FTDNA kits, the BED data is encoded in the background color of the cells. Those cells with a white background have coverage, those with a grey background indicate no coverage in the BED file, and those with a pink background indicate the mutation is on the edge of a coverage region. These pink regions often indicate that the individual may be positive for a SNP even if there is no corresponding entry in the vcf file.

The combBED column indicates whether or not the mutation is a SNP and falls in the combBED region defined in Defining a New Rate Constant for Y-Chromosome SNPs based on Full Sequencing Data by Dmitry Adamov, Vladimir Guryanov, Sergey Karzhavin, Vladimir Tagankin, Vadim Urasin.

The McDonald BED column indicates whether or not the mutation is a SNP and falls in the BED region used by Dr. Iain McDonald in the age analysis he does for R-U106 men.

Age Analysis Information (work in progress)

AllMcDonaldYFull
Kit: 73991506344594245408342943
Used in age calculations1506344594245408342943
Counts of SNPs4440
Variant counts last updated 2026-06-09 02:59:31.



Big Tree Main Page