Ribeyre

BigY3: B203832
MDKA Birth: France

Tree Position

A0-T-YP2191 > P305[A1] > A1b > BT/A1b2 > M168/PF1416[CT] > M145/P205/PF144 > M96/PF1823 > P147 > P177 > M215 > M35 > L539 > Exact position not yet finalized.

Unique Mutations

The mutations unique to this man are summarized in the table below. Those with a '+' or '*' confidence level are considered by FamilyTreeDNA or FullGenomesCorp to be high quality SNPs/INDELs. For completeness, all other mutations of lesser confidence are included as well. These additional mutations may be useful for distinguishing between very closely related men.

Occasionally, some of the mutations listed here will be thought to be shared with other men in which case they might appear in upstream blocks on the tree. When this happens, the 'Blocks' field will indicate what block they appear in. Such a situation might arise with BigY men if the BED data suggests another man may be positive for a SNP, even though it doesn't appear in his VCF data. It might also happen if Chromo2 testing or Sanger sequencing of other men not on the tree show the SNP to be shared.

POS-REF-ALT (hg19) POS-REF-ALT (hg38) Blocks Names Region McDonald BED combBED STRBigY3
B203832
27885388-A-G 25739241-A-G P1_Y2 A+
24241658-G-T 22095511-G-T P3_b1 A*
20391463-A-AT 18229577-A-AT P5_Dst 10×TA*
13687228-G-A 11531552-G-A A*
13195466-G-T 11039790-G-T A*
6318011-T-C 6449970-T-C IR3_Dst A*
20486250-G-GA 18324364-G-GA P5_Dst 12×AA*
20957917-C-CCTTT 18796031-C-CCTTT P4_Dst 5×CTTTA*
27724383-C-CT 25578236-C-CT P1_Y2 12×TA*
6296522-T-C 6428481-T-C IR3_Dst A*
13687148-G-C 11531472-G-C A*
16152908-A-G 14041028-A-G P8_Dst A*
16159157-A-T 14047277-A-T P8_Dst A*
18275441-T-G 16163561-T-G P6_Prx A*
19593906-G-A 17482026-G-A P5_Prx YA*
19775494-T-C 17663614-T-C P5_Prx A*
20404286-A-G 18242400-A-G P5_Dst A*
20653982-G-A 18492096-G-A P4_Prx A*
25888849-C-T 23742702-C-T P1_Y1 A*
26345508-G-T 24199361-G-T P1_Y1 A*
27576739-G-A 25430592-G-A P1_Y2 A*
28073529-G-A 25927382-G-A P1_Y2 A*
14295061-T-C 12174355-T-C FGC33712FGC33733 YY+
8095038-G-A 8226997-G-A A10557 7875984-A-GA10561 YY+
14088353-C-A 11967647-C-A FT101592 Y+
10766652-C-A FT430286 +
3435249-C-G 3567208-C-G +
3568459-A-G 3700418-A-G FT100087 +
3660834-T-G 3792793-T-G FT100117 +
4190378-T-C 4322337-T-C +
4383587-A-G 4515546-A-G FT100343 +
4891718-C-T 5023677-C-T FT100495 +
5221790-C-T 5353749-C-T FT100590 +
5275116-T-C 5407075-T-C FT100609 +
5970273-C-T 6102232-C-T FT100819 +
6043096-C-G 6175055-C-G FT100837 +
6398858-AC-A 6530817-AC-A +
6585334-T-C 6717293-T-C FT100919 +
6851038-T-C 6982997-T-C FT100966 YY+
7242433-G-A 7374392-G-A FT101061 Y+
7620021-G-A 7751980-G-A FT101122 YY+
8457826-C-A 8589785-C-A FT101302 YY+
8597499-G-T 8729458-G-T FT101338 YY+
9114129-G-A FT101399 +
9114130-A-C FT101400 +
9126845-G-C FT101401 +
9824069-A-G 9986460-A-G FT101474 YY+
10827445-T-C FT432982 +
10850326-C-T FT434054 +
13609844-G-A 11454168-G-A FT446456 +
14253617-G-A 12132911-G-A FT101633 YY+
14711249-T-G 12599316-T-G FT101750 YY+
14784176-A-G 12672246-A-G FT101766 YY+
15020292-C-T 12908381-C-T FT101817 YY+
15361857-C-T 13249977-C-T BY4684 YY+
15872252-A-G 13760372-A-G FT101999 YY+
16630371-T-C 14518491-T-C FT102136 YY+
16638812-A-G 14526932-A-G FT102139 YY+
17905917-C-T 15794037-C-T FT102441 YY+
18107506-C-G 15995626-C-G FT102496 YY+
18630354-C-G 16518474-C-G FT102577 YY+
18840866-T-G 16728986-T-G FT102613 YY+
18981438-T-C 16869558-T-C FT102641 YY+
19111382-A-T 16999502-A-T FT102678 YY+
19371789-C-A 17259909-C-A FT102746 YY+
21709184-T-C 19547298-T-C FT102947 YY+
22631726-A-G 20469840-A-G FT103083 Y+
22684902-T-A 20523016-T-A FT103096 YY+
22919718-A-C 20757832-A-C FT103153 YY+
28585099-T-C 26438952-T-C FT103407 +
24637041-C-A 22490894-C-A P3_t2 *
10844059-T-A *
10844065-A-T *
4812937-C-A 4944896-C-A *
10679501-C-T *
10828164-T-G *
28809830-G-T 26663683-G-T *
20510961-ATT-A 18349075-ATT-A P5_Dst 32×T**
13459549-C-G 11303873-C-G **
27844528-G-T 25698381-G-T P1_Y2 **
7285324-C-T 7417283-C-T **
19505514-A-T 17393634-A-T **
25955983-TG-T 23809836-TG-T P1_Y1 **
13456294-TATTCCATTCC-T 11300618-TATTCCATTCC-T 9×ATTCC**
19505547-A-T 17393667-A-T FT348097 8×AT**
22229991-G-A 20068105-G-A DYZ19 **
24624603-A-AT 22478456-A-AT P3_t2 11×T**
19505532-A-T 17393652-A-T **
20700699-A-G 18538813-A-G P4_Prx **
21830190-T-TA 19668304-T-TA 12×A**
7285329-A-G 7417288-A-G **
19505521-A-T 17393641-A-T **
2897690-T-C 3029649-T-C **
6187930-G-T 6319889-G-T IR3_Dst **
6187944-C-A 6319903-C-A IR3_Dst **
8094492-T-G 8226451-T-G **
10669502-T-TCCATA **
13459520-C-T 11303844-C-T **
13459529-C-G 11303853-C-G **
13459538-T-TTA 11303862-T-TTA **
13459540-CAT-C 11303864-CAT-C **
13638688-G-T 11483012-G-T **
15269499-A-G 13157588-A-G **
16107333-T-A 13995453-T-A P8_Prx **
17966869-C-T 15854989-C-T **
18121446-T-C 16009566-T-C **
18130567-G-T 16018687-G-T **
18969086-A-G 16857206-A-G **
19505534-A-T 17393654-A-T **
19505536-A-T 17393656-A-T **
20622555-G-T 18460669-G-T P4_Prx **
20632582-G-T 18470696-G-T P4_Prx **
22419777-T-G 20257891-T-G DYZ19 **
22830547-T-TA 20668661-T-TA **
23596939-T-G 21435053-T-G **
24112737-G-A 21966590-G-A P3_b1 **
25977320-A-AATTATTATT 23831173-A-AATTATTATT P1_Y1 8×ATT**
15225-C-A **
58974938-T-G 56828791-T-G ***
14256021-G-T 12135315-G-T A7858 ***
58996599-G-A 56850452-G-A ***
4292835-TAA-T 4424794-TAA-T 13×A***
17346142-CTTTTTT-C 15234262-CTTTTTT-C 18×T***
56850407-A-T ***
56850410-G-C ***
7160894-CTTTT-C 7292853-CTTTT-C 16×T***
13446531-ATTCCATTCCATTCCATTCCATTC-A,ACTCCATTCCATTCCATTCCATTC 11290855-ATTCCATTCCATTCCATTCCATTC-A,ACTCCATTCCATTCCATTCCATTC ***
18687704-C-CAA 16575824-C-CAA 14×A***
23439905-GT-G,GTT 21278019-GT-G,GTT 15×T***
10844060-C-T ***
17876270-T-C 15764390-T-C ***
9913042-A-ATT 10075433-A-ATT 14×T***
5535203-C-T 5667162-C-T ***
7347377-G-A 7479336-G-A ***
8008083-G-A 8140042-G-A ***
10068117-A-G 10230508-A-G ***
13359855-A-G 11204179-A-G ***
13630452-A-T 11474776-A-T ***
13630455-A-T 11474779-A-T ***
13923626-A-G 11802920-A-G ***
14271263-C-CT,CTT 12150557-C-CT,CTT 8×T***
14786379-A-AT,ATT 12674449-A-AT,ATT 12×T***
17622754-CCAA-C 15510874-CCAA-C ***
17876244-A-G 15764364-A-G ***
17876263-C-T 15764383-C-T ***
18686008-A-C 16574128-A-C ***
21617605-CAA-C,CA 19455719-CAA-C,CA 23×A***
21748047-A-C 19586161-A-C ***
21830178-G-GA 19668292-G-GA 8×A***
22479799-G-T 20317913-G-T DYZ19 ***
28559376-A-AT,ATT 26413229-A-AT,ATT 13×T***
28811739-T-C 26665592-T-C ***
28812524-A-C 26666377-A-C ***
56850434-AC-A ***

In the table above, the meaning of the confidence field depends on whether the data comes from an FTDNA kit or an FGC kit. For FTDNA kits, + implies a "PASS" result with just one possible variant, * indicates a "PASS" but with multiple variants, ** indicates "REJECTED" with just a single variant, and *** indicates "REJECTED" with multiple possible variants. 'A*' are heterozygous variants not called by FTDNA, but still pulled from the VCF file. For FGC kits, + indicates over 99% likely genuine (95% for INDELs); * over 95% likely genuine (90% for INDELs); ** about 40% likely genuine; *** about 10% likely genuine. Manual entries read directly from a BAM file will be either + indicating positive, or * indicating that the data show a mixture of possible variants.

For the FTDNA kits, the BED data is encoded in the background color of the cells. Those cells with a white background have coverage, those with a grey background indicate no coverage in the BED file, and those with a pink background indicate the mutation is on the edge of a coverage region. These pink regions often indicate that the individual may be positive for a SNP even if there is no corresponding entry in the vcf file.

The combBED column indicates whether or not the mutation is a SNP and falls in the combBED region defined in Defining a New Rate Constant for Y-Chromosome SNPs based on Full Sequencing Data by Dmitry Adamov, Vladimir Guryanov, Sergey Karzhavin, Vladimir Tagankin, Vadim Urasin.

The McDonald BED column indicates whether or not the mutation is a SNP and falls in the BED region used by Dr. Iain McDonald in the age analysis he does for R-U106 men.