Many parts of the Y chromosome have not yet been incorporated into a reference sequence. Some of those parts are sequenced by current NGS tests, and mutations from those parts appear as heterozygous mutations at seemingly random positions in current reference sequences. Additional contigs are necessary to describe the position of some new variants. Below is my attempt to describe some of those new contigs that will hopefully be a part of a more complete reference sequence in the future.

None of the contigs below appear in either the hg19 or hg38 reference sequences. They exist in R-P312 sequences.

Contig: A1

(length = 1383bp)
TACAGCACTTAAAGCTGTTATGTCCAGAGTTTGTTCCTTCAGATGTTTCCAGAGTTTCTTCCTTCTGGCAGGTTCGTGGTCTTGCTCACTTCTTTAATGAAGCTGCAGACCTTACTGGTGAGTGTTACAGCACTTAAAGATGTTATGTCCAGAGTTTGTTTCTTCAGATGTGTCCAGAGTTTCTTCCTTCTTGCAGTTTCGTGGTCTTGCTCACTTCCTTAATGAAGCTGCAGACCTTCCTGGTGAGTGTTACAGCACTTAAAGGTGTTATGTCCAGAGTTTGATCCTTCAGATGTTTCCAGAGTTTCTTCCTTCTGGCAGGTTCGTGGTCTTGCTCACTTCTTTAATGAAGCTGCAGACCTTACTGGTGAGTGTTACATCACTTAAAGGTGTTATGTCCAGAGATTGTTTCTTCAGATGTGTCCAGAGTTTCTTCCTTCTGGCATTTTCGTGGTCTTCCTCACTTCAAGAATGAAGCTGCAGACCTTATTGTTGAGTGTTACACCACTTAAAAGTGTTATGTCCAGAGTTTGTTCCTTCAGATGTGTCCAGAGTGTCTTCCTTCTGGCAGGTTCATGGTCTTGCTCACTTCACTAATGAAGCTGCAGACCTTACTGGGGAGTGTTACAGCACTTAAAGGTGTTTTGTCCAGAGTTTCTTCCTTCAGATGTGTCCAGAGTTTCTTCCTTCTAGCAGGTTCATTATCTTGCTCATTTCAAGAATTAAGCTGCAGACCTTAGTGGTGACTGTTACAGCACTTATAGGTGTTATGTCCAGAATTTGTTCCTTCAGATGTGTCCAGAGTTTCTTCCTTCTGGCAGGTTCATGGTGTTGCTCAATTCAAGAATGAAGCTGCAGACCATACTGGTGAGTGTTACAGCACTTAAAGCTGTTATGTCCAGAGTTTGTTCCTTCAGATGTTTCCAGAGTTTCTTCTTTCTGGCAGGTTCGTGGTCTTGCTCACTTCTTTAATGAAGCTGCAGACCTTACTGGTGAGTGTTACAGCACTTAAAGGTGTGATGTCCAGAGTTTGTTTCTTCAGATGTGTCCAGAGTATCTTCCTTCTGGCAGGTTCATGGTCTCCCTCACTTCAAGAATGAAGCTGCCGACCTTAGTGCTGAGTGTTACAGCACGTGAAGGTGTTATGTCCAGAGTTCTTTCCTTCAGATGTGTCCAGCGTTTCTTCCTTCTGGCAGGTTCATGGTCTTCCTCACTTCAAGAAGGAAGCTGCAGACCCTACTGGTGAGTGTTACAGCAATTAAAGTTGTTATATCCAGAGTTTGTTCCTTCAGATGTTTCCAGAGTTTCTTCCTTCTGGCAGGTTCGTGGTCTTGCTCACTTCTTTAATGCAGCTGCAGACCTTACTGGTGAGTGTTACAGCAC

Contig: A2

(length = 2024bp)
GTCTTGCTCACTTCACTAATGAAGCTGCAGACCTTACTGGTGAGTGTTACAGCACTTAAAGGTGTTATGTCCAGAGTTTGTTCCTTCAGATGTGTCCAGAGTTTCTTCCTTCTAGCGGGTTCATTGTCTTGCTCATTTCAAGAATTAAGCTGCAGACTTAGTTGTGAGTGTTACAGCACTTAAAGCTGTTATGTCCAGAGTTTGTTCCTTCAGATGTGTCAAGAGTTTCTTCCTTCTGGCAGGTTCATTGTGTTGCTCAATTCAAGAAAGAAGCTGCAGAACTTACTGGTGAGTGTTACAGCACTTAAATCTGTTATTTCCAGAGTTTGTTCCTTCAGATGTTTCCAGAGTTTCTTCCTTCTGGCAGGTTCATGGTCTTGCTCATTTCAAGAATGGAGCTGCAGACTTTTGTGTTGAGTGTTACAGCAGTTAAAGTTGTTATGTCCAGAATTTGTTCCTTCTGATGGGTCCAGTGTTTCTTCCTTCTGGCAGTTTCATGGTCTTTCTCACTTCAAGAATGGAGCTGCAGACCTTACTGGTGAGTGTTACAGCACTTAAAGGTGTTATGTCCAGAGATTGTTCCTTCAGATGCGTCCAGAGTTTCTACCTTCTGGCAGGTTCATGGTCTTGGTCACTTCAAGAATGAAGGTGCAGACCTTAGTGGTGAGTGTGACAGCACTTAAAGGTGTTATATCCAGACTTTGTTCCTTCAGATATATCCAGAGTTTCTTCCTTCTGGCAGGTTCATTGTCTTGCTCATTTCAAGAATGAAGCTGCAGACCTTAGTGGTGAGTTTTACAGCACTTAAAGGTGTTATGTCCTGACTTTGTTCCTTCAGATGTGTCCAGCGTTTCTTCCTTCTGGCAGGTTCATGATCTTTCTCACTTCAAGAATGAAGCTACAGACCTTACTGTTGAGTGTTAAGGCACTTAAACGTGTTATGTCCATAGTTTGTTCCTTCAGATGTGTCCAGAGTTTCTTCCTTCTGGCAGATTCATGGTCTTGCTCACTTCAAGAATGAAGCTGCAGACCTTAGTGTTGAGTGTTACAGCACTTAAAGGTGTTATGTCCAGAGTTTTTTCCTTCAGATATGTCCAGCGTTTCTTCCTTCTGGCAGGTTCATGGTGTTGCTCACTTCAAGAATGAAGCTGCAGACCTTACTGTTGAGTGTTAAAGCACTTAAAGGTGTTATCTCCAGAGTTTGTTCCTTCAGATGTGTCCAGAGTTTCTTCCTTCTGGCAGGTTCATGGTGTTGCTCCCTTCAAGAATGAAGCTGCAGACCTTAGTGTTGAGTGTTACAGCACTTAAAGGTGTTATGTCCAGAGTTTGTTCCTTCAGATGTGTCCAGAGTTTCTTCCTTCTTGCAGGTTCGTGGTCTTGCTCACTTCCTTAATGTAGCTGCAGACCTTCCTGGTGAGTATTACAGCACTTAAAGGTGTTATGTCCAGAGTTTGTTCCTTAAGATGTGTCCAGTGTTTCTTCCTTCTGGCAGGTTCATGGTGTTACTCACTTCAAGAATGAAGCTGCAGACCTTACTGGTGAGTGTTACAGCAGTTAAAGTTGTTATGTCCAGAATTTGTTCCTTCAGATGTGTCCAGTGTTTCTTCCTTCTGGCAGGTTCATGGTCTTGCTCACTTCAAGAATGAAGCTGCAGACCTTACTGGTGAGTGTTACAGCACTTAAAGCTGTTATGTCCAGAGTTTGTTCCTTCAGATGTTTCCAGAGTTTCTTCCTTCTGGCAGGGTCGTGGTCTTGCTCCCTTCTTTAATGAAGCTGCAGACCTTACTGGTGAGTGTTACAGCACTTAAAGGTGTTATGTCCAGAGTTTTTTCCTTCAGATGTGTCCGGAGTTTCTTCCTACTGGTAGGTTCATGGTCTTGGTCACTTCAAGAATGAAGCTGCAGACCTTACTGTTGAGTTTTAAAGCACTTAAAGATGTTATGTCCAGAGTTTGTTCCTTCAGATATGTCCAGAGTTTCTTCCTTCTGGCAGGTTCATGGTCTTGCTCACTTCAAGAATGAAGC

Contig: A3

(length = 0bp)

Contig: A4

(length = 340bp)
GGCTCATGGTCTTGCTCACTTCAAGAAAGAAGCTGCAGAACTTAGTGGTGAGTTTTGCAGCACTTAAAGGTGTTATGTCCAGAGTTTGTTCCTTCAGATGTGTCCAGAGTTTCTTCCTTCTGGCAGGTTCATGGTCTTGCTCACTTCAAGAATGAAGCTGTAGACCTTAGTGGTGTGTGTTACAACACTTAAAGATGTTATTTACAGAGTTTGTTCCTTCAGATGTGTCCAGAGTTTCTTCCTTCTGGCAGGTTCATGGTCTTGCTCACTTCAAGAATGAAGATGCAGACCTTTACGGTGAGTGTTACAGCACATAAAGGTGTTATGTCCAGAGATTGTT