Tree Position

R-P312/S116 > Z40481 > ZZ11 > DF27/S250 > ZZ12 > BY3332 > BY22163 > BY22194 > BY35076 > BY35082 > BY207979

Unique Mutations

The mutations unique to this man are summarized in the table below. Those with a '+' or '*' confidence level are considered by FamilyTreeDNA or FullGenomesCorp to be high quality SNPs/INDELs. For completeness, all other mutations of lesser confidence are included as well. These additional mutations may be useful for distinguishing between very closely related men.

Occasionally, some of the mutations listed here will be thought to be shared with other men in which case they might appear in upstream blocks on the tree. When this happens, the 'Blocks' field will indicate what block they appear in. Such a situation might arise with BigY men if the BED data suggests another man may be positive for a SNP, even though it doesn't appear in his VCF data. It might also happen if Chromo2 testing or Sanger sequencing of other men not on the tree show the SNP to be shared.

POS-REF-ALT (hg19) POS-REF-ALT (hg38) Blocks Names Region McDonald BED combBED STRBigY2
28630
Kane-BY3
28630
14774164-C-G 12662233-C-G YYA*
13451428-C-A 11295752-C-A A*
6214800-A-G 6346759-A-G IR3_Dst A*
21082346-A-G 18920460-A-G YY+
4175417-G-T 4307376-G-T **+
4487473-A-G 4619432-A-G **+
15081269-C-A 12969359-C-A A12789 Y**+
22229322-A-G 20067436-A-G DYZ19 +
22229325-C-A 20067439-C-A DYZ19 +
56843513-A-G +
3365054-G-T 3497013-G-T **+
5100682-G-T 5232641-G-T **+
5344721-C-A 5476680-C-A **+
5420046-G-T 5552005-G-T **+
5621898-G-A 5753857-G-A **+
7165835-C-T 7297794-C-T Y**+
7966467-C-A 8098426-C-A Y**+
3563785-T-C 3695744-T-C **+
11016035-C-A **+
10749326-C-A **+
10930578-C-T **+
10808631-C-T +
13607343-G-A 11451667-G-A +
14154786-T-C 12034080-T-C Y**+
15592550-C-CAA 13480670-C-CAA 22×A+
13292475-G-A 11136799-G-A +
10689030-T-TTCCAC +
5648611-G-T 5780570-G-T **+
28324730-G-T 26178583-G-T P1_b4 **+
2789006-G-T 2920965-G-T Y**+
10779030-C-A **+
20473607-A-T 18311721-A-T P5_Dst +
56837226-T-G +
10951068-C-T +
10824462-C-A **+
8043923-T-C 8175882-T-C Y**+
10951081-C-G +
21584861-C-A 19422975-C-A Y**+
22487727-T-G 20325841-T-G DYZ19 +
16617470-G-T 14505590-G-T Y**+
16029380-C-A 13917500-C-A Y**+
56837201-T-G +
56837202-A-G +
10898603-C-A **+
28738095-C-A 26591948-C-A **+
10808646-C-A +
10944955-C-A **+
56837206-C-T +
18136043-C-A 16024163-C-A YY**+
56837228-G-T +
56837214-T-G +
56837225-T-C +
7720667-C-A 7852626-C-A YY*
8155688-C-A 8287647-C-A YY*
9062419-G-A 9224810-G-A Y*
6867699-C-A 6999658-C-A YY*
8890933-C-A 9022892-C-A Y*
7237468-G-A 7369427-G-A Y*
7470700-CAAAAA-C,CAAA 7602659-CAAAAA-C,CAAA IR1_L 25×A*
8636066-G-C 8768025-G-C YY*
8470566-A-G 8602525-A-G YY*
8470549-CAAAA-C,CAAAAA 8602508-CAAAA-C,CAAAAA 22×A*
8115418-C-A 8247377-C-A YY*
7866882-C-A 7998841-C-A YY*
8084183-C-A 8216142-C-A YY*
7982838-C-A 8114797-C-A YY*
7474457-A-G 7606416-A-G IR1_L *
7474470-G-T 7606429-G-T IR1_L *
16930272-C-A 14818392-C-A Y***
9807755-C-CTT 9970146-C-CTT 11×T*
7947817-G-T 8079776-G-T YY*
7531416-G-A 7663375-G-A YY*
7663673-C-A 7795632-C-A YY*
16931790-CT-C 14819910-CT-C ***
7977567-C-A 8109526-C-A YY*
10985444-C-T *
16245960-T-C 14134080-T-C Y****
11033968-T-C *
13692535-C-A 11536859-C-A *
13692111-C-G 11536435-C-G *
13689390-C-A 11533714-C-A *
13602239-G-T 11446563-G-T *
13474216-C-A 11318540-C-A *
13452332-G-GATTCC,GATTCC 11296656-G-GATTCC,GATTCC 12×ATTCC*
13450246-T-TCTCAGATCACATTTCATTTCACCATTCCATTCCATTTCATTCCATTCCATTCCATTCCATTCCATTCCATTCCATTCCATTCCATAACTCTCTTTCAAGAGGATCTCACTCTGTCACCCAGGCTGGAGTGCAGTGGCAGTAC 11294570-T-TCTCAGATCACATTTCATTTCACCATTCCATTCCATTTCATTCCATTCCATTCCATTCCATTCCATTCCATTCCATTCCATTCCATAACTCTCTTTCAAGAGGATCTCACTCTGTCACCCAGGCTGGAGTGCAGTGGCAGTAC *
13448633-GCATTC-G,G 11292957-GCATTC-G,G 13×CATTC*
13405957-T-C 11250281-T-C *
13306256-G-T 11150580-G-T *
13219530-G-A 11063854-G-A *
11033955-AAACTC-A *
10032881-A-G 10195272-A-G Y*
11033948-C-CAT *
11033944-TCA-T *
11033941-C-G *
11033932-ATTCTG-A *
11033918-T-G,G *
10959236-C-A *
10926265-C-A *
10893945-C-A *
10796109-T-TTCCATTCCATTCCATTCCGTTCCGTTCCGTTCCGA *
6751916-C-A 6883875-C-A Y*
10663663-A- *
10662174-T-C,C *
6861472-C-A 6993431-C-A YY*
6390948-G-T 6522907-G-T *
17081333-T-C 14969453-T-C YY****
17419439-ATTT-A,ATT 15307559-ATTT-A,ATT 25×T*
11643387-A-T *
23188832-G-T 21026946-G-T Y****
11643376-T-A FT449663 *
11643363-GGTC-G *
11643360-AAT-A *
24573275-G-T 22427128-G-T P3_t2 ****
56832539-C-A,CTCCAATCCATTCCAT *
10662132-AT-A,A *
13862492-A-C 11741786-A-C *
13692061-A-T 11536385-A-T *
18050093-T-TATGTGTGTGTA 15938213-T-TATGTGTGTGTA *
18050092-T-TA 15938212-T-TA *
56834407-C-CCATTCCTCTCCACTCCACTCCATTCCACTT *
14102794-GTCTATCTA-G,G 11982088-GTCTATCTA-G,G 11×TCTA*
15991806-GT-G,GTT 13879926-GT-G,GTT 24×T*
22747731-T-A 20585845-T-A FT210747 YY*
18568092-A-G 16456212-A-G YY*
21651831-AAT-A,AATAT 19489945-AAT-A,AATAT 11×AT*
13687047-T-C,C 11531371-T-C,C 5×GAATG*
22319171-G-T,T 20157285-G-T,T DYZ19 *
28802561-ATGGGG-A 26656414-ATGGGG-A *
6734680-CTTT-C,CTT 6866639-CTTT-C,CTT 21×T*
17913434-C-A 15801554-C-A YY*
13695204-G-T 11539528-G-T *
10661330-C-CCCATCCCATCCCATTCCATTCCATTCCATTCCATTCCATTCCATTCCATT *
10985441-T-C *
56833474-AT-A *
11643379-G-C *
21468607-C-CTT 19306721-C-CTT 10×T*
6664144-G-T 6796103-G-T Y*
3244307-A-T 3376266-A-T *
6457997-C-A 6589956-C-A *
56833472-C-CAGTA *
5968169-G-A 6100128-G-A *
5459387-C-A 5591346-C-A *
5022093-T-C 5154052-T-C *
4930860-C-A 5062819-C-A *
4527752-A-G 4659711-A-G *
4408531-T-C 4540490-T-C *
4235973-A-G 4367932-A-G *
4222921-GA-G 4354880-GA-G *
3712813-T-TGTGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 3844772-T-TGTGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA *
3345893-G-A 3477852-G-A *
2960098-A-G 3092057-A-G *
14612335-TGATA-T,T 12500541-TGATA-T,T 12×GATA*
2884645-C-A 3016604-C-A YY*
17086612-TA-T 14974732-TA-T ***
17929288-G-T 15817408-G-T Y****
2751094-C-A 2883053-C-A YY*
13862458-T-A 11741752-T-A *
2695614-T-C 2827573-T-C YY*
18743552-TTCTA-T,T 16631672-TTCTA-T,T 12×TCTA*
13253394-C-CA 11097718-C-CA *
18050098-G-T 15938218-G-T YY*
13692041-G-A 11536365-G-A *
11033973-T-A *
19500593-GAGAAAGAA-G,G 17388713-GAGAAAGAA-G,G 15×AGAA*
18189532-G-T 16077652-G-T Y****
11655710-G-GTAATCGGATGGAACGGAATGGAATGGAATGGAGTCGAATGGAATA,GTAATCGGATGGAACGGAATGGAATGGAATGGAGTCGAATGGAATA *
14286790-T-C 12166084-T-C YY*
13862460-A-G 11741754-A-G *
22562501-T-C 20400615-T-C YY*
21549217-T-C 19387331-T-C YY*
21596443-C-A 19434557-C-A YY*
21785225-C-A 19623339-C-A YY*
21932094-C-T 19770208-C-T YY*
22190515-C-A 20028629-C-A YY*
22521058-C-A 20359172-C-A Y*
22658561-C-A 20496675-C-A YY*
21477982-T-C 19316096-T-C YY*
22737202-C-A 20575316-C-A YY*
22737231-CAAAA-C,CAA 20575345-CAAAA-C,CAA 18×A*
22770843-CT-C 20608957-CT-C *
22845002-C-A 20683116-C-A YY*
22920605-CTTTTTTTTTTTT-C 20758719-CTTTTTTTTTTTT-C 25×T*
22935171-C-A 20773285-C-A YY*
21504019-C-A 19342133-C-A YY*
21476651-T-C 19314765-T-C YY*
22951104-T-C 20789218-T-C YY*
19320359-G-A 17208479-G-A YY*
18819893-C-A 16708013-C-A YY*
18887179-C-A 16775299-C-A YY*
18925131-A-G 16813251-A-G Y*
18925724-G-A 16813844-G-A YY*
18965642-CTTTT-C,CTTT 16853762-CTTTT-C,CTTT 19×T*
19111145-C-A 16999265-C-A YY*
19377958-A-G 17266078-A-G YY*
21467728-T-C 19305842-T-C YY*
19413065-A-G 17301185-A-G YY*
19500150-G-GTAGA,GTAGA 17388270-G-GTAGA,GTAGA 14×TAGA*
19545665-C-A 17433785-C-A YY*
20685197-T-TAAA 18523311-T-TAAA P4_Prx 14×A*
20920882-GAAAA-G 18758996-GAAAA-G P4_Dst 15×A*
20931976-A-G 18770090-A-G P4_Dst *
21153457-T-C 18991571-T-C Y*
22951101-TC-T 20789215-TC-T *
22998785-A-G 20836899-A-G YY*
18806045-T-A 16694165-T-A YY*
56831410-G-A,GTTCCA *
28441609-C-A 26295462-C-A P1_gr2 *
28514958-C-A 26368811-C-A Y*
28620861-A-T 26474714-A-T Y*
28631729-C-A 26485582-C-A Y*
56828304-C-CTTTTG *
56831409-T-TTTTC *
56831899-T-TTTCCATTCCA *
28008283-G-C 25862136-G-C P1_Y2 *
56832336-ATTCCATTCCACTCCT-A,ATTCCATTCCACTCCTTTCCATTCCACTCCT *
56833363-C-CTCCACACCATTCCAT,CTCCACACCATTCCAT *
56833406-C-A *
56834385-T-TTCCATTCCTCTCCATTCCATTCCACTCCACTCCAC *
56834400-C-CCACTCCATTCCACTCCTCTCCACTCCATTCCTCTCCACTCCACTCCAT *
56836851-C-CTCCATTCCACTTCTCTCAACTCCATTACATTTCATTCCACTCCATTCCAT *
28157471-G-A 26011324-G-A P1_b4 *
26314811-C-T 24168664-C-T P1_Y1 *
23298699-C-A 21136813-C-A YY*
23512129-C-T 21350243-C-T YY*
23306122-C-A 21144236-C-A Y*
23377001-T-C 21215115-T-C YY*
23387755-C-A 21225869-C-A YY*
23393272-C-A 21231386-C-A YY*
23431157-A-G 21269271-A-G YY*
23461143-G-A 21299257-G-A YY*
23537528-G-A 21375642-G-A YY*
26133202-G-T 23987055-G-T P1_Y1 *
23590764-CAAA-C,CAA 21428878-CAAA-C,CAA 15×A*
23609074-C-A 21447188-C-A YY*
23609091-C-A 21447205-C-A YY*
23801928-G-A 21640042-G-A Y*
24636008-G-T 22489861-G-T P3_t2 *
24961017-G-A 22814870-G-A g1 *
26133194-G-T 23987047-G-T P1_Y1 *
18811024-G-A 16699144-G-A YY*
18717893-C-A 16606013-C-A YY*
13862468-A-C 11741762-A-C *
15558431-GAGATAGATAGAT-G,G 13446551-GAGATAGATAGAT-G,G 17×AGAT*
15234941-T-A 13123027-T-A Y*
15257597-T-C 13145681-T-C YY*
15259056-C-A 13147140-C-A YY*
15430586-T-C 13318706-T-C YY*
15479480-G-A 13367600-G-A YY*
15553120-C-A 13441240-C-A YY*
15635760-G-A 13523880-G-A YY*
15158254-C-A 13046340-C-A YY*
15669959-C-G 13558079-C-G Y*
15721083-C-A 13609203-C-A YY*
15728309-A-C 13616429-A-C YY*
15951204-A-G 13839324-A-G YY*
15971742-T-G 13859862-T-G YY*
15975125-C-A 13863245-C-A YY*
15168533-T-C 13056619-T-C Y*
14984864-G-A 12872932-G-A YY*
16226185-C-A 14114305-C-A YY*
14232616-C-A 12111910-C-A YY*
13862480-G-T 11741774-G-T *
14063145-CAGAT-C,C 11942439-CAGAT-C,C 13×AGAT*
14070256-T-A 11949550-T-A YY*
14181316-G-T 12060610-G-T Y*
14181321-G-T 12060615-G-T Y*
14208757-C-A 12088051-C-A YY*
14363325-G-T 12242620-G-T YY*
14946324-CAA-C 12834398-CAA-C 11×A*
14402312-G-A 12281609-G-A YY*
14440186-C-A 12319459-C-A Y*
14593829-T-C 12482029-T-C YY*
14714399-G-A 12602466-G-A YY*
14730574-C-A 12618642-C-A YY*
14823338-C-A 12711405-C-A YY*
14946148-C-A 12834222-C-A YY*
16086069-C-A 13974189-C-A Y*
16226201-T-C 14114321-T-C YY*
18679892-C-A 16568012-C-A YY*
17819404-C-A 15707524-C-A FTA36621 YY*
17462324-A-G 15350444-A-G YY*
17580958-G-T 15469078-G-T YY*
17592059-C-A 15480179-C-A YY*
17645526-A-T 15533646-A-T YY*
17673064-G-A 15561184-G-A YY*
17819391-A-ATT 15707511-A-ATT 9×T*
18047284-AGTTTAGGT-A 15935404-AGTTTAGGT-A *
17361058-CAAAAAA-C,CAAAA 15249178-CAAAAAA-C,CAAAA 25×A*
18123986-G-C 16012106-G-C YY*
18192576-C-T 16080696-C-T BY195331 YY*
18381645-C-A 16269765-C-A P6_Gap *
18397912-C-T 16286032-C-T P6_Gap *
18400922-C-A 16289042-C-A P6_Gap *
18616823-C-A 16504943-C-A YY*
17426011-CCTTTT-C,C 15314131-CCTTTT-C,C 11×CTTTT*
17353325-C-A 15241445-C-A YY*
16242632-T-TTCTATCTATCTA,TTCTATCTATCTA 14130752-T-TTCTATCTATCTA,TTCTATCTATCTA 10×TCTA*
16636972-C-A 14525092-C-A YY*
16258158-C-A 14146278-C-A YY*
16308360-C-A 14196480-C-A YY*
16308942-C-A 14197062-C-A YY*
16424337-C-T 14312457-C-T Y*
16463624-C-A 14351744-C-A YY*
16463820-C-A 14351940-C-A YY*
16760975-C-A 14649095-C-A YY*
17322591-G-A 15210711-G-A YY*
16906968-T-C 14795088-T-C YY*
16922399-A-G 14810519-A-G YY*
16927009-G-A 14815129-G-A YY*
17190488-C-A 15078608-C-A YY*
17196878-C-A 15084998-C-A YY*
17279781-C-A 15167901-C-A YY*
17307508-AAGAT-A,A 15195628-AAGAT-A,A 11×AGAT*
15548847-GACAC-G 13436967-GACAC-G 15548847GACAC-G 18×AC*
58979405-T-TTCCAC 56833258-T-TTCCAC *
14768043-C-A 12656112-C-A YY*
13571263-G-T 11415587-G-T *
13253396-G-GTTTT,GTTTTTT 11097720-G-GTTTT,GTTTTTT 12×T*
7363598-C-A 7495557-C-A Y*
13719537-A-T 11563861-A-T *
19123213-C-A 17011333-C-A YY*
4078223-G-T 4210182-G-T *
18761797-C-A 16649917-C-A YY*
21986984-TA-T 19825098-TA-T *
21939441-C-A 19777555-C-A YY*
11643368-C-A *
23415274-C-CTA 21253388-C-CTA 12×TA*
2752673-C-A 2884632-C-A YY*
10020881-C-A 10183272-C-A Y*
18934014-C-A 16822134-C-A YY****
8386117-A-T 8518076-A-T YY*
23311014-C-A 21149128-C-A YY*
6741506-C-A 6873465-C-A YY*
10944641-C-A *
13478293-T-A 11322617-T-A *
9057008-C-A *
3648817-C-A 3780776-C-A *
21292579-TAAA-T 19130693-TAAA-T 15×A*
14642479-C-A 12530548-C-A YY*
14266945-C-A 12146239-C-A Y*
13330830-C-A 11175154-C-A *
10860493-C-A ****
10658331-ACCATTCCATTCCATTCCATTCCATTCCATT-A *
27546780-G-A 25400633-G-A P1_Y2 *
11643373-A-G FT462777 *
17313388-C-A 15201508-C-A YY****
14080431-C-A 11959725-C-A YY*
17878408-C-A 15766528-C-A YY*
14422094-C-A 12301369-C-A Y*
15372523-C-A 13260643-C-A YY*
21946226-C-A 19784340-C-A YY*
21604956-C-A 19443070-C-A YY*
21891202-CA-C 19729316-CA-C 8×A*
14812065-AAAAG-A 12700136-AAAAG-A *
16213536-C-A 14101656-C-A YY*
15966440-C-A 13854560-C-A YY*
10772518-T-G *
13862452-T-G 11741746-T-G *
21603849-C-A 19441963-C-A YY*
10770341-C-A ****
56835038-C-A *
10661370-T-C *
15971748-T-G 13859868-T-G YY*
7499416-G-T 7631375-G-T IR1_L *
28635721-C-A 26489574-C-A *
10693278-C-A *
15411765-C-A 13299885-C-A YY*
10965424-C-A ***
23248463-C-A 21086577-C-A YY*
8075405-C-A 8207364-C-A Y*
5412103-C-A 5544062-C-A *
15174916-C-A 13063002-C-A YY*
6773413-C-A 6905372-C-A Y*
8156020-C-A 8287979-C-A YY*
19523449-C-A 17411569-C-A YY*
14263511-C-A 12142805-C-A YY*
10652815-G-T ****
16370957-C-A 14259077-C-A YY*
7524509-GT-G 7656468-GT-G 9×T*
18806040-C-A 16694160-C-A YY*
14286784-CTTTTT-C,CTTT 12166078-CTTTTT-C,CTTT 22×T*
11033975-C-A *
23952818-A-G 21806671-A-G *
13862464-A-G 11741758-A-G *
10951050-C-A *
14254643-C-A 12133937-C-A YY*
24485246-C-A 22339099-C-A *
18144097-C-A 16032217-C-A YY*
13209322-C-A 11053646-C-A *
13719547-T-C 11563871-T-C *
8282656-C-CA 8414615-C-CA 9×A*
18512502-C-A 16400622-C-A P6_Dst *
10694119-C-A *
6647067-C-A 6779026-C-A YY*
13692056-G-C 11536380-G-C *
8012490-TA-T 8144449-TA-T 8×A*
13349853-A-T 11194177-A-T ****
10777933-C-T ****
13473992-C-A 11318316-C-A *
22564210-C-A 20402324-C-A YY*
7107740-C-A 7239699-C-A YY*
2750884-C-A 2882843-C-A YY*
10951055-G-A *
8058647-C-A 8190606-C-A YY*
56828284-A-AATTCCTATCC *
10971662-C-A ****
8666748-TG-T 8798707-TG-T *
13689336-G-C 11533660-G-C *
22758190-G-GA 20596304-G-GA 9×A*
22819315-C-A 20657429-C-A YY*
23413938-C-A 21252052-C-A YY*
6133820-C-A 6265779-C-A *
10826133-CTCCAT-C ****
13478261-G-T 11322585-G-T *
10776510-T-A *
13461039-A-C 11305363-A-C *
7317137-C-A 7449096-C-A YY*
14697172-C-A 12585238-C-A YY*
14967881-T-TA 12855956-T-TA 10×A*
16549720-C-A 14437840-C-A YY*
21240454-GTA-G 19078568-GTA-G *
8877365-TTG-T 9009324-TTG-T 8×TG*
6828046-C-A 6960005-C-A Y*
19517474-C-A 17405594-C-A YY*
18639018-AGTGTGT-A 16527138-AGTGTGT-A 26×GT*
19485229-T-TCA 17373349-T-TCA *
13862470-A-G 11741764-A-G Z12008 *
10683202-C-A ****
18911123-C-A 16799243-C-A YY*
18806043-TC-T 16694163-TC-T *
58979606-A-T 56833459-A-T *
15353227-AAT-A 13241346-AAT-A *
17632667-C-T 15520787-C-T F21960 YY*
18765353-ATG-A 16653473-ATG-A *
28802569-T-C 26656422-T-C *
19558843-C-A 17446963-C-A **
5869981-TC-T 6001940-TC-T **
18768319-C-A 16656439-C-A **
20865359-C-CACAT 18703473-C-CACAT P4_Dst **
21096150-C-A 18934264-C-A **
28818074-A-G 26671927-A-G **
9125503-G-T **
4508786-C-A 4640745-C-A **
21946819-C-A 19784933-C-A **
28814114-T-A 26667967-T-A **
14226618-C-T 12105912-C-T **
10748325-C-G **
10984140-G-A FGC77193 **
20265321-CACACA-C 18103435-CACACA-C P5_Dst **
13564454-C-A 11408778-C-A **
24240677-T-G 22094530-T-G P3_b1 **
10877315-CTCCAT-C **
11026767-C-A **
10667024-C-T **
13939757-C-A 11819051-C-A **
8216571-AT-A 8348530-AT-A 9×T**
22335156-A-G 20173270-A-G DYZ19 **
10667028-C-T **
28461073-C-A 26314926-C-A **
7033535-C-A 7165494-C-A **
19293636-C-T 17181756-C-T **
16148185-T-TA 14036305-T-TA P8_Dst **
23262596-C-A 21100710-C-A **
11034895-C-A **
16084155-G-T 13972275-G-T **
10656987-C-A **
14485952-C-A 12365221-C-A **
10997044-C-A **
5125776-C-A 5257735-C-A **
22689918-C-A 20528032-C-A **
27727513-CT-C 25581366-CT-C P1_Y2 **
22842253-C-A 20680367-C-A **
14448198-G-A 12327471-G-A **
23844990-A-T 21683104-A-T **
7166987-C-A 7298946-C-A **
13349871-C-A 11194195-C-A **
7536435-C-T 7668394-C-T **
4567830-C-A 4699789-C-A **
11035854-G-T **
10964391-C-A **
10873114-ATTGC-A **
10873119-AT-A **
10984447-C-A **
19853726-G-T 17741846-G-T P5_Prx **
15888711-AT-A 13776831-AT-A 8×T**
23412175-C-A 21250289-C-A **
18511226-G-T 16399346-G-T P6_Dst **
10791618-C-A **
17151431-C-A 15039551-C-A **
3367013-C-A 3498972-C-A **
14557994-C-A 12446195-C-A **
16760142-C-A 14648262-C-A **
10773247-C-A **
14160289-G-T 12039583-G-T **
11022745-C-A **
6490704-C-A 6622663-C-A **
15863119-C-A 13751239-C-A **
5170471-C-A 5302430-C-A **
10748319-C-T **
16625925-C-A 14514045-C-A **
17181528-C-A 15069648-C-A **
10032669-C-A 10195060-C-A **
10826971-TTGCAC-T **
6012955-A-G 6144914-A-G **
13938667-T-C 11817961-T-C **
11027320-C-A **
22775416-C-A 20613530-C-A **
26102950-T-TC 23956803-T-TC P1_Y1 **
19388366-T-C 17276486-T-C **
20027946-CA-C 17916066-CA-C P5_Prx **
20792802-G-T 18630916-G-T P4_Prx **
21127454-C-A 18965568-C-A **
21245403-G-T 19083517-G-T **
21297846-C-A 19135960-C-A **
21525955-C-A 19364069-C-A **
21597642-C-A 19435756-C-A **
22199492-A-G 20037606-A-G **
22893329-CTT-C 20731443-CTT-C **
22893333-CTT-C 20731447-CTT-C **
22935232-G-T 20773346-G-T **
23848357-G-T 21686471-G-T **
24466096-C-G 22319949-C-G **
27584615-A-G 25438468-A-G P1_Y2 **
19293652-T-C 17181772-T-C **
27790888-C-G 25644741-C-G P1_Y2 **
28558857-C-A 26412710-C-A **
28611273-G-A 26465126-G-A **
28617646-T-G 26471499-T-G **
28659676-C-A 26513529-C-A **
10813414-C-A **
28818077-G-A 26671930-G-A **
28818086-GGAATT-G 26671939-GGAATT-G **
56751902-G-C **
10812188-T-C **
10760434-CTACTG-C **
10751649-C-A **
10748326-ACATTCC-A **
11032678-C-A **
19351514-T-C 17239634-T-C **
19293596-C-T 17181716-C-T **
10667018-C-CGGGTAGATTG **
16063030-A-T 13951150-A-T **
14073345-A-G 11952639-A-G **
11666930-C-A **
14181562-G-T 12060856-G-T **
14430452-G-A 12309725-G-A **
14490739-A-G 12370008-A-G **
14490741-T-C 12370010-T-C **
14501279-C-A 12389484-C-A **
14715764-G-T 12603831-G-T **
14796525-A-G 12684596-A-G **
15011240-C-A 12899325-C-A **
15598938-G-T 13487058-G-T **
15758655-G-A 13646775-G-A **
15795511-G-T 13683631-G-T **
13595537-G-T 11439861-G-T **
16413509-A-G 14301629-A-G **
18795419-T-G 16683539-T-G **
16480402-C-A 14368522-C-A **
13286360-C-A 11130684-C-A **
16625546-T-C 14513666-T-C **
10996689-GCTCCA-G **
10989595-A-C **
17071297-A-C 14959417-A-C **
10911691-G-T **
17214391-A-G 15102511-A-G **
17481305-A-G 15369425-A-G **
17500958-A-G 15389078-A-G **
17629766-C-A 15517886-C-A **
10907730-T-A **
10896440-T-TTC **
10883826-C-A **
10672436-T-G **
14490742-G-A 12370011-G-A **
10025101-C-A 10187492-C-A **
18297537-G-A 16185657-G-A P6_Prx **
9971767-A-G 10134158-A-G **
10844847-A-G **
19293624-C-A 17181744-C-A **
14458406-T-TA 12337679-T-TA **
4840666-C-A 4972625-C-A **
28621873-G-A 26475726-G-A **
10990351-C-A **
28818124-C-CTTGAT 26671977-C-CTTGAT **
4241401-C-A 4373360-C-A **
13944661-C-A 11823955-C-A **
11028283-G-T **
28818111-G-A 26671964-G-A **
10969053-C-A **
10678516-C-A **
23004487-G-T 20842601-G-T **
23952953-G-T 21806806-G-T **
16478198-G-T 14366318-G-T 16×A**
15866004-G-A 13754124-G-A **
26500446-C-A 24354299-C-A P1_Y1 **
10748681-C-T **
10780011-C-A **
18978822-C-A 16866942-C-A **
14068569-T-G 11947863-T-G **
21775156-C-A 19613270-C-A **
10969033-C-T **
28818140-T-A 26671993-T-A **
28818131-AAAGCG-A 26671984-AAAGCG-A **
28818097-G-T 26671950-G-T **
56838509-G-T **
19302290-C-A 17190410-C-A **
10844862-C-T **
10807870-C-A **
4389662-T-A 4521621-T-A **
7015870-G-T 7147829-G-T **
7444117-T-G 7576076-T-G **
6501812-C-A 6633771-C-A **
6501784-C-A 6633743-C-A **
5125809-A-G 5257768-A-G **
5067469-C-A 5199428-C-A **
4968755-A-G 5100714-A-G **
4897051-G-T 5029010-G-T **
4897045-G-T 5029004-G-T **
4749184-C-A 4881143-C-A **
10844828-CGTTCG-C **
4382483-A-C 4514442-A-C **
4340112-C-A 4472071-C-A **
3968664-G-A 4100623-G-A **
3856642-G-T 3988601-G-T FT351004 **
7590527-G-T 7722486-G-T **
8389671-G-A 8521630-G-A **
9444900-C-A 9607291-C-A **
3849245-C-T 3981204-C-T **
3695985-G-T 3827944-G-T **
3640866-T-G 3772825-T-G **
3008003-A-G 3139962-A-G **
2933968-C-A 3065927-C-A **
2845228-A-T 2977187-A-T **
2845201-AG-A 2977160-AG-A **
2762078-G-T 2894037-G-T **
56835929-C-A,G ***
10999839-C-A ***
13726010-G-GGCT 11570334-G-GGCT ***
10873153-C-CTTTGA ***
17158968-C-CTT 15047088-C-CTT 26×T***
10824505-G-T ***
10824499-G-C ***
10658591-G-C,T ***
10662133-TT-T,TTCTATTTCAC ***
10824501-C-A ***
10885175-TGAA-T,TGCA ***
10982373-C-T ***

In the table above, the meaning of the confidence field depends on whether the data comes from an FTDNA kit or an FGC kit. For FTDNA kits, + implies a "PASS" result with just one possible variant, * indicates a "PASS" but with multiple variants, ** indicates "REJECTED" with just a single variant, and *** indicates "REJECTED" with multiple possible variants. 'A*' are heterozygous variants not called by FTDNA, but still pulled from the VCF file. For FGC kits, + indicates over 99% likely genuine (95% for INDELs); * over 95% likely genuine (90% for INDELs); ** about 40% likely genuine; *** about 10% likely genuine. Manual entries read directly from a BAM file will be either + indicating positive, or * indicating that the data show a mixture of possible variants.

For the FTDNA kits, the BED data is encoded in the background color of the cells. Those cells with a white background have coverage, those with a grey background indicate no coverage in the BED file, and those with a pink background indicate the mutation is on the edge of a coverage region. These pink regions often indicate that the individual may be positive for a SNP even if there is no corresponding entry in the vcf file.

The combBED column indicates whether or not the mutation is a SNP and falls in the combBED region defined in Defining a New Rate Constant for Y-Chromosome SNPs based on Full Sequencing Data by Dmitry Adamov, Vladimir Guryanov, Sergey Karzhavin, Vladimir Tagankin, Vadim Urasin.

The McDonald BED column indicates whether or not the mutation is a SNP and falls in the BED region used by Dr. Iain McDonald in the age analysis he does for R-U106 men.

Age Analysis Information (work in progress)

AllMcDonaldYFull
Kit: 28630985235979858637863195
Kit: 28630946822877142707634568
Used in age calculations985235979858637863195
Counts of SNPs193162
Variant counts last updated 2022-05-04 03:01:12.



Big Tree Main Page