Paul

BigY3: 949071

Tree Position

A0-T-YP2191 > P305[A1] > A1b > BT/A1b2 > M168/PF1416[CT] > P143[CF] > M89/PF2746[F] > F1329/M3658[GHI > F929[HIJK] > IJK > IJ > J > J2

Unique Mutations

The mutations unique to this man are summarized in the table below. Those with a '+' or '*' confidence level are considered by FamilyTreeDNA or FullGenomesCorp to be high quality SNPs/INDELs. For completeness, all other mutations of lesser confidence are included as well. These additional mutations may be useful for distinguishing between very closely related men.

Occasionally, some of the mutations listed here will be thought to be shared with other men in which case they might appear in upstream blocks on the tree. When this happens, the 'Blocks' field will indicate what block they appear in. Such a situation might arise with BigY men if the BED data suggests another man may be positive for a SNP, even though it doesn't appear in his VCF data. It might also happen if Chromo2 testing or Sanger sequencing of other men not on the tree show the SNP to be shared.

POS-REF-ALT (hg19) POS-REF-ALT (hg38) Blocks Names Region McDonald BED combBED STRBigY3
949071
13869155-G-A 11748449-G-A A*
20040458-G-C 17928578-G-C P5_Prx A*
20040466-G-C 17928586-G-C BY212060 P5_Prx A*
20040474-G-C 17928594-G-C BY196756 P5_Prx A*
18863060-A-AT 16751180-A-AT 10×TA*
10756323-A-G A*
10673656-C-G A*
10877903-T-A A*
11028207-C-T A*
13204397-A-G 11048721-A-G A*
13450706-T-G 11295030-T-G A*
28807183-A-G 26661036-A-G A*
28814775-G-C 26668628-G-C A*
28814791-A-G 26668644-A-G A*
10630035-A-G A*
8363665-T-C 8495624-T-C YYA*
19641341-G-C 17529461-G-C P5_Prx A*
20775686-T-C 18613800-T-C P4_Prx A*
25612873-C-T 23466726-C-T P1_gr1 A*
25871242-G-C 23725095-G-C P1_Y1 A*
26468960-T-C 24322813-T-C P1_Y1 A*
28814745-G-A 26668598-G-A A*
28814754-T-A 26668607-T-A A*
28814755-G-C 26668608-G-C A*
28814764-C-T 26668617-C-T A*
28814765-A-G 26668618-A-G A*
28814769-C-G 26668622-C-G A*
28817608-A-T 26671461-A-T A*
18595408-G-A 16483528-G-A FGC11605 YY+
2865265-TAAACTTA-T 2997224-TAAACTTA-T +
3074373-C-T 3206332-C-T BY57393 +
3097678-A-G 3229637-A-G FTA44003 +
3425145-G-A 3557104-G-A +
3824833-G-T 3956792-G-T FTA44072 +
3885590-T-G 4017549-T-G FTA44079 +
6424156-G-A 6556115-G-A +
6471818-C-T 6603777-C-T FTA44298 +
7265434-C-T 7397393-C-T BY205795 YY+
7861284-T-C 7993243-T-C FTA38317 Y+
8151539-A-G 8283498-A-G FTA38425 YY+
8242519-A-G 8374478-A-G BY206079 YY+
8555902-G-A 8687861-G-A YY+
9858031-C-T 10020422-C-T YY+
10932553-T-C +
13924605-C-T 11803899-C-T FTA38904 Y+
14248824-G-A 12128118-G-A BY206669 YY+
14835900-T-C 12723967-T-C BY206822 YY+
15038238-G-A 12926328-G-A BY99327 YY+
15203841-G-A 13091927-G-A BY206920 YY+
15367981-A-G 13256101-A-G FTA39487 Y+
16718286-G-A 14606406-G-A BY207312 YY+
16769085-A-G 14657205-A-G BY207320 YY+
16926244-C-T 14814364-C-T FT122130 Y+
17148456-A-G 15036576-A-G BY207440 YY+
17205791-A-G 15093911-A-G BY207458 YY+
17340102-G-T 15228222-G-T FTA40254 YY+
17752307-G-A 15640427-G-A BY207616 YY+
18633639-T-A 16521759-T-A YY+
18818454-A-T 16706574-A-T FTA40800 Y+
19021759-A-G 16909879-A-G BY207936 YY+
19050693-T-C 16938813-T-C BY125813 YY+
19341674-G-A 17229794-G-A FTA41023 YY+
19469666-T-G 17357786-T-G YY+
20814280-T-C 18652394-T-C BY212509 P4_Gap +
21252704-A-C 19090818-A-C BY208170 YY+
21334672-G-A 19172786-G-A YY+
21485890-A-T 19324004-A-T BY208253 YY+
21589926-T-C 19428040-T-C BY208283 YY+
21725241-T-C 19563355-T-C BY208328 YY+
23044783-G-C 20882897-G-C BY208731 YY+
23135513-G-A 20973627-G-A BY208756 YY+
23653285-C-T 21491399-C-T BY208916 Y+
24892184-G-A 22746037-G-A BY226373 g1 +
11010210-C-A *
11010207-G-GC *
27647681-C-T 25501534-C-T FGC73075 P1_Y2 *
13448564-A-C,T 11292888-A-C,T *
8363663-T-TC 8495622-T-TC *
10655112-T-C *
10808999-A-G *
27654020-A-T 25507873-A-T P1_Y2 *
26314758-G-A 24168611-G-A FGC29280FGC29279 P1_Y1 **
28819181-A-G 26673034-A-G **
13453186-T-C 11297510-T-C **
13453191-T-G 11297515-T-G **
30045-T-A **
19899553-G-T 17787673-G-T P5_Prx **
27447484-GT-G 25301337-GT-G P1_Y2 **
19759370-A-T 17647490-A-T P5_Prx **
20486773-A-AT 18324887-A-AT P5_Dst **
5557261-AC-A 5689220-AC-A **
26200001-T-C 24053854-T-C P1_Y1 **
19930406-G-T 17818526-G-T P5_Prx **
5142623-T-C 5274582-T-C **
5505962-ATTTTTTTTTTTTTTTTTTTTTTTTTTTT-A 5637921-ATTTTTTTTTTTTTTTTTTTTTTTTTTTT-A 53×T**
5702087-G-T 5834046-G-T **
7123180-T-C 7255139-T-C **
9329987-A-G 9492378-A-G **
9381847-G-A 9544238-G-A **
10628134-C-A **
10809578-C-G **
13923290-G-A 11802584-G-A **
15301008-A-G 13189107-A-G **
15379725-T-A 13267845-T-A **
19412021-AAAG-A 17300141-AAAG-A **
20394886-A-AT 18233000-A-AT P5_Dst **
21002535-T-TTCTCTCTCTCTC 18840649-T-TTCTCTCTCTCTC P4_Dst 16×TC**
21119411-A-G 18957525-A-G **
21802781-G-T 19640895-G-T **
22302659-A-G 20140773-A-G DYZ19 **
22506163-C-G 20344277-C-G BY225158 DYZ19 **
23440801-T-C 21278915-T-C **
23472231-A-G 21310345-A-G BY145524 **
28796194-G-C 26650047-G-C **
28819131-C-T 26672984-C-T **
28819133-A-G 26672986-A-G **
28819153-ATCCAAAGGAG-A 26673006-ATCCAAAGGAG-A **
56728087-GGAAT-G **
56728094-AT-A **
56728107-G-A **
10673571-C-A ***
10801662-C-G ***
9057551-ATTT-A ***
10973961-TCCAC-T,TCCACC ***
10790301-TTCCAT-T,TTCTGC ***
10766385-CT-C ***
10999975-A-G ***
14984852-TGG-T,TG 12872920-TGG-T,TG 12×G***
7019347-AT-A,ATT 7151306-AT-A,ATT 13×T***
13898754-GTTT-G,GT 11778048-GTTT-G,GT 26×T***
13454843-A-ACTC 11299167-A-ACTC ***
13454844-T-TAC 11299168-T-TAC ***
13454864-T-A 11299188-T-A ***
13454870-T-C 11299194-T-C ***
3968645-TAA-T 4100604-TAA-T 13×A***
16352456-CAAA-C 14240576-CAAA-C 21×A***
3896536-T-A 4028495-T-A ***
5563451-CTT-C,CT 5695410-CTT-C,CT 11×T***
7285543-T-C 7417502-T-C ***
13258311-A-G 11102635-A-G ***
13258312-T-A 11102636-T-A ***
13446580-CATTCCATTCCATTCCATTCCATTCC-C,CAATCCACTCCAATTCACTCCATTCG 11290904-CATTCCATTCCATTCCATTCCATTCC-C,CAATCCACTCCAATTCACTCCATTCG ***
13454872-CATTCC-C,CATTCG 11299196-CATTCC-C,CATTCG ***
13478912-C-A 11323236-C-A ***
13643109-C-A 11487433-C-A ***
14532908-T-C 12421109-T-C ***
14569063-A-T 12457263-A-T ***
14698476-AAC-A,AAA 12586542-AAC-A,AAA ***
14765142-C-T 12653211-C-T ***
16618411-C-A 14506531-C-A ***
16834746-CAAAAAAAAAAAAAAAAAAAAAAAAAA-C,CAA 14722866-CAAAAAAAAAAAAAAAAAAAAAAAAAA-C,CAA 45×A***
16860773-AG-A,G 14748893-AG-A,G ***
17389840-A-G 15277960-A-G ***
18818742-A-T 16706862-A-T ***
19155395-T-C 17043515-T-C ***
21078211-A-AAAATAAAT 18916325-A-AAAATAAAT 10×AAAT***
23472220-G-A 21310334-G-A BY145523 ***
23472223-T-A 21310337-T-A ***
14225-G-C ***

In the table above, the meaning of the confidence field depends on whether the data comes from an FTDNA kit or an FGC kit. For FTDNA kits, + implies a "PASS" result with just one possible variant, * indicates a "PASS" but with multiple variants, ** indicates "REJECTED" with just a single variant, and *** indicates "REJECTED" with multiple possible variants. 'A*' are heterozygous variants not called by FTDNA, but still pulled from the VCF file. For FGC kits, + indicates over 99% likely genuine (95% for INDELs); * over 95% likely genuine (90% for INDELs); ** about 40% likely genuine; *** about 10% likely genuine. Manual entries read directly from a BAM file will be either + indicating positive, or * indicating that the data show a mixture of possible variants.

For the FTDNA kits, the BED data is encoded in the background color of the cells. Those cells with a white background have coverage, those with a grey background indicate no coverage in the BED file, and those with a pink background indicate the mutation is on the edge of a coverage region. These pink regions often indicate that the individual may be positive for a SNP even if there is no corresponding entry in the vcf file.

The combBED column indicates whether or not the mutation is a SNP and falls in the combBED region defined in Defining a New Rate Constant for Y-Chromosome SNPs based on Full Sequencing Data by Dmitry Adamov, Vladimir Guryanov, Sergey Karzhavin, Vladimir Tagankin, Vadim Urasin.

The McDonald BED column indicates whether or not the mutation is a SNP and falls in the BED region used by Dr. Iain McDonald in the age analysis he does for R-U106 men.