Tree Position

R-P312/S116 > Z46577 > Z290 > L21/S145 > S552 > DF13 > L513/S215/DF1 > S5668 > Z16340 > FGC9807 > FGC9795 > FGC9804

Unique Mutations

The mutations unique to this man are summarized in the table below. Those with a '+' or '*' confidence level are considered by FamilyTreeDNA or FullGenomesCorp to be high quality SNPs/INDELs. For completeness, all other mutations of lesser confidence are included as well. These additional mutations may be useful for distinguishing between very closely related men.

Occasionally, some of the mutations listed here will be thought to be shared with other men in which case they might appear in upstream blocks on the tree. When this happens, the 'Blocks' field will indicate what block they appear in. Such a situation might arise with BigY men if the BED data suggests another man may be positive for a SNP, even though it doesn't appear in his VCF data. It might also happen if Chromo2 testing or Sanger sequencing of other men not on the tree show the SNP to be shared.

Position Blocks Names Region McDonald BED combBED STRBigY3
156456
hg19:Y:27634136-A-C hg38:Y:25487989-A-C P1_Y2 A+
hg19:Y:27634132-A-C hg38:Y:25487985-A-C P1_Y2 A+
hg19:Y:13446826-C-A hg38:Y:11291150-C-A A*
hg19:Y:13686986-T-C hg38:Y:11531310-T-C DYZ17 A*
hg19:Y:6237213-C-T hg38:Y:6369172-C-T IR3_Dst A*
hg19:Y:19947827-A-C hg38:Y:17835947-A-C P5_Prx A*
hg19:Y:19952783-G-A hg38:Y:17840903-G-A P5_Prx A*
hg19:Y:13849736-G-A hg38:Y:11729030-G-A FT146244 DYZ17 +
hg19:Y:18422837-G-A hg38:Y:16310957-G-A Y6729 FGC7707 P6_Gap +
hg19:Y:5187595-A-G hg38:Y:5319554-A-G FT145292 +
hg19:Y:7333185-G-A hg38:Y:7465144-G-A FT145789 YY+
hg19:Y:7775050-G-A hg38:Y:7907009-G-A FT145871 YY+
hg19:Y:8319493-C-G hg38:Y:8451452-C-G FT145973 YY+
hg19:Y:9856738-C-A hg38:Y:10019129-C-A FT146203 YY+
hg19:Y:13992954-A-T hg38:Y:11872248-A-T FT146302 YY+
hg19:Y:14169908-C-T hg38:Y:12049202-C-T FT146349 YY+
hg19:Y:15594230-G-A hg38:Y:13482350-G-A FT146666 YY+
hg19:Y:16406188-G-A hg38:Y:14294308-G-A FT146824 YY+
hg19:Y:17985790-C-T hg38:Y:15873910-C-T FT147172 Y+
hg19:Y:19064584-C-A hg38:Y:16952704-C-A FT147362 Y+
hg19:Y:20015749-T-C hg38:Y:17903869-T-C FT452491 P5_Prx +
hg19:Y:23020632-C-T hg38:Y:20858746-C-T BY142329 YY+
hg19:Y:23472009-A-AG hg38:Y:21310123-A-AG +
hg19:Y:2977483-C-CTG hg38:Y:3109442-C-CTG 12×TG*
hg19:Y:22237849-A-G hg38:Y:20075963-A-G DYZ19 *
hg19:Y:9564509-CTG-C hg38:Y:9726900-CTG-C IR3_Prx 9×TG**
hg19:Y:27918647-T-TC hg38:Y:25772500-T-TC P1_Y2 **
hg19:Y:15402765-A-ATT hg38:Y:13290885-A-ATT 14×T**
hg19:Y:14146667-T-C hg38:Y:12025961-T-C **
hg19:Y:16064144-A-G hg38:Y:13952264-A-G **
hg19:Y:16834746-CAAAAAAAAAAAAAAAAAAAAAAAA-C hg38:Y:14722866-CAAAAAAAAAAAAAAAAAAAAAAAA-C 45×A**
hg19:Y:18153685-T-A hg38:Y:16041805-T-A **
hg19:Y:18318852-C-A hg38:Y:16206972-C-A P6_Prx **
hg19:Y:18877756-G-C hg38:Y:16765876-G-C **
hg19:Y:19138351-A-ATC hg38:Y:17026471-A-ATC **
hg19:Y:19684402-A-G hg38:Y:17572522-A-G P5_Prx **
hg19:Y:22422362-G-A hg38:Y:20260476-G-A DYZ19 **
hg19:Y:24015846-T-TTCC hg38:Y:21869699-T-TTCC **
hg19:Y:25982142-T-A hg38:Y:23835995-T-A P1_Y1 **
hg19:Y:13478549-T-C hg38:Y:11322873-T-C ***
hg19:Y:4279738-TTG-T hg38:Y:4411697-TTG-T 10×TG***
hg19:Y:13489394-G-C hg38:Y:11333718-G-C ***
hg19:Y:7656025-T-TA hg38:Y:7787984-T-TA 10×A***
hg19:Y:59013608-G-GTA hg38:Y:56867461-G-GTA 15×TA***
hg19:Y:13974693-CTTTT-C hg38:Y:11853987-CTTTT-C 17×T***
hg19:Y:5487197-A-AT hg38:Y:5619156-A-AT 10×T***
hg38:Y:10923656-A-T ***
hg19:Y:17122246-AT-A hg38:Y:15010366-AT-A 9×T***
hg38:Y:10744322-C-A ***
hg38:Y:56850374-T-A ***
hg19:Y:16503664-G-A hg38:Y:14391784-G-A ***
hg19:Y:16503667-T-A hg38:Y:14391787-T-A ***
hg19:Y:16309571-CAAA-C,CAA hg38:Y:14197691-CAAA-C,CAA 17×A***
hg19:Y:14772676-AT-A,ATT hg38:Y:12660745-AT-A,ATT 21×T***
hg19:Y:5495445-G-GTT hg38:Y:5627404-G-GTT 14×T***
hg19:Y:8842942-G-T hg38:Y:8974901-G-T ***
hg19:Y:17048781-GT-G hg38:Y:14936901-GT-G 10×T***
hg19:Y:13450139-TTCCA-T hg38:Y:11294463-TTCCA-T ***
hg19:Y:2673751-C-T hg38:Y:2805710-C-T ***
hg19:Y:3960352-ATGTGTG-A,ATG hg38:Y:4092311-ATGTGTG-A,ATG 16×TG***
hg19:Y:9173420-TG-T hg38:Y:9335811-TG-T ***
hg19:Y:9909029-A-G hg38:Y:10071420-A-G ***
hg19:Y:9991637-C-CT,CTT hg38:Y:10154028-C-CT,CTT 20×T***
hg19:Y:13302962-C-CAA hg38:Y:11147286-C-CAA 17×A***
hg19:Y:13456019-GATTCCATTCCATTCCATTCCATTCCATTCCATTCC-G,GATTCCATTCCATTCCATTCCATTCCATTCCATTCCATTCC hg38:Y:11300343-GATTCCATTCCATTCCATTCCATTCCATTCCATTCC-G,GATTCCATTCCATTCCATTCCATTCCATTCCATTCCATTCC 11×ATTCC***
hg19:Y:13484584-G-A hg38:Y:11328908-G-A ***
hg19:Y:21697366-C-A hg38:Y:19535480-C-A ***

In the table above, the meaning of the confidence field depends on whether the data comes from an FTDNA kit or an FGC kit. For FTDNA kits, + implies a "PASS" result with just one possible variant, * indicates a "PASS" but with multiple variants, ** indicates "REJECTED" with just a single variant, and *** indicates "REJECTED" with multiple possible variants. 'A*' are heterozygous variants not called by FTDNA, but still pulled from the VCF file. For FGC kits, + indicates over 99% likely genuine (95% for INDELs); * over 95% likely genuine (90% for INDELs); ** about 40% likely genuine; *** about 10% likely genuine. Manual entries read directly from a BAM file will be either + indicating positive, or * indicating that the data show a mixture of possible variants.

For the FTDNA kits, the BED data is encoded in the background color of the cells. Those cells with a white background have coverage, those with a grey background indicate no coverage in the BED file, and those with a pink background indicate the mutation is on the edge of a coverage region. These pink regions often indicate that the individual may be positive for a SNP even if there is no corresponding entry in the vcf file.

The combBED column indicates whether or not the mutation is a SNP and falls in the combBED region defined in Defining a New Rate Constant for Y-Chromosome SNPs based on Full Sequencing Data by Dmitry Adamov, Vladimir Guryanov, Sergey Karzhavin, Vladimir Tagankin, Vadim Urasin.

The McDonald BED column indicates whether or not the mutation is a SNP and falls in the BED region used by Dr. Iain McDonald in the age analysis he does for R-U106 men.

Age Analysis Information (work in progress)

AllMcDonaldYFull
Kit: 1564561487168693255038280448
Used in age calculations1487168693255038280448
Counts of SNPs119
Variant counts last updated 2026-04-26 03:06:23.



Big Tree Main Page