Lindsey

BigY2: 824861
MDKA Birth: United States > South Carolina

Tree Position

R-P312/S116 > Z40481 > ZZ11 > DF27/S250 > Z195/S355 > BY161355

Unique Mutations

The mutations unique to this man are summarized in the table below. Those with a '+' or '*' confidence level are considered by FamilyTreeDNA or FullGenomesCorp to be high quality SNPs/INDELs. For completeness, all other mutations of lesser confidence are included as well. These additional mutations may be useful for distinguishing between very closely related men.

Occasionally, some of the mutations listed here will be thought to be shared with other men in which case they might appear in upstream blocks on the tree. When this happens, the 'Blocks' field will indicate what block they appear in. Such a situation might arise with BigY men if the BED data suggests another man may be positive for a SNP, even though it doesn't appear in his VCF data. It might also happen if Chromo2 testing or Sanger sequencing of other men not on the tree show the SNP to be shared.

POS-REF-ALT (hg19) POS-REF-ALT (hg38) Blocks Names Region McDonald BED combBED STRBigY2
824861
20648567-A-AAAAGG 18486681-A-AAAAGG P4_Prx 11×AAAGGA*
58983148-C-T 56837001-C-T A*
6283143-G-A 6415102-G-A IR3_Dst A*
28817613-G-A 26671466-G-A A*
6167670-T-C 6299629-T-C IR3_Dst A*
9587226-C-T 9749617-C-T IR3_Prx A*
19632097-C-CA 17520217-C-CA P5_Prx A*
19809964-C-T 17698084-C-T P5_Prx A*
20488208-G-C 18326322-G-C P5_Dst A*
23179433-G-A 21017547-G-A YA*
28817173-G-T 26671026-G-T A*
19220197-G-A 17108317-G-A YY+
5690869-T-C 5822828-T-C BY177946 +
8059077-T-C 8191036-T-C BY178223 YY+
8120213-G-T 8252172-G-T BY178232 YY+
8539168-C-A 8671127-C-A BY178325 YY+
8819345-C-G 8951304-C-G BY178393 YY+
8821227-A-T 8953186-A-T BY178395 YY+
9035081-G-C 9197472-G-C BY178429 Y+
14201672-G-A 12080966-G-A BY178616 YY+
14362766-G-A 12242061-G-A BY178651 YY+
14948675-G-T 12836749-G-T BY178747 YY+
16908360-G-C 14796480-G-C BY179094 YY+
17041314-C-T 14929434-C-T BY179117 YY+
18225805-C-A 16113925-C-A BY179358 Y+
18634268-T-C 16522388-T-C BY179404 YY+
22466593-A-C 20304707-A-C BY221744 DYZ19 +
22830880-A-G 20668994-A-G BY179898 YY+
22992185-G-A 20830299-G-A BY179926 YY+
23625115-A-AT 21463229-A-AT +
23293478-A-ATGTG 21131592-A-ATGTG 14×TG*
7195501-CTGTGTG-C 7327460-CTGTGTG-C 17×TG*
19691565-C-G 17579685-C-G P5_Prx *
22486171-C-A 20324285-C-A DYZ19 *
21082256-AAAGG-A 18920370-AAAGG-A Y16487 8×AAGG**
25201091-A-AAAGGAAGG 23054944-A-AAAGGAAGG g1 15×AAGG**
10686162-C-A **
17193072-C-A 15081192-C-A **
11027293-T-C **
11027331-C-A **
10772538-A-T **
10667018-C-CTATT **
10679330-C-A **
10760336-A-G **
9498766-C-A 9661157-C-A **
10754901-C-G **
10653931-C-A **
20229562-AC-A 18067676-AC-A P5_Dst **
21054379-C-CAA 18892493-C-CAA 18×A**
23006963-C-A 20845077-C-A **
3986199-C-T 4118158-C-T **
8730858-C-A 8862817-C-A **
14101059-G-T 11980353-G-T **
20473584-A-T 18311698-A-T P5_Dst **
11038097-C-A **
19464157-C-T 17352277-C-T **
19042655-G-A 16930775-G-A FGC46402 **
11038142-C-T **
10998029-C-A **
56826694-TTTGCATCCATTCAA-T **
21773793-C-A 19611907-C-A **
18187512-G-T 16075632-G-T **
11038132-C-A **
10851796-C-A **
6491109-C-A 6623068-C-A **
11038127-T-A **
10745872-C-A **
10785293-C-CGTTCTGTTCAGGTTA **
10795486-C-A **
10967620-G-T **
11038090-C-T **
11038160-C-CATTTT **
13706782-G-C 11551106-G-C **
11647970-TGAATG-T **
11673602-G-T **
14406834-TA-T 12286132-TA-T **
14424034-A-C 12303309-A-C **
14688353-C-A 12576419-C-A **
14743246-C-A 12631314-C-A **
16719771-C-A 14607891-C-A FT79464 **
23111062-G-T 20949176-G-T **
23697871-G-T 21535985-G-T **
24241275-T-C 22095128-T-C P3_b1 **
13869068-T-C 11748362-T-C ***
15483235-C-CCA 13371355-C-CCA 11×CA***
23123237-CA-C 20961351-CA-C 9×A***
19547815-TAAA-T 17435935-TAAA-T 16×A***
10965579-C-T ***
13489498-G-C 11333822-G-C ***
13476926-C-A 11321250-C-A ***
10667019-C-CGAATTA ***
56834453-CATTCCATTCCCTTCC-C,CATTTCATTCCTTTCA ***
13446565-C-A 11290889-C-A ***
2686629-AT-A 2818588-AT-A 10×T***
15264807-TA-T 13152896-TA-T ***
10989446-A-C ***
56832014-A-G ***
15423474-CAAAAA-C 13311594-CAAAAA-C 16×A***
10965568-C-T ***
3990664-C-CAA 4122623-C-CAA 18×A***
56826953-ATTCCATTCCATTAGT-A,ATTCCATTCCATTCCATGGCATTCCA ***
10772471-C-A ***
10861244-C-A ***
16427494-C-A 14315614-C-A ***
9403172-G-A 9565563-G-A ***
13446560-C-A 11290884-C-A ***
2960130-C-A 3092089-C-A ***
14395435-T-C 12274731-T-C ***
13446580-C-T 11290904-C-T ***
13446581-A-G 11290905-A-G ***
11025267-G-T ***
28784667-A-C 26638520-A-C ***
14241660-C-A 12120954-C-A ***
18933178-C-A 16821298-C-A ***
14604590-CTTT-C,CT 12492792-CTTT-C,CT 21×T***
22849491-CTTTTTT-C,CTTTTT 20687605-CTTTTTT-C,CTTTTT 20×T***
31148-C-A ***
21698933-C-CT 19537047-C-CT 9×T***
3626747-GTGGC-G 3758706-GTGGC-G ***
8835808-G-T 8967767-G-T ***
10652193-A-G ***
10666984-C-CATTCT ***
15468678-CAA-C,CA 13356798-CAA-C,CA 23×A***
16720426-T-C 14608546-T-C ***
17133864-C-A 15021984-C-A ***
18154446-T-C 16042566-T-C ***
18569871-GT-G 16457991-GT-G ***
19358096-C-A 17246216-C-A ***
22287573-G-A 20125687-G-A BY30334 FGC71323 DYZ19 ***
56835395-C-A ***

In the table above, the meaning of the confidence field depends on whether the data comes from an FTDNA kit or an FGC kit. For FTDNA kits, + implies a "PASS" result with just one possible variant, * indicates a "PASS" but with multiple variants, ** indicates "REJECTED" with just a single variant, and *** indicates "REJECTED" with multiple possible variants. 'A*' are heterozygous variants not called by FTDNA, but still pulled from the VCF file. For FGC kits, + indicates over 99% likely genuine (95% for INDELs); * over 95% likely genuine (90% for INDELs); ** about 40% likely genuine; *** about 10% likely genuine. Manual entries read directly from a BAM file will be either + indicating positive, or * indicating that the data show a mixture of possible variants.

For the FTDNA kits, the BED data is encoded in the background color of the cells. Those cells with a white background have coverage, those with a grey background indicate no coverage in the BED file, and those with a pink background indicate the mutation is on the edge of a coverage region. These pink regions often indicate that the individual may be positive for a SNP even if there is no corresponding entry in the vcf file.

The combBED column indicates whether or not the mutation is a SNP and falls in the combBED region defined in Defining a New Rate Constant for Y-Chromosome SNPs based on Full Sequencing Data by Dmitry Adamov, Vladimir Guryanov, Sergey Karzhavin, Vladimir Tagankin, Vadim Urasin.

The McDonald BED column indicates whether or not the mutation is a SNP and falls in the BED region used by Dr. Iain McDonald in the age analysis he does for R-U106 men.