Tree Position

R-M269 > L23 > L51 > P310 > L151 > S1194 > S1200 > S14328 > 13184964-C-G > BY46915 > BY62252 > BY125155 > 21070455-TG-T

Unique Mutations

The mutations unique to this man are summarized in the table below. Those with a '+' or '*' confidence level are considered by FamilyTreeDNA or FullGenomesCorp to be high quality SNPs/INDELs. For completeness, all other mutations of lesser confidence are included as well. These additional mutations may be useful for distinguishing between very closely related men.

Occasionally, some of the mutations listed here will be thought to be shared with other men in which case they might appear in upstream blocks on the tree. When this happens, the 'Blocks' field will indicate what block they appear in. Such a situation might arise with BigY men if the BED data suggests another man may be positive for a SNP, even though it doesn't appear in his VCF data. It might also happen if Chromo2 testing or Sanger sequencing of other men not on the tree show the SNP to be shared.

POS-REF-ALT (hg19) POS-REF-ALT (hg38) Blocks Names Region McDonald BED combBED STRBigY3
610671
BigY2
610671
5735907-A-G 5867866-A-G A+
6402420-T-G 6534379-T-G FT226107 A*
4339324-T-A 4471283-T-A A*
10657300-C-T A*
20426351-C-CA 18264465-C-CA P5_Dst 19×AA*
14171527-T-A 12050821-T-A YYA*
13448085-C-T 11292409-C-T A*
5506406-T-C 5638365-T-C A*
2957323-C-CT 3089282-C-CT 15×TA*
9548602-G-A 9710993-G-A IR3_Prx A*
19226196-G-A 17114316-G-A YYA*
20333189-C-CA 18171303-C-CA P5_Dst 17×AA*
13489054-A-C 11333378-A-C A*
10659187-T-C A*
25609082-G-C 23462935-G-C P1_gr1 A*
13450766-T-TATTCC 11295090-T-TATTCC A*
10837166-A-T FT433468 +**
17296930-G-T 15185050-G-T BY195016 YY++
13817702-G-A 11696996-G-A BY194008 ++
10754949-T-C *
5842119-T-C 5974078-T-C FT325242 *
56879910-A-G *
18563951-GTC-G 16452071-GTC-G *
13450109-CTCCACCCCATCCCATCCCATTCTAT-C,CTCCATTCCATTCCATGCCATTCCAT 11294433-CTCCACCCCATCCCATCCCATTCTAT-C,CTCCATTCCATTCCATGCCATTCCAT *
10672068-C-A **
10969167-C-A FT183149 **
13273309-C-A 11117633-C-A **
14385213-C-A 12264509-C-A **
4213246-C-A 4345205-C-A **
10753184-C-T FGC77525 **
13454262-C-A 11298586-C-A **
10852676-T-C **
17564903-C-A 15453023-C-A **
6226079-C-A 6358038-C-A IR3_Dst **
10852668-A-C **
18511240-G-T 16399360-G-T P6_Dst **
15605515-C-A 13493635-C-A **
8092071-C-A 8224030-C-A **
10753235-C-T **
17503474-CAG-C 15391594-CAG-C **
17654934-C-A 15543054-C-A **
7349215-C-A 7481174-C-A **
4063977-C-A 4195936-C-A **
28812247-G-C 26666100-G-C **
6191318-A-C 6323277-A-C IR3_Dst **
10921147-A-T **
28465126-C-A 26318979-C-A FT423784 **
16786167-C-A 14674287-C-A **
10661297-C-A **
10753246-A-C **
16342223-G-T 14230343-G-T **
13961818-C-A 11841112-C-A **
19318232-C-A 17206352-C-A **
24296346-C-A 22150199-C-A P3_t1 **
9306671-C-A 9469062-C-A **
4081574-A-C 4213533-A-C **
10773388-T-G **
18050412-C-A 15938532-C-A **
26355439-C-A 24209292-C-A P1_Y1 **
23371568-C-A 21209682-C-A **
22838670-GA-G 20676784-GA-G 11×A**
3407921-C-A 3539880-C-A **
21139499-C-A 18977613-C-A **
10656365-G-C **
11008981-C-T **
10846960-C-A **
9990068-G-T 10152459-G-T **
4937194-C-A 5069153-C-A **
10767810-C-A **
19507074-C-A 17395194-C-A **
56844211-C-A **
10867917-C-A **
11037950-C-T **
4351349-C-A 4483308-C-A **
14505554-G-C 12393759-G-C **
10770684-A-C **
10828844-A-C **
3346910-C-A 3478869-C-A **
10991790-C-A **
5627604-C-A 5759563-C-A **
28570347-C-A 26424200-C-A **
10894645-C-A **
10921157-A-G FT127757 **
13631546-C-A 11475870-C-A **
10678647-C-T **
10938363-A-C **
28808596-C-A 26662449-C-A **
13643061-A-G 11487385-A-G **
28812219-G-C 26666072-G-C **
9116770-G-T **
14017643-C-A 11896937-C-A **
27947063-ATATAT-A 25800916-ATATAT-A P1_Y2 **
24290722-C-A 22144575-C-A P3_t1 **
10770677-C-G **
23311272-CTTTTT-C 21149386-CTTTTT-C 15×T**
18926887-AAAG-A 16815007-AAAG-A **
13447121-C-CG 11291445-C-CG **
10686695-G-A **
10769997-G-T **
10849683-C-A **
18201147-C-A 16089267-C-A **
13475511-C-A 11319835-C-A **
24660754-C-A 22514607-C-A P3_b2 **
7504956-C-A 7636915-C-A IR1_L **
10969285-C-G **
9979115-C-A 10141506-C-A **
13943087-C-A 11822381-C-A **
10852669-G-C **
16114249-A-AAT 14002369-A-AAT P8_Prx **
17794234-CTCTT-C 15682354-CTCTT-C 4×TCTT**
24884196-A-T 22738049-A-T g1 **
10973784-C-CT **
11005530-T-A **
3440350-C-A 3572309-C-A **
11000036-T-C **
7154652-C-A 7286611-C-A **
13468206-A-G 11312530-A-G **
22132410-C-A 19970524-C-A **
11005515-T-A **
27607095-G-T 25460948-G-T P1_Y2 **
10796523-T-A **
10889323-C-T **
11000054-G-C **
16102026-TTG-T 13990146-TTG-T P8_Prx **
13476461-T-A 11320785-T-A **
11020115-C-A **
28808583-G-T 26662436-G-T **
10900810-A-C **
27733737-AAAG-A 25587590-AAAG-A P1_Y2 **
11004334-C-A **
16829285-T-A 14717405-T-A **
11025431-ATCAAT-A **
10987751-T-A **
14607724-G-T 12495926-G-T **
25994234-T-C 23848087-T-C P1_Y1 **
10828858-C-T **
7369026-A-C 7500985-A-C **
28747705-ATTT-A 26601558-ATTT-A 27×T**
10656366-A-G **
56835430-C-A **
26117854-A-AC 23971707-A-AC P1_Y1 **
11000001-C-A **
11000031-T-A **
11000053-T-G **
11000066-T-A **
18730690-C-A 16618810-C-A **
10971883-A-G **
19701512-A-AC 17589632-A-AC P5_Prx **
13454277-C-T 11298601-C-T **
28545696-CAAAAA-C 26399549-CAAAAA-C 26×A**
22081048-C-A 19919162-C-A **
15060607-A-C 12948699-A-C **
21895506-C-A 19733620-C-A **
10992285-C-CTA **
10992285-C-CCTG **
10992310-C-T **
7054269-C-A 7186228-C-A **
13329101-C-A 11173425-C-A **
9075188-C-A 9237579-C-A 20×T**
13643070-G-A 11487394-G-A **
13223157-G-GGT 11067481-G-GGT **
13223172-G-T 11067496-G-T **
13223181-G-A 11067505-G-A **
19479889-C-A 17368009-C-A **
17367877-C-A 15255997-C-A **
10655927-T-G **
11645133-G-T **
14626982-C-A 12515050-C-A **
10693391-C-A **
16559930-A-C 14448050-A-C **
15230990-TC-T 13119076-TC-T **
15232136-G-T 13120222-G-T **
15753178-CTTTTTTTTTTTTT-C 13641298-CTTTTTTTTTTTTT-C 20×T**
16075339-C-A 13963459-C-A **
16466576-G-T 14354696-G-T **
16540055-G-A 14428175-G-A **
16622031-C-A 14510151-C-A **
14718917-G-T 12606985-G-T **
16760211-T-G 14648331-T-G **
17375032-A-G 15263152-A-G **
17402407-A-G 15290527-A-G **
17490025-T-C 15378145-T-C **
17916572-T-G 15804692-T-G **
17916581-A-C 15804701-A-C **
15081158-C-A 12969248-C-A **
14693876-C-A 12581942-C-A **
18159661-C-A 16047781-C-A **
13459410-C-A 11303734-C-A **
11034521-TC-T **
11037946-T-TAAATTCC **
13206316-C-G 11050640-C-G **
13213943-TG-T 11058267-TG-T **
13225953-A-G 11070277-A-G **
13269034-T-C 11113358-T-C **
13496665-G-T 11340989-G-T **
14560300-C-A 12448501-C-A **
11671372-A-G **
11677795-A-G **
13878632-A-C 11757926-A-C **
14273532-T-G 12152826-T-G **
14382852-G-A 12262148-G-A **
14385013-C-A 12264309-C-A **
14544159-G-A 12432360-G-A **
18101861-T-C 15989981-T-C **
18368636-GT-G 16256756-GT-G P6_Prx **
11004248-C-A **
28812245-G-C 26666098-G-C **
27216710-G-T 25070563-G-T P1_g3 **
27966869-ATATATATATATATATATATATATATAT-A 25820722-ATATATATATATATATATATATATATAT-A P1_Y2 **
28536245-TTG-T 26390098-TTG-T **
28596698-G-GTTTT 26450551-G-GTTTT 24×T**
28798125-G-A 26651978-G-A **
28812227-A-C 26666080-A-C **
56858162-AT-A **
26514894-C-A 24368747-C-A P1_Y1 **
5570430-T-C 5702389-T-C **
8065920-A-C 8197879-A-C **
13476535-T-G 11320859-T-G **
15185611-CT-C 13073697-CT-C **
15221284-C-T 13109370-C-T **
21352731-T-C 19190845-T-C **
23415277-T-C 21253391-T-C **
26514946-C-T 24368799-C-T P1_Y1 **
26358728-G-T 24212581-G-T P1_Y1 **
18443428-C-A 16331548-C-A P6_Dst **
21462645-C-A 19300759-C-A **
18937305-G-A 16825425-G-A **
19019937-C-A 16908057-C-A **
21055999-C-A 18894113-C-A **
21115816-A-T 18953930-A-T **
21247150-C-A 19085264-C-A **
21382748-A-C 19220862-A-C **
21796177-G-T 19634291-G-T **
25592848-C-T 23446701-C-T P1_gr1 **
21796396-G-T 19634510-G-T **
22220585-C-A 20058699-C-A DYZ19 **
22422808-T-G 20260922-T-G DYZ19 **
22810939-T-C 20649053-T-C **
23412186-C-A 21250300-C-A **
23465736-G-T 21303850-G-T **
24405170-C-A 22259023-C-A **
11009257-T-G **
10996952-A-C **
10772502-A-G **
7451295-T-C 7583254-T-C IR1_L **
5635295-A-G 5767254-A-G **
5669764-C-A 5801723-C-A **
5911907-C-A 6043866-C-A **
6593415-T-A 6725374-T-A **
7253801-A-G 7385760-A-G **
7295864-T-C 7427823-T-C **
7541269-G-A 7673228-G-A **
4540196-A-C 4672155-A-C **
8214295-C-A 8346254-C-A **
8344591-C-T 8476550-C-T **
9111466-G-A **
9076851-G-T 9239242-G-T **
9499178-C-A 9661569-C-A **
9499487-G-T 9661878-G-T **
4937235-G-A 5069194-G-A **
4511296-A-G 4643255-A-G **
9605323-A-ATGC 9767714-A-ATGC IR3_Prx **
56844230-G-T **
9596495-GT-G 9758886-GT-G IR3_Prx **
23742160-C-A 21580274-C-A **
7310601-G-T 7442560-G-T **
23425395-CA-C 21263509-CA-C **
28732884-G-T 26586737-G-T **
10744291-C-G **
14284021-C-A 12163315-C-A **
4456328-C-A 4588287-C-A **
56858350-AAGAAAGAAAG-A **
3046407-C-A 3178366-C-A **
3133125-C-T 3265084-C-T **
3734829-C-T 3866788-C-T **
4178475-A-T 4310434-A-T **
4215587-G-T 4347546-G-T **
4444420-C-A 4576379-C-A **
9566983-C-CTA 9729374-C-CTA IR3_Prx **
9945557-G-T 10107948-G-T **
10996951-T-A **
10921153-T-TTATAC **
10837045-C-G **
10843393-T-C **
10869289-C-A **
10894392-T-C **
10894416-C-T **
10916160-C-T **
10938257-C-A **
10781212-C-A **
10969250-C-T **
10969897-T-C **
10976552-C-A **
10981498-G-T **
10986564-A-G **
10989172-C-G **
10996939-T-C **
10813433-C-A **
10772025-C-A **
9977368-T-A 10139759-T-A **
10683068-CACTACACTCT-C **
10018221-C-A 10180612-C-A **
10658743-T-C **
10663668-A-C **
10676797-A-G **
10678654-A-C **
10683065-T-C **
10688952-C-A **
10771837-G-T **
10691194-T-G **
10750817-T-C **
10753204-C-A FT429706 **
10753223-TC-T **
10755855-T-G **
10768031-C-T **
10769656-A-C **
10791003-C-CCTTTCCATTG **
22587993-C-A 20426107-C-A Y78291 **
10883042-A-C **
10883034-G-T **
10973810-G-A **
10866102-C-A **
13643086-CG-A 11487410-CG-A **
13643057-G-A 11487381-G-A **
13643056-T-C 11487380-T-C **
10883115-C-A **
10883105-C-G **
10883075-C-A **
10883060-TTCCAA-T **
10883056-A-T **
10883049-A-G **
10883045-C-T **
10883033-T-C **
10772505-C-G **
10883032-T-C **
10883015-T-A **
10882995-G-A **
10936268-GTTCTGTCGCATTCCA-G **
16505988-C-A 14394108-C-A Y96525 31×T**
16505978-C-A 14394098-C-A **
10744288-A-G **
10955486-C-CATTTA **
10820394-A-T **
13488839-C-G 11333163-C-G **
13476457-G-C 11320781-G-C **
25995121-GTA-G 23848974-GTA-G P1_Y1 **
8661265-C-A 8793224-C-A **
10866106-C-CCAATT **
21700613-G-A 19538727-G-A **
15073304-CAG-C 12961394-CAG-C **
10801682-C-A **
10801669-T-A **
10801666-C-CGAATT **
10801657-G-C BY83850 **
10801656-C-G **
10969235-T-A **
10655939-T-C **
15557124-AAT-A 13445244-AAT-A 19×AT**
13454259-T-C 11298583-T-C **
9639094-T-TTG 9801485-T-TTG IR3_Prx 19×TG**
14008776-ACG-A 11888070-ACG-A **
14518424-C-A 12406625-C-A **
16226324-TTA-T 14114444-TTA-T **
10692224-G-A **
25995096-AAT-A 23848949-AAT-A P1_Y1 9×AT**
13143078-C-A 10632564-C-A Z7215 **
17081248-A-T 14969368-A-T 9×AT**
19377130-TGGAG-T 17265250-TGGAG-T 4×GGAG**
6770758-ATT-A 6902717-ATT-A 14×T**
10755423-A-C **
10801697-C-G **
24634120-G-T 22487973-G-T P3_t2 **
11030731-C-CCTCTCCATTG **
10895831-C-A **
10895806-C-G **
18343579-C-A 16231699-C-A P6_Prx **
10686663-T-C **
17081249-A-T 14969369-A-T **
56836223-G-T **
10801703-A-G **
10683394-T-C **
10936337-G-C **
10936336-A-C **
10936329-T-G **
10936316-G-C **
10936293-TTTAGA-T **
10936293-T-G **
10936288-A-C **
10936247-C-A **
10936242-A-AATTTC **
24884190-A-T 22738043-A-T g1 **
27620768-GAC-G 25474621-GAC-G P1_Y2 9×AC**
10755433-A-T **
58862980-T-A 56727891-A-T **
10936359-T-TGCAC **
10794307-T-C **
10794297-T-C **
10794276-C-T **
10794267-T-A **
10691040-T-C **
10653490-T-G **
10790993-T-G **
6310837-G-T 6442796-G-T FT74201 IR3_Dst **
13705509-T-A 11549833-T-A **
13998071-CTTT-C 11877365-CTTT-C 19×T**
5097348-CT-C 5229307-CT-C 26×T**
13447111-C-G 11291435-C-G **
13223165-A-G 11067489-A-G **
10936351-CTGTT-C **
10992284-T-A **
13466099-G-T 11310423-G-T **
5084713-AT-A 5216672-AT-A 10×T**
14502618-AT-A 12390823-AT-A 10×T**
13223153-G-A 11067477-G-A **
10760463-C-T **
10683085-G-T **
10683055-T-C **
10683050-T-C **
10683070-C-T **
10959331-C-A **
7009187-CTTTTTT-C 7141146-CTTTTTT-C 19×T**
13460990-C-T 11305314-C-T **
22316885-C-G 20154999-C-G DYZ19 **
10878266-T-C BY83932 **
13446539-C-T 11290863-C-T A13787 **
10992286-C-CA **
18101856-A-G 15989976-A-G **
10895780-C-G **
17569226-GAAA-G 15457346-GAAA-G 25×A**
10929881-C-T **
10929869-A-T **
9714718-T-TC 9877109-T-TC IR3_Prx **
19600432-G-T 17488552-G-T P5_Prx **
11037941-A-T **
28791366-A-T 26645219-A-T **
10992335-C-T **
10992327-T-A **
10992317-T-C **
10992292-T-G **
10801691-C-G **
19127627-CA-C 17015747-CA-C 17×A**
10801706-C-G **
10796516-A-C **
10992291-A-T **
10826590-A-T **
10999998-A-G **
10658169-G-T **
11037945-T-C **
10989115-T-TC **
10989104-C-A **
10989103-A-T **
10989079-C-T **
10989074-C-T **
10796557-T-A **
10796528-C-G **
10796515-G-C **
10792439-T-G **
10796513-T-C **
10796505-C-G **
10796502-T-A **
10796501-A-C **
10796497-A-T **
10796484-T-C **
10796481-C-T **
10796471-G-C **
10796467-G-A FT219967 **
10796451-C-A **
10796443-T-C FT431592 **
10655838-T-A **
18401241-G-T 16289361-G-T P6_Gap **
15178394-C-A 13066480-C-A **
10859676-A-G **
10954297-A-T **
10852664-A-G **
10969252-A-T **
22422806-C-G 20260920-C-G BY50532 DYZ19 **
22422796-C-G 20260910-C-G FT455965 DYZ19 **
13453480-A-T 11297804-A-T **
24929402-G-T 22783255-G-T g1 **
18905494-C-A 16793614-C-A **
14021251-C-G 11900545-C-G **
8333626-A-T 8465585-A-T ZS5598 FGC35108 25×CTT**
6339131-AC-A 6471090-AC-A IR3_Dst **
10996933-T-A **
6329692-T-G 6461651-T-G IR3_Dst **
10852690-T-A **
10852660-G-A **
14430526-CA-C 12309799-CA-C 9×A**
58862994-G-C 56727877-C-G **
14764914-A-ATT 12652983-A-ATT 23×T**
13447118-AT-A 11291442-AT-A **
58862999-G-T 56727872-C-A **
13466101-G-C 11310425-G-C **
23005468-C-A 20843582-C-A **
10658149-C-CTT **
10658148-A-ATTT **
10658138-A-C **
8333623-C-T 8465582-C-T **
10751152-T-C **
10956618-C-A **
10956588-C-G **
10954308-T-TTCAAA **
10796491-A-C **
16305913-A-T 14194033-A-T **
11000007-C-T **
11005490-C-A **
11005477-G-GCTCTCCTTTA **
10753190-T-C FT429703 **
10801721-C-T **
10954293-T-G **
10885179-C-G **
5204456-C-T 5336415-C-T Y22970 **
10885157-T-A **
10885156-C-G **
11000008-A-C **
10686698-C-T **
11005523-C-CT **
22580062-G-T 20418176-G-T **
28756144-C-A 26609997-C-A **
59004541-A-G 56858394-A-G **
20998361-G-T 18836475-G-T P4_Dst **
11003706-T-G **
10992352-C-T **
9559493-TG-T 9721884-TG-T IR3_Prx **
6359640-TAAAAA-T 6491599-TAAAAA-T 22×A**
10658146-G-C **
10755392-ATCTCT-C **
8333620-T-A 8465579-T-A **
11005497-C-G **
10885191-C-T **
10973820-A-G **
10973816-T-C **
11037935-G-C **
10973821-T-C **
56835625-T-G **
10969292-A-T **
10973818-C-T **
10973795-A-T **
10973779-CA-C **
16621474-T-C 14509594-T-C **
21755816-C-T ***
21940393-C-CAA 19778507-C-CAA 17×A***
5393970-GTC-G 5525929-GTC-G ***
4345713-G-T 4477672-G-T ***
22996969-GATATAT-G 20835083-GATATAT-G 21×AT***
16988044-GA-G 14876164-GA-G 10×A***
58973976-C-A 56827829-C-A ***
6089764-GTT-G,GT 6221723-GTT-G,GT 31×T***
4778178-C-CA 4910137-C-CA 15×A***
13461019-A-G 11305343-A-G ***
5191228-CT-C 5323187-CT-C 27×T***
56885118-G-A ***
21592634-T-TA 19430748-T-TA 14×A***
26437169-C-CAA 24291022-C-CAA P1_Y1 28×A***
58976596-C-G 56830449-C-G ***
17564912-GAA-G 15453032-GAA-G 16×A***
15980721-TAA-T 13868841-TAA-T 17×A***
58974988-T-C 56828841-T-C ***
13466050-G-A 11310374-G-A ***
15860225-C-A 13748345-C-A ***
17186726-TAAAA-T 15074846-TAAAA-T 19×A***
3830098-AAGAC-A 3962057-AAGAC-A ***
14426037-AAT-A 12305312-AAT-A 8×AT***
22023684-GTTTTT-G 19861798-GTTTTT-G 17×T***
13488165-C-A 11332489-C-A ***
26047456-AT-A 23901309-AT-A P1_Y1 17×T***
13461015-G-T 11305339-G-T A18598 ***
26120150-T-C 23974003-T-C P1_Y1 12×TTCC***
17929275-G-T 15817395-G-T ***
14453709-GAA-G 12332982-GAA-G 18×A***
13450612-TCCA-T,TCTT 11294936-TCCA-T,TCTT ***
21830190-T-A 19668304-T-A 12×A***
13931739-CTTTT-C,CTTTTT 11811033-CTTTT-C,CTTTTT 22×T***
14451286-T-A 12330559-T-A ***
58979428-C-T 56833281-C-T ***
4019849-C-CA 4151808-C-CA 16×A***
19389717-TA-T,TAAA 17277837-TA-T,TAAA 17×A***
14671394-C-T 12559460-C-T ***
19429714-A-T 17317834-A-T ***
13811204-C-A 11690498-C-A 5×AATGG***
13488123-G-C 11332447-G-C ***
5555645-C-CA 5687604-C-CA 18×A***
3349229-CAAA-C 3481188-CAAA-C 22×A***
58984197-G-A 56838050-G-A ***
17170475-CT-C,CTTT 15058595-CT-C,CTTT 11×T***
13446001-G-C 11290325-G-C ***
4537586-CTTTT-C 4669545-CTTTT-C 21×T***
11009051-G-C,T ***
23196176-GTT-G 21034290-GTT-G 20×T***
11014467-C-T ***
16514375-C-A 14402495-C-A ***
10887422-T-C ***
10673940-T-C ***
16364111-TAC-T 14252231-TAC-T 11×AC***
19202928-CAA-C 17091048-CAA-C 25×A***
23364087-CAAA-C 21202201-CAAA-C 16×A***
10958359-C-G ***
14771649-CT-C,CTT 12659718-CT-C,CTT 17×T***
18390083-C-CAA 16278203-C-CAA P6_Gap 19×A***
11643683-G-A ***
10763308-C-A ***
10763302-A-T ***
10754966-C-A ***
10754953-A-AC ***
10754947-C-G ***
13469407-T-C 11313731-T-C ***
9374735-C-A 9537126-C-A ***
16823952-T-TAA 14712072-T-TAA 17×A***
10689024-A-T ***
10973966-C-CA,T ***
3628709-GAAAA-G 3760668-GAAAA-G 26×A***
6100552-TAA-T 6232511-TAA-T 15×A***
10763303-T-A ***
10772437-A-G ***
10764603-T-G ***
13478165-G-A 11322489-G-A ***
18959213-TCA-T 16847333-TCA-T ***
23123058-A-T 20961172-A-T 9×AT***
2775124-A-AT 2907083-A-AT 14×T***
10645844-A-T ***
14397351-AT-A 12276647-AT-A 10×T***
10764519-C-A ***
10851049-T-G ***
16749739-TT-T,TG 14637859-TT-T,TG ***
10942727-T-C,G ***
10754930-T-C ***
10935583-AT-A ***
15041209-CA-C 12929299-CA-C 10×A***
24877503-CTTTT-C 22731356-CTTTT-C g1 23×T***
10682540-T-C ***
14395642-C-A 12274938-C-A ***
10888013-A-AGTGCT ***
13488839-C-T 11333163-C-T ***
13859945-G-C 11739239-G-C ***
10805712-T-C ***
10973935-T-A ***
11643693-G-A ***
13489182-G-T 11333506-G-T ***
10973984-G-C,T ***
21405832-CAA-C 19243946-CAA-C 15×A***
13866800-C-T 11746094-C-T ***
5178062-CAAA-C 5310021-CAAA-C 20×A***
7090139-C-CT 7222098-C-CT 10×T***
22768819-CTTT-C 20606933-CTTT-C 20×T***
13844043-T-A 11723337-T-A ***
13643028-G-T 11487352-G-T ***
10942729-C-T ***
19517491-C-A 17405611-C-A ***
11009031-A-C,G ***
15865582-G-T 13753702-G-T ***
10691383-A-T ***
9361168-G-GAC 9523559-G-GAC 12×AC***
13488176-A-T 11332500-A-T ***
13488167-A-G 11332491-A-G ***
13643051-T-G 11487375-T-G ***
24407161-A-G 22261014-A-G ***
3275824-C-A 3407783-C-A ***
9519818-TTCTTTC-T,TTTTC 9682209-TTCTTTC-T,TTTTC ***
22843740-CTT-C 20681854-CTT-C 12×T***
6125116-T-C 6257075-T-C ***
6582710-T-C 6714669-T-C ***
7015303-G-T 7147262-G-T ***
15753178-CTTTT-C 13641298-CTTTT-C 20×T***
10987876-T-C ***
13844026-A-C 11723320-A-C ***
13446637-C-T 11290961-C-T ***

In the table above, the meaning of the confidence field depends on whether the data comes from an FTDNA kit or an FGC kit. For FTDNA kits, + implies a "PASS" result with just one possible variant, * indicates a "PASS" but with multiple variants, ** indicates "REJECTED" with just a single variant, and *** indicates "REJECTED" with multiple possible variants. 'A*' are heterozygous variants not called by FTDNA, but still pulled from the VCF file. For FGC kits, + indicates over 99% likely genuine (95% for INDELs); * over 95% likely genuine (90% for INDELs); ** about 40% likely genuine; *** about 10% likely genuine. Manual entries read directly from a BAM file will be either + indicating positive, or * indicating that the data show a mixture of possible variants.

For the FTDNA kits, the BED data is encoded in the background color of the cells. Those cells with a white background have coverage, those with a grey background indicate no coverage in the BED file, and those with a pink background indicate the mutation is on the edge of a coverage region. These pink regions often indicate that the individual may be positive for a SNP even if there is no corresponding entry in the vcf file.

The combBED column indicates whether or not the mutation is a SNP and falls in the combBED region defined in Defining a New Rate Constant for Y-Chromosome SNPs based on Full Sequencing Data by Dmitry Adamov, Vladimir Guryanov, Sergey Karzhavin, Vladimir Tagankin, Vadim Urasin.

The McDonald BED column indicates whether or not the mutation is a SNP and falls in the BED region used by Dr. Iain McDonald in the age analysis he does for R-U106 men.

Age Analysis Information (work in progress)

AllMcDonaldYFull
Kit: 610671987326680484487929079
Kit: 6106711476625692516498253317
Used in age calculations1476625692516498253317
Counts of SNPs33
Variant counts last updated 2022-07-30 03:29:58.



Big Tree Main Page