Tree Position

R-P312/S116 > Z290 > L21/S145 > S552 > DF13 > DF21/S192 > FGC3213 > ZZ1 > S3058 > S424 > S426 > S190 > FGC3215 > Z36747 > Y16487 > Y16486 > BY4583 > BY6580

Unique Mutations

The mutations unique to this man are summarized in the table below. Those with a '+' or '*' confidence level are considered by FamilyTreeDNA or FullGenomesCorp to be high quality SNPs/INDELs. For completeness, all other mutations of lesser confidence are included as well. These additional mutations may be useful for distinguishing between very closely related men.

Occasionally, some of the mutations listed here will be thought to be shared with other men in which case they might appear in upstream blocks on the tree. When this happens, the 'Blocks' field will indicate what block they appear in. Such a situation might arise with BigY men if the BED data suggests another man may be positive for a SNP, even though it doesn't appear in his VCF data. It might also happen if Chromo2 testing or Sanger sequencing of other men not on the tree show the SNP to be shared.

POS-REF-ALT (hg19) POS-REF-ALT (hg38) Blocks Names Region McDonald BED combBED STRFB38
791941-A
BigY3
791941
BigY2
791941
10847072-C-G A*
20536393-G-T 18374507-G-T P5_Dst A*
18275029-G-T 16163149-G-T P6_Prx A*
16101226-G-T 13989346-G-T P8_Prx A*
16156506-G-T 14044626-G-T P8_Dst A*
18450367-G-T 16338487-G-T P6_Dst A*
19676996-C-A 17565116-C-A P5_Prx A*
19817277-C-A 17705397-C-A P5_Prx A*
19846600-G-T 17734720-G-T P5_Prx A*
19887751-G-T 17775871-G-T P5_Prx A*
19991288-T-C 17879408-T-C P5_Prx A*
20083160-A-G 17971280-A-G P5_Dst A*
20111200-G-T 17999320-G-T P5_Dst A*
20216469-G-GTA 18054583-G-GTA P5_Dst A*
20330156-G-A 18168270-G-A P5_Dst A*
20330203-G-T 18168317-G-T P5_Dst A*
20359634-G-T 18197748-G-T P5_Dst A*
20423529-G-T 18261643-G-T P5_Dst A*
20486772-G-GA 18324886-G-GA P5_Dst 11×AA*
20501525-G-T 18339639-G-T P5_Dst A*
20640891-G-T 18479005-G-T P4_Prx A*
20655784-G-T 18493898-G-T P4_Prx A*
20703685-C-A 18541799-C-A P4_Prx A*
20727545-G-T 18565659-G-T P4_Prx A*
20851393-T-C 18689507-T-C P4_Dst A*
20866361-T-C 18704475-T-C P4_Dst A*
20946380-T-C 18784494-T-C P4_Dst A*
20952688-G-T 18790802-G-T P4_Dst A*
20970160-T-C 18808274-T-C P4_Dst A*
21005899-G-T 18844013-G-T P4_Dst YA*
21008524-G-T 18846638-G-T P4_Dst YA*
26150638-G-A 24004491-G-A P1_Y1 *A*A*
8505378-T-G 8637337-T-G BY73490 YY+++
13471776-CCGGG-TCAGC 11316100-CCGGG-TCAGC *
7144247-C-CT 7276206-C-CT 9×T*
22316204-T-C 20154318-T-C DYZ19 *
13452507-GAGTC-CACTTCACT 11296831-GAGTC-CACTTCACT *
10750778-T-C,TCATTC *
13449753-CAACCCCATTCTATTCCATTCT-AAACCCCATTCCATTGCATTCC,ATGAAACCCCATTCCATTGC 11294077-CAACCCCATTCTATTCCATTCT-AAACCCCATTCCATTGCATTCC,ATGAAACCCCATTCCATTGC *
13485725-GGT-TGC 11330049-GGT-TGC *
14530849-T-A,AA 12419050-T-A,AA *
16904731-A-AGT,T 14792851-A-AGT,T 20×GT*
20816924-CAAA-C,CAAAA 18655038-CAAA-C,CAAAA P4_Gap 22×A*
56847119-CA-AG,CG *
9535155-AT-A,ATT 9697546-AT-A,ATT IR3_Prx 17×T*
18369802-CAA-C,CAAA 16257922-CAA-C,CAAA P6_Prx 25×A*
22316159-C-A 20154273-C-A DYZ19 *
22345687-CC-CA,GT 20183801-CC-CA,GT DYZ19 *
22366175-TG-GA,GG 20204289-TG-GA,GG DYZ19 *
22447438-TTTCA-GTTCA,GTTCT 20285552-TTTCA-GTTCA,GTTCT DYZ19 *
22488169-GG-AA,GT 20326283-GG-AA,GT DYZ19 *
7503851-AACAC-A 7635810-AACAC-A IR1_L 20×AC**
6326213-GAC-G 6458172-GAC-G IR3_Dst 8×AC**
16535053-CT-C 14423173-CT-C 35×T**
20989908-CT-C 18828022-CT-C P4_Dst 11×T**
27550462-CT-C 25404315-CT-C P1_Y2 13×T**
22504773-C-G 20342887-C-G DYZ19 **
13699802-G-T 11544126-G-T **
14071348-ACCCGACTT-TCCTGAC 11950642-ACCCGACTT-TCCTGAC **
9657404-C-CA 9819795-C-CA IR3_Prx 12×A**
26514931-TCACA-T 24368784-TCACA-T P1_Y1 9×CA**
10892573-C-CGGAAG **
10892587-C-G **
2810452-A-AT 2942411-A-AT 9×T**
10847236-G-T **
13698834-A-G 11543158-A-G **
28763658-C-A 26617511-C-A **
17315581-C-A 15203701-C-A **
15743755-C-A 13631875-C-A **
17375303-G-T 15263423-G-T **
14483537-G-T 12362806-G-T **
9398077-C-A 9560468-C-A **
15957481-C-A 13845601-C-A **
10773385-C-A **
10980212-C-A **
8008047-G-T 8140006-G-T **
24264734-C-CAA 22118587-C-CAA P3_b1 **
11669504-C-A **
16702106-G-T 14590226-G-T **
13698886-T-C 11543210-T-C **
10661771-C-A **
10630580-G-T **
3287758-G-T 3419717-G-T **
3684996-G-T 3816955-G-T **
4272460-G-A 4404419-G-A **
4663665-C-A 4795624-C-A **
6326107-G-T 6458066-G-T IR3_Dst **
6354388-C-A 6486347-C-A **
6756988-G-A 6888947-G-A **
7123332-G-T 7255291-G-T **
7256397-C-A 7388356-C-A **
8810765-C-A 8942724-C-A **
8851071-C-A 8983030-C-A **
9019122-C-A 9181513-C-A **
10660022-T-A **
10765016-T-C FT172150 **
10779028-C-G **
10785282-C-CCAATA **
10801251-C-A **
10801951-C-A **
10802245-C-T **
10880956-T-C **
10925491-C-A **
10933707-C-A **
10933728-A-T **
10933732-A-G **
10938526-C-A **
10959190-GCATTC-G **
10959667-T-G **
10965128-G-T **
10976713-C-T **
11005019-C-A **
11033627-C-A **
11664255-G-T **
13809903-T-C 11689197-T-C **
13882030-G-T 11761324-G-T **
13911668-C-A 11790962-C-A **
13912451-C-A 11791745-C-A **
16707529-G-T 14595649-G-T **
17609677-C-A 15497797-C-A **
17776161-G-T 15664281-G-T **
18895661-G-T 16783781-G-T **
19297782-C-A 17185902-C-A **
20425940-G-T 18264054-G-T P5_Dst **
21393982-T-C 19232096-T-C **
21455860-C-A 19293974-C-A **
22062089-T-C 19900203-T-C **
22068525-C-A 19906639-C-A **
22069639-C-A 19907753-C-A **
22360227-T-C 20198341-T-C DYZ19 **
22788581-C-A 20626695-C-A **
22991587-C-A 20829701-C-A **
23277776-T-C 21115890-T-C **
23598016-C-A 21436130-C-A **
23860436-C-A 21698550-C-A **
24405206-C-A 22259059-C-A **
56763557-G-C **
24446852-A-AATAT 22300705-A-AATAT 15×AT**
28421647-CA-C 26275500-CA-C P1_gr2 15×A**
16148530-C-T 14036650-C-T P8_Dst **
27491653-CT-C 25345506-CT-C P1_Y2 25×T**
20941173-A-AT 18779287-A-AT P4_Dst **
13545640-ATT-A 11389964-ATT-A **
25565654-GTT-G 23419507-GTT-G P1_gr1 20×T**
2856977-C-T 2988936-C-T FTB35126 *****
6265062-C-A 6397021-C-A IR3_Dst **
13923489-C-A 11802783-C-A ****
12374632-C-G ****
17165315-T-C 15053435-T-C *****
18138218-A-G 16026338-A-G *****
18138234-A-G 16026354-A-G *****
19425816-T-C 17313936-T-C ****
13476550-CGGT-TGGC 11320874-CGGT-TGGC **
13257283-ATATATA-T 11101607-ATATATA-T **
13530099-A-T 11374423-A-T **
13698852-GG-TT 11543176-GG-TT **
13726298-C-A 11570622-C-A **
14977295-TCT-C 12865370-TCT-C **
18085409-A-C 15973529-A-C **
22722332-AGGCTGCT-CGGCGGC 20560446-AGGCTGCT-CGGCGGC **
24101909-C-A 21955762-C-A P3_b1 **
22504717-G-C 20342831-G-C DYZ19 **
21743207-CA-C **
9620998-G-T 9783389-G-T IR3_Prx **
9678760-A-G 9841151-A-G IR3_Prx **
16709207-G-C 14597327-G-C **
18015738-A-C 15903858-A-C P7_Dst **
18456069-A-ATT 16344189-A-ATT P6_Dst 15×T**
18511195-CAAAAAA-C 16399315-CAAAAAA-C P6_Dst 30×A**
18618897-A-G 16507017-A-G **
20269900-G-A 18108014-G-A P5_Dst **
20365888-A-T 18204002-A-T P5_Dst **
20411094-G-T 18249208-G-T P5_Dst **
20493276-C-A 18331390-C-A P5_Dst **
20493295-C-A 18331409-C-A P5_Dst **
20567463-G-A 18405577-G-A P5_Dst **
20609914-CA-TG 18448028-CA-TG P5_Dst **
20979104-G-T 18817218-G-T P4_Dst **
22503500-G-A 20341614-G-A DYZ19 **
21778739-C-CA **
24779074-CAAAA-C 22632927-CAAAA-C P3_b2 22×A**
25468526-CTTTT-C 23322379-CTTTT-C P2_r2 21×T**
27155028-ATGTGTGCG-A 25008881-ATGTGTGCG-A P1_g3 **
27311720-G-C 25165573-G-C P1_g3 **
27406421-A-G 25260274-A-G P1_g3 **
27448303-G-A 25302156-G-A P1_Y2 **
27533857-C-T 25387710-C-T P1_Y2 **
27662356-T-C 25516209-T-C P1_Y2 **
27775783-CA-C 25629636-CA-C P1_Y2 9×A**
27852981-A-G 25706834-A-G P1_Y2 **
27928702-A-G 25782555-A-G P1_Y2 **
27948656-A-G 25802509-A-G P1_Y2 **
27960506-G-T 25814359-G-T P1_Y2 **
28000857-G-A 25854710-G-A P1_Y2 **
28003873-T-A 25857726-T-A P1_Y2 **
28153738-C-G 26007591-C-G P1_b4 **
13459175-G-T 11303499-G-T ***
13748491-T-A 11592815-T-A ***
22484968-TG-T 20323082-TG-T DYZ19 ***
9559580-CT-C 9721971-CT-C IR3_Prx 11×T***
25500566-AT-A 23354419-AT-A P2_r2 10×T***
22459160-C-G 20297274-C-G BY220260 DYZ19 ***
27792527-AT-A 25646380-AT-A P1_Y2 10×T***
22225925-A-C 20064039-A-C ZS4165 DYZ19 ***
25831940-C-CT 23685793-C-CT P1_b3 16×T***
18480043-GA-G 16368163-GA-G P6_Dst 17×A***
7579109-T-C 7711068-T-C ***
7579118-T-C 7711077-T-C ***
27173659-GA-G 25027512-GA-G P1_g3 13×A***
19966013-T-TA 17854133-T-TA P5_Prx 14×A***
17686249-T-TA 15574369-T-TA 9×A***
22364704-A-G 20202818-A-G DYZ19 ***
9202929-T-G 9365320-T-G ***
22250184-T-A 20088298-T-A A3962 DYZ19 ***
27198886-C-CA 25052739-C-CA P1_g3 11×A***
18499927-GA-G 16388047-GA-G P6_Dst 13×A***
7103038-T-TAC 7234997-T-TAC 17×AC***
22363229-T-C 20201343-T-C DYZ19 ***
24598279-GA-G 22452132-GA-G P3_t2 9×A***
13869182-ATG-CTC 11748476-ATG-CTC ***
26900264-T-TA 24754117-T-TA P1_r3 22×A***
22502936-C-A 20341050-C-A DYZ19 ***
9236251-T-G 9398642-T-G ***
22361261-GTT-CTA 20199375-GTT-CTA DYZ19 ***
22358215-A-T 20196329-A-T DYZ19 ***
22362401-G-T 20200515-G-T DYZ19 ***
22452982-A-T 20291096-A-T DYZ19 ***
22453047-G-A 20291161-G-A DYZ19 ***
22360988-A-T 20199102-A-T DYZ19 ***
22363138-T-A 20201252-T-A DYZ19 ***
7783280-C-A 7915239-C-A V1432 FGC25563 ***
22360412-T-A 20198526-T-A DYZ19 ***
11643324-G-T ***
9618339-G-T 9780730-G-T IR3_Prx ***
22721757-GT-G 20559871-GT-G 10×T***
11017489-C-A ***
10992976-T-C ***
10992979-C-T ***
18687704-CA-C,CAA 16575824-CA-C,CAA 14×A***
18966043-C-A 16854163-C-A ***
19007619-CATAT-C,CAT 16895739-CATAT-C,CAT 10×AT***
15742087-G-T 13630207-G-T ***
8760517-CTTTTTT-C,CTTT 8892476-CTTTTTT-C,CTTT 20×T***
10785248-C-T ***
21766180-C-A ***
10686725-C-A ***
10979820-C-G ***
10979830-C-T ***
10979846-C-A ***
10979873-T-C ***
10785260-T-C ***
10992987-T-A ***
10839461-C-A ***
7567871-G-A 7699830-G-A ***
17885879-G-T 15773999-G-T ***
27540976-C-CA 25394829-C-CA P1_Y2 12×A***
8052682-C-A 8184641-C-A ***
8498338-CAA-C,CA 8630297-CAA-C,CA 16×A***
21457495-G-T 19295609-G-T ***
18184844-C-A 16072964-C-A ***
14607811-G-T 12496013-G-T ***
20497928-CCT-C 18336042-CCT-C P5_Dst ***
17004618-CAA-C,CAAA 14892738-CAA-C,CAAA 14×A***
3640555-C-T 3772514-C-T ***
19268165-C-A 17156285-C-A ***
10994159-C-G ***
22010462-CAA-C,CA 19848576-CAA-C,CA 16×A***
2752725-CAAAAA-C,CAAA 2884684-CAAAAA-C,CAAA 18×A***
4425790-C-A 4557749-C-A ***
7082560-C-A 7214519-C-A ***
7349542-C-A 7481501-C-A ***
7652912-C-A 7784871-C-A ***
7762173-G-A 7894132-G-A ***
7867879-GGAAAGAAAGAAA-G,GGAAAGAAAGAAAGAAAGAAAGAAA 7999838-GGAAAGAAAGAAA-G,GGAAAGAAAGAAAGAAAGAAAGAAA 16×GAAA***
7975826-C-A 8107785-C-A ***
7999977-C-A 8131936-C-A ***
8536167-G-A 8668126-G-A ***
8647809-T-C 8779768-T-C Y64261 ***
8689577-C-A 8821536-C-A ***
9006761-C-A 9169152-C-A ***
10661783-C-A ***
10785268-C-CAATCGGTTTA ***
10828713-C-T FT433039 ***
13254687-C-A 11099011-C-A ***
13472195-C-A,T 11316519-C-A,T ***
13799108-GTGGAA-G 11678402-GTGGAA-G ***
14080435-C-A 11959729-C-A ***
14296220-C-A 12175514-C-A ***
14393822-C-A 12273118-C-A ***
14393860-C-A 12273156-C-A ***
14461004-G-T 12340277-G-T ***
15047969-C-A 12936060-C-A ***
15366018-C-T 13254138-C-T ***
15412464-C-CAA 13300584-C-CAA 10×A***
15823133-C-A 13711253-C-A ***
15979887-C-A 13868007-C-A ***
16482359-TTATATA-T 14370479-TTATATA-T 9×TA***
16593787-G-A 14481907-G-A ***
16905790-G-A 14793910-G-A ***
17208372-C-A 15096492-C-A ***
17851608-T-C 15739728-T-C ***
18035665-CTTTTT-C 15923785-CTTTTT-C 30×T***
18528039-G-T 16416159-G-T P6_Dst ***
18690273-C-A 16578393-C-A ***
19306682-C-A 17194802-C-A ***
19400973-C-A 17289093-C-A ***
21138567-A-G 18976681-A-G FT129177 ***
21220355-C-T 19058469-C-T ***
21468745-ATTTTT-A 19306859-ATTTTT-A 25×T***
21509722-C-A 19347836-C-A ***
21762359-A-G 19600473-A-G ***
22091526-C-A 19929640-C-A ***
22618570-C-A 20456684-C-A ***
23142590-C-A 20980704-C-A ***
23142789-CT-C 20980903-CT-C ***
23209584-C-A 21047698-C-A ***
23309349-C-T 21147463-C-T ***
24931831-A-G 22785684-A-G g1 ***
19097426-G-T 16985546-G-T ******
18688500-CAAA-C 16576620-CAAA-C 20×A***
26631899-A-AT 24485752-A-AT P1_g2 20×T***
8718956-C-A 8850915-C-A ***
13727992-AGTCA-CGTCG 11572316-AGTCA-CGTCG ***
9577293-C-CA 9739684-C-CA IR3_Prx 8×A***
5248619-AT-A,ATT 5380578-AT-A,ATT 19×T***
4498179-ATTTT-A 4630138-ATTTT-A 23×T***
20979546-T-C 18817660-T-C P4_Dst ***
19505084-C-T 17393204-C-T ***
19505087-A-G 17393207-A-G ***
27502180-C-A 25356033-C-A P1_Y2 ***
22242371-AC-GG 20080485-AC-GG DYZ19 ***
16757043-AT-A,ATT 14645163-AT-A,ATT 27×T***
20938054-G-T 18776168-G-T P4_Dst ***
14097945-AT-A,ATT 11977239-AT-A,ATT 23×T***
13608647-CA-C,CAA 11452971-CA-C,CAA 27×A***
22475843-T-G 20313957-T-G BY223444 DYZ19 ***
3640559-C-T 3772518-C-T ***
12371950-CA-C,CAAAAA ***
16308980-T-C 14197100-T-C ***
16888302-T-TAAA 14776422-T-TAAA ******
21373462-T-A 19211576-T-A ******
28563960-T-C 26417813-T-C ******
13474008-CGTAG-GGTGA 11318332-CGTAG-GGTGA ***
56756874-GAATGGAATG-CAATGGAATC ***
13716333-G-T 11560657-G-T ***
13466016-TGTT-AGTC 11310340-TGTT-AGTC ***
2729644-ATGTCT-ATGTC,TTTTA 2861603-ATGTCT-ATGTC,TTTTA ***
4834268-AC-AAA,C 4966227-AC-AAA,C ***
4878246-CA-C,CAA 5010205-CA-C,CAA 18×A***
8100637-CAAAA-C,CAAA 8232596-CAAAA-C,CAAA 37×A***
9030412-A-AGGAAA,AGGAAG 9192803-A-AGGAAA,AGGAAG ***
9975269-C-T 10137660-C-T ***
10761013-GATTCCAC-CATTTCAA ***
13270742-AAAA-GAAG 11115066-AAAA-GAAG ***
13451897-T-CCATTCCATTC 11296221-T-CCATTCCATTC ***
13488952-TCCCAGGGCC-CCCCAGGCCT 11333276-TCCCAGGGCC-CCCCAGGCCT ***
13728941-TTGG-ATGG,ATGT 11573265-TTGG-ATGG,ATGT ***
13728961-GTCA-CTCA,CTCG 11573285-GTCA-CTCA,CTCG ***
13842693-G-C,GAATGG 11721987-G-C,GAATGG ***
12555882-CAA-C,CA 24×A***
14691111-C-G 12579177-C-G ***
15799136-CTTCC-C,T 13687256-CTTCC-C,T ***
16786235-TC-C,TTA 14674355-TC-C,TTA ***
16882821-A-G 14770941-A-G ***
17270261-C-T 15158381-C-T ***
19505084-CTAA-TTAG 17393204-CTAA-TTAG ***
21261823-CTTTA-ATTT,CTTT 19099937-CTTTA-ATTT,CTTT ***
21464556-GAAAAGAAAAAAAGATAAAGACAAAAAAGAAAGAGAGAGAAAGAAAGGAAAGAAAGAATG-AGAAAAGAAAAAAAGATAAAGACAAAAAAGAAAGAGAGAGAAAGAAAGGAAAGAAAGAATG,GAAAAGAAAAAAAGATAAAGACAAAAAAGAAAGAGAGAGAAAGAAAGGAAAGAAATAATT 19302670-GAAAAGAAAAAAAGATAAAGACAAAAAAGAAAGAGAGAGAAAGAAAGGAAAGAAAGAATG-AGAAAAGAAAAAAAGATAAAGACAAAAAAGAAAGAGAGAGAAAGAAAGGAAAGAAAGAATG,GAAAAGAAAAAAAGATAAAGACAAAAAAGAAAGAGAGAGAAAGAAAGGAAAGAAATAATT ***
22737248-AAG-AAA,G 20575362-AAG-AAA,G ***
23311386-GC-G 21149500-GC-G ***
23452108-A-T 21290222-A-T ***
23488834-TA-T,TTA 21326948-TA-T,TTA 30×A***
28596399-GTT-G,GTTT 26450252-GTT-G,GTTT 16×T***
28427876-T-C 26281729-T-C P1_gr2 ***
25964895-GTT-G 23818748-GTT-G P1_Y1 23×T***
6162372-T-G 6294331-T-G IR3_Dst ***
6566062-GT-G 6698021-GT-G 14×T***
7579136-CA-TG 7711095-CA-TG ***
9181085-A-ACC 9343476-A-ACC ***
9530155-T-C 9692546-T-C IR3_Prx ***
9542551-A-G 9704942-A-G IR3_Prx ***
9549013-G-A 9711404-G-A IR3_Prx ***
9550330-C-A 9712721-C-A IR3_Prx ***
9551020-T-C 9713411-T-C IR3_Prx ***
9592447-C-T 9754838-C-T IR3_Prx ***
9625902-T-C 9788293-T-C IR3_Prx ***
9656554-G-T 9818945-G-T IR3_Prx ***
9662153-A-G 9824544-A-G IR3_Prx ***
9679043-T-A 9841434-T-A IR3_Prx ***
9687302-C-T 9849693-C-T IR3_Prx ***
13545355-AG-AGAAGA,TGAAGA 11389679-AG-AGAAGA,TGAAGA ***
16154943-A-C 14043063-A-C P8_Dst ***
18335545-A-G 16223665-A-G P6_Prx ***
18487132-G-A 16375252-G-A P6_Dst ***
18489668-G-A 16377788-G-A P6_Dst ***
18493598-A-G 16381718-A-G P6_Dst ***
18497271-G-A 16385391-G-A P6_Dst ***
18514557-G-T 16402677-G-T P6_Dst ***
18516931-A-G 16405051-A-G P6_Dst ***
19744991-ATTTT-A,ATTT 17633111-ATTTT-A,ATTT P5_Prx 23×T***
20088441-T-A 17976561-T-A P5_Dst ***
20109010-A-G 17997130-A-G P5_Dst ***
20114736-G-T 18002856-G-T P5_Dst ***
20140910-T-A 18029030-T-A P5_Dst ***
20199881-CAAA-C,CA 18037995-CAAA-C,CA P5_Dst 28×A***
20217960-TA-T,TAAA 18056074-TA-T,TAAA P5_Dst 13×A***
20233863-C-T 18071977-C-T P5_Dst ***
20238850-C-T 18076964-C-T P5_Dst ***
20252796-C-AA 18090910-C-AA P5_Dst 24×A***
20264852-C-T 18102966-C-T P5_Dst ***
20270537-T-C 18108651-T-C P5_Dst ***
20283954-C-T 18122068-C-T P5_Dst ***
20344856-G-T 18182970-G-T P5_Dst ***
20378511-A-G 18216625-A-G P5_Dst ***
20383455-T-C 18221569-T-C P5_Dst ***
20427588-A-G 18265702-A-G P5_Dst ***
20435243-A-G 18273357-A-G P5_Dst ***
20447254-C-T 18285368-C-T P5_Dst ***
20450147-A-G 18288261-A-G P5_Dst ***
20478290-C-T 18316404-C-T P5_Dst ***
20503508-C-A 18341622-C-A P5_Dst ***
20506631-T-C 18344745-T-C P5_Dst ***
20510961-ATT-A,AT 18349075-ATT-A,AT P5_Dst 32×T***
20512578-A-T 18350692-A-T P5_Dst ***
20529089-ATT-A 18367203-ATT-A P5_Dst ***
20586936-T-C 18425050-T-C P5_Dst ***
20609799-T-C 18447913-T-C P5_Dst ***
20693615-CTT-C,CT 18531729-CTT-C,CT P4_Prx 12×T***
20784369-GT-G 18622483-GT-G P4_Prx 13×T***
20874907-A-G 18713021-A-G P4_Dst ***
20882630-C-T 18720744-C-T P4_Dst ***
20891251-A-T 18729365-A-T P4_Dst ***
20911819-A-G 18749933-A-G P4_Dst ***
20928526-T-C 18766640-T-C P4_Dst ***
20933260-A-T 18771374-A-T P4_Dst ***
20934261-T-C 18772375-T-C P4_Dst ***
20939312-C-T 18777426-C-T P4_Dst ***
20990401-T-A 18828515-T-A P4_Dst ***
20992501-G-T 18830615-G-T P4_Dst ***
21009523-A-G 18847637-A-G P4_Dst ***
21979689-C-G 19817803-C-G ***
21979715-A-G 19817829-A-G FT363710 ***
21979721-G-C 19817835-G-C ***
21979731-C-T 19817845-C-T FT403973 ***
21979737-G-T 19817851-G-T ***
22216901-T-A 20055015-T-A DYZ19 ***
22235568-CTTTT-TCTTT,TTTTC 20073682-CTTTT-TCTTT,TTTTC DYZ19 ***
22239005-G-T 20077119-G-T DYZ19 ***
22300642-T-G 20138756-T-G DYZ19 ***
22341439-T-C 20179553-T-C DYZ19 ***
22361657-CGTT-AGTG 20199771-CGTT-AGTG DYZ19 ***
22366554-CATG-GATT 20204668-CATG-GATT DYZ19 ***
22366581-GT-AC 20204695-GT-AC DYZ19 ***
22366846-GGTGA-TGTGG 20204960-GGTGA-TGTGG DYZ19 ***
22420158-CACT-GACC 20258272-CACT-GACC DYZ19 ***
22448577-C-T 20286691-C-T DYZ19 ***
22453648-T-A 20291762-T-A DYZ19 ***
22472954-T-G 20311068-T-G BY10861 DYZ19 ***
22475844-T-G 20313958-T-G DYZ19 ***
22477086-A-C 20315200-A-C DYZ19 ***
22481328-TTTAGG-GATATG,GTTATT 20319442-TTTAGG-GATATG,GTTATT DYZ19 ***
22485091-ATTG-TTTA,TTTG 20323205-ATTG-TTTA,TTTG DYZ19 ***
22503457-C-T 20341571-C-T DYZ19 ***
22508821-TAGT-AAGG 20346935-TAGT-AAGG DYZ19 ***
22511597-CTCAG-TTCAG,TTCAT 20349711-CTCAG-TTCAG,TTCAT DYZ19 ***
21765882-G-A ***
21771317-C-A ***
24023091-GC-G 21876944-GC-G ***
24529740-T-C 22383593-T-C P3_t2 ***
24544036-AT-A 22397889-AT-A P3_t2 ***
24545617-T-C 22399470-T-C P3_t2 ***
24578737-T-C 22432590-T-C P3_t2 ***
24583704-T-C 22437557-T-C P3_t2 ***
24587568-T-G 22441421-T-G P3_t2 ***
24618312-A-G 22472165-A-G P3_t2 ***
24625220-A-G 22479073-A-G P3_t2 ***
24626409-AT-A 22480262-AT-A P3_t2 ***
24633474-A-G 22487327-A-G P3_t2 ***
24668467-A-G 22522320-A-G P3_b2 ***
24756064-T-C 22609917-T-C P3_b2 ***
24760263-C-T 22614116-C-T P3_b2 ***
25433908-G-T 23287761-G-T P2_r2 ***
25440014-C-CTTT 23293867-C-CTTT P2_r2 19×T***
25453486-G-A 23307339-G-A P2_r2 ***
25484119-T-C 23337972-T-C P2_r2 ***
25486710-G-A 23340563-G-A P2_r2 ***
25491340-G-T 23345193-G-T P2_r2 ***
25500230-C-T 23354083-C-T P2_r2 ***
25500610-T-A 23354463-T-A P2_r2 ***
25574802-CTT-C 23428655-CTT-C P1_gr1 17×T***
25631849-C-T 23485702-C-T P1_b3 ***
25990634-GT-G,T 23844487-GT-G,T P1_Y1 23×T***
26276778-A-G 24130631-A-G P1_Y1 ***
26283209-CAAA-C 24137062-CAAA-C P1_Y1 21×A***
26424314-CAA-C 24278167-CAA-C P1_Y1 23×A***
26514623-T-C 24368476-T-C P1_Y1 ***
27149937-A-G 25003790-A-G P1_g3 ***
27178005-G-T 25031858-G-T P1_g3 ***
27199852-C-T 25053705-C-T P1_g3 ***
27219700-T-G 25073553-T-G P1_g3 ***
27241796-A-G 25095649-A-G P1_g3 ***
27253421-GA-G 25107274-GA-G P1_g3 ***
27301933-T-C 25155786-T-C P1_g3 ***
27304511-C-T 25158364-C-T P1_g3 ***
27345166-G-A 25199019-G-A P1_g3 ***
27366292-T-C 25220145-T-C P1_g3 ***
27368512-C-G 25222365-C-G P1_g3 ***
27394474-C-CT 25248327-C-CT P1_g3 ***
27413408-C-A 25267261-C-A P1_g3 ***
27458726-T-A 25312579-T-A P1_Y2 ***
27467574-C-A 25321427-C-A P1_Y2 ***
27477023-T-C 25330876-T-C P1_Y2 ***
27498061-A-G 25351914-A-G P1_Y2 ***
27529203-A-G 25383056-A-G P1_Y2 ***
27531110-T-C 25384963-T-C P1_Y2 ***
27540486-G-A 25394339-G-A P1_Y2 ***
27554537-T-C 25408390-T-C P1_Y2 ***
27554554-T-G 25408407-T-G P1_Y2 ***
27587815-T-C 25441668-T-C P1_Y2 ***
27627146-T-C 25480999-T-C P1_Y2 ***
27632362-T-A 25486215-T-A P1_Y2 ***
27644243-C-A 25498096-C-A P1_Y2 10×A***
27660930-A-G 25514783-A-G P1_Y2 ***
27660955-T-C 25514808-T-C P1_Y2 ***
27672058-C-T 25525911-C-T P1_Y2 ***
27714328-CTTT-C,CTT 25568181-CTTT-C,CTT P1_Y2 15×T***
27730276-A-T 25584129-A-T P1_Y2 ***
27764292-T-C 25618145-T-C P1_Y2 ***
27774248-T-A 25628101-T-A P1_Y2 ***
27787658-C-T 25641511-C-T P1_Y2 ***
27792462-A-G 25646315-A-G P1_Y2 ***
27799681-T-C 25653534-T-C P1_Y2 ***
27807198-C-A 25661051-C-A P1_Y2 ***
27808951-G-T 25662804-G-T P1_Y2 ***
27811797-C-T 25665650-C-T P1_Y2 ***
27874039-C-T 25727892-C-T P1_Y2 ***
27879493-A-G 25733346-A-G P1_Y2 ***
27893035-A-T 25746888-A-T P1_Y2 ***
27895007-A-G 25748860-A-G P1_Y2 ***
27899010-G-T 25752863-G-T P1_Y2 ***
27903011-A-G 25756864-A-G P1_Y2 ***
27952289-A-G 25806142-A-G P1_Y2 ***
27956998-A-G 25810851-A-G P1_Y2 ***
27962217-C-G 25816070-C-G P1_Y2 ***
27968846-C-T 25822699-C-T P1_Y2 ***
27989198-C-A 25843051-C-A P1_Y2 ***
27993564-A-G 25847417-A-G P1_Y2 ***
27999052-A-G 25852905-A-G P1_Y2 ***
28023950-A-G 25877803-A-G P1_Y2 ***
28044774-C-T 25898627-C-T P1_Y2 ***
28060000-C-T 25913853-C-T P1_Y2 ***
28070598-T-C 25924451-T-C P1_Y2 ***
28088200-G-A 25942053-G-A P1_Y2 ***
28147342-TA-T 26001195-TA-T P1_b4 10×A***
28176487-A-G 26030340-A-G P1_b4 ***
28204087-GTT-G 26057940-GTT-G P1_b4 15×T***
28228349-A-G 26082202-A-G P1_b4 ***
28255159-A-G 26109012-A-G P1_b4 ***
28347434-C-T 26201287-C-T P1_gr2 ***
28362542-A-G 26216395-A-G P1_gr2 ***
28366066-T-C 26219919-T-C P1_gr2 ***
28381422-A-G 26235275-A-G P1_gr2 ***
28392976-A-G 26246829-A-G P1_gr2 ***
28405384-CA-C 26259237-CA-C P1_gr2 10×A***
28409696-C-CA 26263549-C-CA P1_gr2 12×A***
28427859-T-C 26281712-T-C P1_gr2 ***
28456269-T-C 26310122-T-C P1_gr2 ***

In the table above, the meaning of the confidence field depends on whether the data comes from an FTDNA kit or an FGC kit. For FTDNA kits, + implies a "PASS" result with just one possible variant, * indicates a "PASS" but with multiple variants, ** indicates "REJECTED" with just a single variant, and *** indicates "REJECTED" with multiple possible variants. 'A*' are heterozygous variants not called by FTDNA, but still pulled from the VCF file. For FGC kits, + indicates over 99% likely genuine (95% for INDELs); * over 95% likely genuine (90% for INDELs); ** about 40% likely genuine; *** about 10% likely genuine. Manual entries read directly from a BAM file will be either + indicating positive, or * indicating that the data show a mixture of possible variants.

For the FTDNA kits, the BED data is encoded in the background color of the cells. Those cells with a white background have coverage, those with a grey background indicate no coverage in the BED file, and those with a pink background indicate the mutation is on the edge of a coverage region. These pink regions often indicate that the individual may be positive for a SNP even if there is no corresponding entry in the vcf file.

The combBED column indicates whether or not the mutation is a SNP and falls in the combBED region defined in Defining a New Rate Constant for Y-Chromosome SNPs based on Full Sequencing Data by Dmitry Adamov, Vladimir Guryanov, Sergey Karzhavin, Vladimir Tagankin, Vadim Urasin.

The McDonald BED column indicates whether or not the mutation is a SNP and falls in the BED region used by Dr. Iain McDonald in the age analysis he does for R-U106 men.