Tree Position

R-P312/S116 > DF19/S232

Unique Mutations

The mutations unique to this man are summarized in the table below. Those with a '+' or '*' confidence level are considered by FamilyTreeDNA or FullGenomesCorp to be high quality SNPs/INDELs. For completeness, all other mutations of lesser confidence are included as well. These additional mutations may be useful for distinguishing between very closely related men.

Occasionally, some of the mutations listed here will be thought to be shared with other men in which case they might appear in upstream blocks on the tree. When this happens, the 'Blocks' field will indicate what block they appear in. Such a situation might arise with BigY men if the BED data suggests another man may be positive for a SNP, even though it doesn't appear in his VCF data. It might also happen if Chromo2 testing or Sanger sequencing of other men not on the tree show the SNP to be shared.

POS-REF-ALT (hg19) POS-REF-ALT (hg38) Blocks Names Region McDonald BED combBED STRKane-BY3
191764
BigY2
191764
22231559-C-T 20069673-C-T DYZ19 *A*
18353251-T-G 16241371-T-G P6_Prx A*
22310257-G-A 20148371-G-A DYZ19 *A*
19835989-C-T 17724109-C-T P5_Prx A*
6337795-T-TGTGA 6469754-T-TGTGA IR3_Dst A*
6331507-A-G 6463466-A-G IR3_Dst A*
22454642-C-CA 20292756-C-CA DYZ19 A*
22310131-T-A 20148245-T-A DYZ19 *A*
4615235-CTATA-C 4747194-CTATA-C 9×TA+**
5027981-C-G 5159940-C-G FT120854 +**
4560469-A-G +
4801512-C-A +
4786293-T-A 4918252-T-A +**
4695970-C-A 4827929-C-A +**
5445539-T-C +
4336371-C-A 4468330-C-A +**
19330053-G-A 17218173-G-A Y+**
4550213-C-T +
4402613-T-A 4534572-T-A +**
6526308-A-G +
26381-GTTCCTTCAGATGTGTCCAGTTTCTTCCTCCTGGCAAGTTCATGGTCTTGCTCACTTCAAGAATGAAACTGTAGACCTTTACGGTGAGTGTTACAGCACTGAAAGATGTTATGTCCAGAGTTTT-G +
4155960-G-T 4287919-G-T +**
4132373-C-A 4264332-C-A +**
3962011-T-C 4093970-T-C +**
3777077-T-C 3909036-T-C +**
5028017-G-T 5159976-G-T +**
4236679-G-T +
4550212-T-G +
5976750-C-A 6108709-C-A Y4847 A3242 ++
7707484-AT-A 7839443-AT-A ++
29659-T-A +
7196872-T-C 7328831-T-C Z39383 YY++
7185982-G-C 7317941-G-C Z39382 YY++
21402181-C-CTTTTTTTTTTTTTTT 19240295-C-CTTTTTTTTTTTTTTT 34×T+
6933392-C-T 7065351-C-T Z39381 YY++
5844145-G-A 5976104-G-A +**
5112932-C-A 5244891-C-A +**
3261087-G-T +
3377692-G-T +
3718140-A-G +
5568614-G-T 5700573-G-T +**
7709849-C-T +
5227323-G-T 5359282-G-T +**
5134419-A-G 5266378-A-G +**
3536998-G-T 3668957-G-T +**
3194862-G-T 3326821-G-T +**
7709850-T-C +
10806667-T-A +
11202970-C-G +
11202975-A-G +
11202976-T-C +
11202977-CAA-C +
13358661-A-AAT 11202985-A-AAT +
11257686-G-T +
16624729-C-A 14512849-C-A Y+**
12225814-CA-C +
11113983-G-A +
12225816-T-G +
10964920-G-T +
16003729-C-A 13891849-C-A Y+
5895008-C-A 6026967-C-A +
13183523-T-C +
13183556-C-T +
14387465-G-T +
14563001-C-T +
11146792-A-T +
11113972-C-G +
3259936-A-G 3391895-A-G +**
56881325-TA-T 11×A+**
8332182-A-G 8464141-A-G Y86497 YY++
3108668-C-A 3240627-C-A +**
8983812-C-A +
2806469-C-G 2938428-C-G Z39380 YY++
21244054-C-A 19082168-C-A YY+**
9701264-T-C IR3_Prx +
10791303-C-T +
10071520-C-G +
10688224-C-G +
10693056-C-A +**
10803296-C-T +
10803297-A-G +
23087575-AT-A 20925689-AT-A +**
10806674-TC-T +
10806677-TTTGCA-T +
10885179-CTCCATTCCAT-C +
11006660-C-A +
10964939-T-TTC +
7834459-G-A 7966418-G-A Z39385 YY++
10800222-CTCCACTCCACTCCATTTCATTCCATTTTATTCCATTCCATTGCATTCCACTCCCCTAAACTCCAG-C +
8720463-C-T 8852422-C-T YY+**
58890212-A-T 56700659-T-A +
28497611-G-T 26351464-G-T Z39409 Y++
16631206-C-G 14519326-C-G Z39397 YY++
16469170-G-T 14357290-G-T Y+**
15750502-CTTTTTTT-C 13638622-CTTTTTTT-C 18×T+
15748958-G-A 13637078-G-A Y+**
15704736-A-C 13592856-A-C Z39396 YY++
15433448-G-C 13321568-G-C Y30782 YY+**
10990902-G-T +
17372815-A-T 15260935-A-T Y+**
14964452-A-G 12852527-A-G Y+**
10806692-T-A +
14798479-G-A 12686550-G-A YY+**
10806708-G-T +
56850468-C-A +
10964919-G-A +
14422662-C-T 12301937-C-T Y30785 YY+**
27516160-A-G 25370013-A-G P1_Y2 +**
23739823-G-T 21577937-G-T Z39407 ++
28093-C-T +
21336196-G-T 19174310-G-T Y+**
19330057-G-GATATC 17218177-G-GATATC +**
19330083-G-T 17218203-G-T Y+**
19353995-T-C 17242115-T-C Y+**
19415721-G-T 17303841-G-T Y29871 Y+**
19554525-C-A 17442645-C-A Y+**
21184491-A-T 19022605-A-T Z39875 YY+**
21189237-T-A 19027351-T-A Z39403 YY++
21377274-T-C 19215388-T-C Y+**
23549479-G-A 21387593-G-A Z39406 YY++
22122245-G-A 19960359-G-A Y30783 YY+**
17872424-C-A 15760544-C-A Z39402 YY++
17825490-G-T 15713610-G-T Y+**
22846430-A-G 20684544-A-G Z39404 YY++
22980933-C-A 20819047-C-A Y+**
17705070-G-A 15593190-G-A Z39401 YY++
23239448-A-T 21077562-A-T Z39405 Y++
17465449-G-A 15353569-G-A Z39400 YY++
28085-C-G +
14346520-AT-A 12225815-AT-A +
9147412-C-T 9309803-C-T Z39388 Y++
9909111-C-G 10071502-C-G Y+
10874280-C-A +**
11643726-T-TTGGAATGGAA +
10856931-C-A +**
28130-A-G +
10796984-C-A FT431617 +**
10795603-G-T +**
10783466-C-A +**
9909118-T-A 10071509-T-A Y+
10930996-C-A +**
9909086-C-G 10071477-C-G Y+
9909126-C-G 10071517-C-G Y+
28371-G-C +
28420-T-C +
28425-C-A +
28450-A-G +
10654045-C-A FT428206 +**
14886844-A-C +
10928564-C-A +**
10673113-C-CA +
14346520-A-G 12225815-A-G BY43339 YY+
13822594-CATCGAATGGAATGTA-C 11701888-CATCGAATGGAATGTA-C ++
29699-G-C +
10964955-T-A +
10964957-C-T +
15366145-G-T 13254265-G-T Y+
13873644-A-G 11752938-A-G Y+**
13871044-T-C 11750338-T-C BY43298 Y+
13834001-AGAATGTATTTGAATG-A 11713295-AGAATGTATTTGAATG-A ++
13632823-A-G 11477147-A-G +
11006140-C-G +**
11646450-AT-A +**
56734173-A-G +
13323394-G-A 11167718-G-A +**
13251843-C-T 11096167-C-T +**
11031231-C-G FT225521 +**
26544-A-T +
26548-T-C +
26556-G-C +
14886843-A-G +
19330050-A-G 17218170-A-G Y+**
19515514-A-G +
20338038-C-G DYZ19 +
15889928-C-G P7_Gap +
26343173-T-C +
19217878-A-G +
19330084-G-A 17218204-G-A CTS10219 Y+**
13474522-C-A 11318846-C-A +
56743320-C-T +
20179461-TG-T DYZ19 +
17950825-AATAT-A 15838945-AATAT-A 27×AT+
22785802-G-T g1 +
58985431-C-A 56839284-C-A +**
17065544-G-A +
26495223-C-A 24349076-C-A BY3501Z39408 BY14185 P1_Y1 6×TAAA*+
56763786-G-A +
23156402-C-T P2_r1 +
20096590-GGTTCATGGTCTTGCTCACTTCAAAAATGAAACTGGAGACCATTACGGTGAGTGTTACAGCACTTAAAGGTGTTATGTCCAGAGTTTGTTCCTTCAGATGTGTCCAGTTTCTTCCTCCTGGCAA-G DYZ19 +
20321159-A-T DYZ19 +
16903037-C-T +
14696029-G-A 12584095-G-A YY+
56824119-C-A +
17435678-C-T 15323798-C-T Z39399 YY++
16499362-G-A 14387482-G-A Y+
23505327-G-A P1_b3 +
24225671-T-C P1_Y1 +
14706731-G-A 12594797-G-A Y1208 Z39393 YY++
56757041-A-C +
13740666-T-A 11584990-T-A +
22502976-A-T 20341090-A-T DYZ19 +
12763-C-A +
11006202-C-A +**
19509579-G-T +
20073679-AAACTTTTAAGTGCTGTAACACT-A DYZ19 +
12776-T-G +
14006721-G-A 11886015-G-A FGC65416 F18328 YY+**
24375348-G-A 22229201-G-A +
20890030-A-G +
26343220-A-G +
12781-G-A +
23070772-C-CTTTTTTT 20908886-C-CTTTTTTT 29×T+
26343222-C-A +
8378186-C-T 8510145-C-T ZS3315 Z39386 YY++
14696022-ACAG-A 12584088-ACAG-A +
28805415-G-T 26659268-G-T BY227407 *
21730548-ATTT-A,ATTTT 19568662-ATTT-A,ATTTT 23×T*
28805430-A-G 26659283-A-G *
13478041-T-G 11322365-T-G *
13470912-ACCAC-A 11315236-ACCAC-A *
10657373-T-A *
56833893-G-GTCCACT,T *
10657364-C-T *
13484167-A-G 11328491-A-G *
26055411-A-G P1_b4 *
10657318-T-TA *
13468187-C-A 11312511-C-A *
13474380-G-A 11318704-G-A *
25243608-G-A P1_g3 *
9994959-T-C 10157350-T-C Y*
10657323-T-TAGG *
13453396-T-C 11297720-T-C *
10657319-C-CA *
56833228-T-TTCCATTCCACTCCACTCCTTTCCATTCCATTCCACTCCAC *
13483012-T-A 11327336-T-A *
22220025-T-A 20058139-T-A DYZ19 *
10686682-TTTCCA-T *
10669540-A-ACTGCAT *
22220053-T-C 20058167-T-C DYZ19 *
22220056-T-G 20058170-T-G DYZ19 *
22238377-A-ATC 20076491-A-ATC DYZ19 *
22220022-G-A 20058136-G-A DYZ19 *
22238379-CTG-C 20076493-CTG-C DYZ19 *
24929439-TACAC-T,TAC 22783292-TACAC-T,TAC g1 14×AC*
13474012-G-GATGA 11318336-G-GATGA *
13474004-TGTAC-T 11318328-TGTAC-T *
26223835-TTA-T,T P1_gr2 17×TA*
26097642-G-T P1_b4 *
10669543-C-CA *
10669576-T-C *
10669544-C-CTCTACT *
10669545-G-GTA *
10669556-T-C *
10669558-C-CCA *
10669560-T-TCCA *
13483139-A-C 11327463-A-C *
19206934-TTA-T,TTATA 17095054-TTA-T,TTATA 10×TA*
22220026-G-T 20058140-G-T DYZ19 *
10669565-A-G *
10669569-C-T *
10669571-T-C *
13466393-C-G 11310717-C-G *
13483314-C-T 11327638-C-T *
13470917-C-CTGAT 11315241-C-CTGAT *
24884168-C-CT,CT 22738021-C-CT,CT g1 20×T*
13465099-C-G 11309423-C-G *
22389083-T-C P3_t2 *
22513435-AT-A P3_b2 8×T*
13599429-AAATGAGATG-A 11443753-AAATGAGATG-A *
13599427-TG-T 11443751-TG-T *
22619702-T-A P3_b2 *
56832886-CTCAACTCAAT-C *
11022153-TTCC-T *
11557473-AAGTGGAATGGCATCG- *
11557465-C- *
10652337-CAGCTCACAATTCATTTCACTTTTCCATTCCATTCCATTCCTTTCAATTACATTCCACACCATTCCACCACCCTCCACTCTACTCCATTCCATTCCATTGCATTCCATTCCATTTCGTTCCATTCCATTTCATTCCATTCCATTCCTTT-C *
10652277-CATTCTGTCTTCAACAGGATCTCACTTTGTCACTTAGGCTGGAGTGCAGTGTCACAA-C *
13484174-A-T 11328498-A-T *
28805548-G-GAAT 26659401-G-GAAT *
11022150-CCA-C *
13721271-G-T 11565595-G-T *
28805544-A-G 26659397-A-G *
13480822-A-T 11325146-A-T *
21580184-A-G *
15084869-TAGAA- 14×AGAA*
13473845-A-G 11318169-A-G *
13203845-C-G,G 11048169-C-G,G *
13203844-C-T,T 11048168-C-T,T *
23505521-G-A 21343635-G-A YY*
11308851-T- *
13721288-A-G 11565612-A-G *
21642465-TA-T *
21646682-C-A *
21836461-G-T *
24278270-G-GAAAGAA 22132123-G-GAAAGAA P3_b1 *
56834250-TTC- *
13474393-G-T 11318717-G-T *
56834398-C-CACT *
28805546-T-TGG 26659399-T-TGG *
28805534-A-G 26659387-A-G *
13483303-G-A 11327627-G-A *
56706537-T-C *
10791257-A-G *
10791251-T-A *
56834817-C-CTCCACTCCAT *
10678044-C-CAAT *
56834385-T-TTCCACTCCACTCCAC *
56834374-A-AATCTATTCCGTTCCATTC *
24096373-C-A P1_Y1 *
10791269-T-G *
56707471-A-C *
13471846-C-A 11316170-C-A *
13471819-C-T 11316143-C-T *
13463435-CCT-C 11307759-CCT-C *
8160178-CAAA-C,CAA 8292137-CAAA-C,CAA 20×A*
13483324-G-C 11327648-G-C *
13483310-A-C 11327634-A-C *
23249555-CT-C,CTT P2_r2 20×T*
10791286-C-T *
28805525-T-A 26659378-T-A *
10905597-C-A *
22950301-GGAAA- g1 20×GAAA*
23054700-CAAAGAAAGAAAGAAAG-C,CAAAG g1 15×AAAG*
28805519-T-A 26659372-T-A BY227413 *
28805518-C-G 26659371-C-G *
28805516-T-A 26659369-T-A *
17196753-A-AAGGT,AAGGT 15084873-A-AAGGT,AAGGT *
22511240-T-A 20349354-T-A DYZ19 *
13480142-A-C 11324466-A-C *
13463442-G-T 11307766-G-T *
13463438-G-GCA 11307762-G-GCA *
13463427-G-T 11307751-G-T *
13463411-G-A 11307735-G-A *
13448796-C-CTCCAG 11293120-C-CTCCAG *
13448741-C-CTCCACTCCACTGCATTGCATTGCATTCCATTCCAT 11293065-C-CTCCACTCCACTGCATTGCATTGCATTCCATTCCAT *
9771942-T-A 9934333-T-A Y*
9732895-CAA-C 9895286-CAA-C IR3_Prx 20×A*
17632570-G-GTTT,GTTT 15520690-G-GTTT,GTTT 22×T*
13476676-A-T 11321000-A-T *
19042677-C-A 16930797-C-A Y*
56832797-TC-T *
56832822-T-TG *
13466503-C-G 11310827-C-G *
18256125-G-A 16144245-G-A FT170037 *
10926732-C-A *
17584167-C-A 15472287-C-A YY*
10803285-T-C *
23041195-T-A 20879309-T-A YY*
56747795-C-A *
2790415-C-T 2922374-C-T Y*
56839464-G-A *
56839454-A-G *
13473950-G-T 11318274-G-T *
28794020-A-G 26647873-A-G **
13474563-T-C 11318887-T-C *
17597154-CTT-C,CTTT 15485274-CTT-C,CTTT 20×T*
56832836-CTCCATGCCAG-C *
58862699-A-C 56728172-T-G *
56832761-TGCCAA- *
56832771-CTCCATTCCATTCCACTCTACTCCACTCCTCTCCATTCCACTCCAATCCACTCCACTCCATTCCACTCCATGCCAG- *
3535947-C-T 3667906-C-T *
8773877-C-A 8905836-C-A YY*
22511286-G-T 20349400-G-T DYZ19 *
21292579-TAAAA-T 19130693-TAAAA-T 15×A*
17089105-C-A 14977225-C-A YY*
21095609-C-A 18933723-C-A YY*
14062048-C-A 11941342-C-A YY*
13445880-C-T 11290204-C-T *
10791263-T-A *
9967154-C-A 10129545-C-A Y*
10921158-T-A *
4093486-C-A 4225445-C-A *
28625703-G-T 26479556-G-T ***
56832848-C-T *
56839478-G-A *
21266023-T-C 19104137-T-C Z39876 YY***
56850777-G-C *
22212003-G-T 20050117-G-T Y***
56850797-C-T *
56850817-AG-A *
56850827-C-G *
21328852-C-A 19166966-C-A YY****
56853759-C-A *
22235541-C-G 20073655-C-G DYZ19 ***
56858366-AAGAAAGAAAGGAAAGAAAAGAAAGAAAAGAAAGAAAGAAAAGAAAGAAAGAAAGAAAGAAAAGAAAGAAAGAAGGAAAGAAGGAAAGAAGGAAAGAAGGAAAGAAGGAAGGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGTT-A *
56858937-G-T *
19563255-C-A 17451375-C-A Y***
19424985-A-G 17313105-A-G Y****
14186-C-A *
14196-T-G *
22233341-CG-C 20071455-CG-C DYZ19 *
22340819-A-G 20178933-A-G DYZ19 **
26500566-T-C 24354419-T-C P1_Y1 ***
56834550-TTCCATTCCAC-T *
56832853-C-A *
26066840-C-T 23920693-C-T P1_Y1 **
56832873-CTA-C *
56832878-C-CTG *
56834400-C-CACTCCAT *
23476245-C-T 21314359-C-T FT314980 YY***
23050332-C-A 20888446-C-A YY****
56847794-T-C *
56835007-T-A *
56839327-G-A *
56839341-T-A *
22538105-T-C 20376219-T-C Y30784 Y***
56843365-G-A *
22443300-G-T 20281414-G-T DYZ19 **
56846682-G-T *
13489459-T-C 11333783-T-C *
18730703-C-A 16618823-C-A Y*
9967104-T-C 10129495-T-C Y*
22361551-G-T 20199665-G-T DYZ19 *
13474528-A-C 11318852-A-C *
56710610-C-A *
56725021-A-G *
16076219-C-CA 13964339-C-CA 8×A*
11033207-CCTGTG-C *
21238796-C-A 19076910-C-A YY*
22361479-T-A 20199593-T-A DYZ19 *
56710552-G-A *
11651912-A-G *
56732013-T-A *
13462256-C-G 11306580-C-G *
56763742-G-T *
19345128-TAAAA-T 17233248-TAAAA-T 18×A*
10032081-C-A 10194472-C-A Y*
13935521-AT-A 11814815-AT-A *
27808453-CT-C,CTT 25662306-CT-C,CTT P1_Y2 15×T*
21992963-TAAAA-T,TAA 19831077-TAAAA-T,TAA 23×A*
22509814-G-C 20347928-G-C DYZ19 *
13289992-C-A 11134316-C-A *
56707334-G-C *
26640541-G- *
22240707-T-C 20078821-T-C DYZ19 *
6117070-CTG-C 6249029-CTG-C 8×TG*
22361421-G-T 20199535-G-T DYZ19 *
19436718-AAGAAAGAAAGAAAGAAAGAAAG-A 17324838-AAGAAAGAAAGAAAGAAAGAAAG-A *
56680554-A-G *
13254344-C-A 11098668-C-A *
13479632-G-C 11323956-G-C *
15799353-TTCTC-T,TTC 13687473-TTCTC-T,TTC 15×TC*
26640551-GGAGTGGAATGGAATGGAATTGAATGGAGTGGAATGGAACGGAATGGAATGGAATGGAATCAAATCACATGGAATT- *
56680524-G-A *
15753178-CT-C,CTT 13641298-CT-C,CTT 20×T*
22723386-CAAAA-C,CAA 20561500-CAAAA-C,CAA 17×A*
13478406-G-T 11322730-G-T *
14062053-C-A 11941347-C-A BY189063 YY*
22427311-T-G 20265425-T-G DYZ19 *
13474473-A-T 11318797-A-T *
56839380-A-T *
16354566-C-A 14242686-C-A Y*
56832509-C-CTCAATTCCAT *
10926722-C-T *
22427316-G-A 20265430-G-A DYZ19 *
56832749-CATGCCACTCCATGCCAATCCACTCCATTCCATTCCACTCT-C *
9775201-C-G 9937592-C-G Y*
21813773-C-A 19651887-C-A YY*
13474546-C-T 11318870-C-T *
13474530-A-G 11318854-A-G *
10959379-C-A *
13466420-A-C 11310744-A-C *
22185855-CTTTTT-C,CTTTT 20023969-CTTTTT-C,CTTTT 25×T*
16060065-C-A 13948185-C-A Y*
15862901-T-C 13751021-T-C YY*
13478404-A-T 11322728-A-T *
22755535-C-G 20593649-C-G YY*
18403352-G-A 16291472-G-A P6_Gap *
6953518-C-A 7085477-C-A YY*
21606150-C-A 19444264-C-A YY*
17315475-C-A 15203595-C-A YY*
13484930-G-C 11329254-G-C *
10803288-C-T *
56827790-AT- *
15862909-G-A 13751029-G-A YY*
56827793-CCATTCTAGTCCATTCCATT- *
17126342-A-G 15014462-A-G Y*
56829948-C-A *
7043652-G-T 7175611-G-T Y*
21664054-G-GA 19502168-G-GA 10×A*
16340184-C-A 14228304-C-A YY*
56832351-T-TTTCCATTCCACTCCA *
56834779-G-A,GCGTTC 4×CATTC*
22361036-TG-T 20199150-TG-T DYZ19 *
56858370-AAGAAAGGAAAGAAAAGAAAGAAAAGAAAGAAAGAAAAGAAAGAAAGAAAGAAAGAAAAGAAAGAAAGAAGGAAAGAAGGAAAGAAGGAAAGAAGGAAAGAAGGAAGGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGTT-A *
11292513-CCA- *
11297726-T-C *
11295394-C-A *
11294428-CTCCACTCCACCCCATCCCATCCCATTCTATTCCAT- *
13449097-C-CCGTTCCACTGTACTCCACTCCGGTCCATTTCATTCCATCACATTCCATTCCACTCCACTTTACTCTATTCCATTACATTGCCCTCCATTCCATTCCAATATTTTCTTTCGACAGAATCTCACTCTGTCACCCAGGCTGGAGTGCAGTGCAACAATGTCAGCTCACATTTCATTTACCAATTCCCTTCCCTTCCATTCCATTCCCTTCCCTT 11293421-C-CCGTTCCACTGTACTCCACTCCGGTCCATTTCATTCCATCACATTCCATTCCACTCCACTTTACTCTATTCCATTACATTGCCCTCCATTCCATTCCAATATTTTCTTTCGACAGAATCTCACTCTGTCACCCAGGCTGGAGTGCAGTGCAACAATGTCAGCTCACATTTCATTTACCAATTCCCTTCCCTTCCATTCCATTCCCTTCCCTT *
13449082-G-GCATTCCACTCCATTCCACTCCACTC 11293406-G-GCATTCCACTCCATTCCACTCCACTC *
11292516-TTCC- *
16627258-C-A *
11307954-TAGCAAGCCATCCCGGTGCCCTCCCAGGCACTCCAGTAGCCTGGGCGCTCGTCTGCACTCCCCTCCGGCCTGCTGCTGGATGAGCTCCTGGTGAGCCCGGAGTTTCTGCAGCAGGCGCAA-T *
16656828-T-A *
18864961-A-AT,T 16753081-A-AT,T *
16859078-A-C *
16870730-ACC-A *
16873070-CT-C,TT 20×T*
11149007-C-A *
11305388-A-T *
11309429-T-A *
16910380-T-G *
11326961-A-G *
13489395-C-G,G 11333719-C-G,G *
11330058-T-C *
13485692-T-G,G 11330016-T-G,G *
11328764-C-A *
11328757-G-T *
11328746-T-G *
11325212-AG-A *
11310798-T-C *
11319697-A-T *
13474531-G-T,T 11318855-G-T,T *
11318081-A-T *
11313751-G-C *
11312664-C-A *
11310803-G-T *
11115793-G-T *
16910387-G-A *
11342186-T-C *
10791278-A-C,T *
19130687-C-A *
19218586-C-T *
19276899-TAA-T,TAAA 31×A*
10803260-CCACTCCATTT-C *
10803259-T-G *
10791284-T-G *
10760024-C-CATTA *
10807259-T-G,G *
10760023-T-TA *
10693224-C-A *
19302352-A-G *
21482762-C-CTTTTTTTTTTTTTTTT 19320876-C-CTTTTTTTTTTTTTTTT 19×T*
10686530-CCATTCCACTCCATTGCACTCCACTCCATTCCACTCATCTCCATTCCACTCCAATCCACTT-C *
10673114-T-TTCCATTCCATTCCATTCCATTCTA,TTCCATTCCATTCCATTCCATTCTA *
21200904-A-AG 19039018-A-AG *
18971445-G-A *
11103111-T-C *
11022156-C- *
11048304-TC-T,T *
11048296-ACCCCGCC-A,A *
13203971-C-T,T 11048295-C-T,T *
13203849-A-G,G 11048173-A-G,G *
13203843-A-G,G 11048167-A-G,G *
16937043-C-A *
17688095-T-C P5_Prx *
10892542-TCATTCCATTCCATTCCATTCCATTCCATTCCATTCCATTC-T *
10986688-CTCCAA-C *
10986680-C-G *
10967704-GTTCCATTGCA-G *
10967559-A-AATTCG *
10967504-T-G,TTTCCA *
10921159-T-C *
10912503-C-T *
16607006-ATATCTATCTATC-A,ATATC 13×TATC*
11348624-C-A *
10196666-C-A *
13368540-T-C *
13764480-CAA-AAA,C 21×A*
13751024-T-C *
13751011-T-C *
13638622-CTTTTTTT-C,C 18×T*
13472405-TA-T,T 12×A*
15480434-A-AT 13368554-A-AT *
13368537-G-T *
13955230-T-C *
13368536-C-G *
15480407-A-ATG 13368527-A-ATG *
13368524-T-G *
13368520-CAA-C *
13368231-ATTTTT-A,ATTTT 21×T*
13308452-C-A *
15940306-C-CAAAAA 13828426-C-CAAAAA 24×A*
14104950-G-A *
15928239-C-A *
15550287-GTAGATAGATAGATAGATAGATAGA-G,GTAGA 16×TAGA*
17446767-C-CT,CT 15334887-C-CT,CT 33×T*
15256153-C-A *
15190372-A-G *
15170061-TGATA-T,T 10×GATA*
14938219-CTTT- 15×T*
17021226-T-TA,TA 14909346-T-TA,TA 9×A*
15730805-GT-G *
14200448-G-T *
14567219-AT-A,A 25×T*
15750694-C-A *
14429297-C-A *
14419215-A-G *
15844176-CT-C,CTTT 13×T*
14312222-T-C *
14268346-T-C *
13231005-C-A *
16043538-C-A *
11365883-T-C *
11584523-A-C *
13819959-T-TGAATGGAATGGAATG,TGAATGGAATGGAATG 11699253-T-TGAATGGAATGGAATG,TGAATGGAATGGAATG 14×GAATG*
11668954-A-G *
11589628-AGAATG- 7×GAATG*
11587061-C-T *
11584531-G-T *
11584530-C-A *
11548676-TGAAATGGAATGGAATGGAATGGAAC- *
13871044-T-C,C 11750338-T-C,C *
11548648-G- *
11548647-G- *
11542921-C-A *
11542901-G-A *
11532547-CATGGAATGGAATGCA- *
11401826-C-A *
11724835-AAATGGAATGGAATGGAATGGAATGG-A,AAATGGAATGGAATGGAATGGAATGGAATGGAATGGAATGGAATGGAATGGAATGGAATGGAATGG 8×AATGG*
11879322-G-A *
13127566-C-A *
12536762-G-T *
13120957-C-A *
15208845-C-CA,CA 13096931-C-CA,CA 23×A*
13045065-C-A *
13045053-C-A *
16075183-C-T *
12865371-CT-C,TT 15×T*
14606301-A-AGGC 12494503-A-AGGC *
18592176-A-AG 16480296-A-AG *
12370616-G-T *
16205636-TG-T P6_Prx *
12308680-T-TTATA,TTATA 14×TA*
12274393-C-A *
16242332-A-G P6_Prx *
12100087-C-A *
12028868-C-A *
10661827-T-C *
10099970-G-T *
9521986-ATATC-A,A 9684377-ATATC-A,A 12×TATC*
12836822-C-T *
56724845-A-AATGGGATGGAATGGG *
11589625-CATAGA-C *
11578261-G-C *
11328748-ACATCACCTGGGTGATCAGAGCAGAGATATGTCATAATGCCCCCTGTAGGCAGAGCATAGAGAAGAGTTT-A *
56832515-T-TC *
12836823-A-G *
20324210-TC-T DYZ19 *
20324196-T-G DYZ19 *
3678434-ATACTT-A *
56724814-G-GAATGC *
20199153-CTTCTGGCAGGTTCATGGTCTTGCTCACTTCACTAAACGAAGCTGCAGACCTTACTGGTGAGTGTTACAGCACTTAAAGGTGTTATGTCCACAGTTTGTTCCTTCAGATGTGTCCAGGGTTTCTGT- DYZ19 *
20072453-TAAGGTCTGCAGCTTCATTCTTGACGTGATCAAGACCATGAATCTGCCAGAAAGAAGA-T DYZ19 *
20072434-TGCTGTAACACTCTATC-T DYZ19 *
20072383-GAAATTCTGGACACATCCGAATGAACAAACTCTGGACATAACACCTTTAA-G DYZ19 *
9335420-T-G *
11941350-G-A *
11327620-GC-G *
3987569-C-CT 4119528-C-CT *
20199537-C-G DYZ19 *
4403068-C-T *
4246411-AGAGAG- *
20199552-G-A DYZ19 *
3990664-C-CAAAAAAAAAA,CAAAAAAAAAA 4122623-C-CAAAAAAAAAA,CAAAAAAAAAA 18×A*
20199608-G-T DYZ19 *
20205590-G-C DYZ19 *
20163458-G- DYZ19 *
20269352-T-A DYZ19 *
20269478-G-A DYZ19 *
3102891-C-A *
2922372-C-T *
2783842-CT-C,CTTTTTTT 19×T*
20163459-T- DYZ19 *
20072374-CAGAA-C DYZ19 *
2938983-TTA-T,TTATA 20×TA*
20199521-A-C DYZ19 *
15431824-C-T *
9868419-TA-T 10030810-TA-T 10×A*
13745083-C-T 11589407-C-T *
13465121-A-G 11309445-A-G *
20935214-C-T *
21153827-CT-C,CTTT 20×T*
56743372-G-A *
13476724-T-G 11321048-T-G *
13734969-A-G 11579293-A-G *
21304405-G-T *
56834367-C-CTTTTCCACTCCATTCCGCTCCATTCCATTT *
28805562-GA-G 26659415-GA-G *
28805554-AGTGG-A 26659407-AGTGG-A *
56832960-C-CCACTCCA,CTCCA *
13483160-A-G 11327484-A-G *
10986863-A-ACTCCC *
13734976-AGAAAGGCATC-A 11579300-AGAAAGGCATC-A *
20342969-G-T DYZ19 *
13203901-C-T,T 11048225-C-T,T *
20163497-GCTCACTTCAAGAATGAAGCTGCAGAATTTAGTGGTGAGCGTTACAGCACTTAAGTTTTTATGTCCAGAGTTTGTTCCTTCAGATAAGTCTAGAGATTCTTCCTTCTGGCAGGTCCATGGTCTTC- DYZ19 *
20416065-GAAAAA-G,GAAA 24×A*
13474438-A-C 11318762-A-C *
13478418-G-T 11322742-G-T *
13478386-G-C 11322710-G-C *
13478365-A-G 11322689-A-G *
22220089-A-T 20058203-A-T DYZ19 *
9238896-GTGTA-G 9401287-GTGTA-G *
22089753-C-A 19927867-C-A YY*
20568200-C-A *
13468150-T-G 11312474-T-G *
20767827-G-T *
21369258-T-G 19207372-T-G YY*
21369255-G-A 19207369-G-A YY*
13475356-T-A 11319680-T-A *
4403095-A-G *
20198367-A-T DYZ19 *
10098711-T-C *
20078785-A-C DYZ19 *
8333957-C-A *
8184192-C-A *
20073705-CATAAAGGTCTGCAGCTTCATTCTTGAAGTAAGGAAGACCATGAACCTGCCAGAAGGAAGAAATTCTGGACACATCTGAAGGAACAAACTCTGGATATAACAAA-C DYZ19 *
20073898-G-A DYZ19 *
7841234-T-A *
20078781-A-T DYZ19 *
7622151-T-C IR1_L *
8549032-G-GTTTTT 8680991-G-GTTTTT 23×T*
7387394-C-CT 7519353-C-CT *
7349121-CTT- 14×T*
20078817-A-G DYZ19 *
7311693-GTT-G,GTTTTT 25×T*
7297409-GAC-G *
7165449-C-CTAT 7297408-C-CTAT *
8465439-TTTCTTCTTCTTCTTCTTCTTC-T,TTTCTTCTTCTTCTTCTTCTTCTTCTTC 31×TTC*
20071456-G-A DYZ19 *
7294133-A-G *
9490716-G-T *
20048784-TA-T *
9700422-G-T IR3_Prx *
9679146-T-C *
9679139-TTTC-T *
9531259-GCA-G *
9516388-C-T *
9477094-A-C *
9043707-C-A *
9393815-G-T *
9384051-CATATATATAT-C,CAT 27×AT*
9373665-AC-A *
20071454-AC-A DYZ19 *
9373663-AC-A *
9369749-C-A *
9057042-C-A *
7295265-CT-C *
7224259-G-T *
4457756-T-A *
20147906-TTACGGTC-T DYZ19 *
20130046-G-A DYZ19 *
6089071-A-T *
20130050-C-T DYZ19 *
20139872-C-T DYZ19 *
5004085-A-G *
4994315-C-A *
4912029-C-A *
6288253-C-A IR3_Dst *
4852895-G-A *
20147916-TGTTACAGCACTTAAAGGTGTTAAGTCCAGAGTTTGTTCCTTCAGATGTGTCCAGAGTTTCTTCCTTCTGGCAGGTTCTTGGTCTTGCTCACTTCAAGAATGAAGCTGCAGACCTTTAC-T DYZ19 *
20179463-TTCCTTCAGATGTGTCCAGGGTTTCTGTCTTCTGGCAGGTTCATGACTTCCTCACTTCAAGAATGAAGCTGCAGACCTTACTGGTGAGTGTTACAGCACTTAAAGGTGTTATGTCCAGAGTTTG-T DYZ19 *
20183770-GC-G DYZ19 *
20183772-TCACTTCAAGAATGAAGCTGCAGACCTTACCGGTGAGTGTTACAGCACTTAAAGGTGTTATGTCCAGAGTTTGTTCCTTCAGATGTGTCCAGGGTTTCTGTCTTCTGGCAGGTTCATGGTCTTGC-T DYZ19 *
20197856-T-A DYZ19 *
6265288-G-A *
6293347-C-CTTTTTTTTTTTTTTTTT 6425306-C-CTTTTTTTTTTTTTTTTT IR3_Dst 15×T*
22240712-C-CGT 20078826-C-CGT DYZ19 *
20085282-G-T DYZ19 *
7185317-AAAAG-A,AAAAGAAAG 17×AAAG*
7085209-C-A *
7013954-G-T *
20078827-ACT-A DYZ19 *
6959123-T-A *
20082206-C-A DYZ19 *
6906221-A-G *
6478046-TATA-T *
6866635-C-A *
6863807-T-G *
6863804-T-G *
6717200-A-G *
20099986-T-C DYZ19 *
6500318-A-G *
6500314-A-G *
6253684-C-A *
18982605-AGG-A 16870725-AGG-A *
16605612-A-T 14493732-A-T YY***
14240528-A-G 12119822-A-G Y30781 YY***
20027998-TTA-T 17916118-TTA-T P5_Prx *
26314856-G-T 24168709-G-T P1_Y1 *
21079200-CAT-C 18917314-CAT-C *
10772543-C-A ****
13710165-A-C 11554489-A-C *
19247117-C-A 17135237-C-A YY*
10805260-A-G ***
14387832-C-A 12267128-C-A YY***
19216539-C-A 17104659-C-A YY****
10925553-C-T *
9117945-G-T *
14648627-C-A 12536692-C-A YY****
3334526-G-T 3466485-G-T ***
10751283-C-A ***
14050862-C-A 11930156-C-A BY203056 YY****
14453734-G-A 12333007-G-A YY*
17211049-C-A 15099169-C-A YY*
10753265-C-T *
8422869-CAAAA-C 8554828-CAAAA-C 17×A****
56742772-G-C *
56835786-G-T *
13874115-G-T 11753409-G-T Y****
13835164-G-T 11714458-G-T ****
10753207-T-C *
18996930-C-A 16885050-C-A YY*
7869666-ATTT-A 8001625-ATTT-A 14×T*
56839461-T-TA *
4521570-C-A 4653529-C-A *
18382570-C-A 16270690-C-A P6_Gap *
10980769-C-A ****
21780472-G-T *
15615920-T-C 13504040-T-C Z39395 YY***
13484113-C-T 11328437-C-T *
10811369-C-A ***
19300673-C-A 17188793-C-A Y133623 Y*
15497351-C-A 13385471-C-A YY****
3696808-G-T 3828767-G-T *
4093432-C-A 4225391-C-A ****
10791261-C-A *
10686020-A-G ***
13288838-C-A 11133162-C-A *
27906857-G-T 25760710-G-T P1_Y2 *
23002386-C-A 20840500-C-A YY*
18398192-CATATAT-C,CATAT 16286312-CATATAT-C,CATAT P6_Gap 15×AT*
5650593-AACACAC-A 5782552-AACACAC-A 18×AC*
10657335-C-T *
18772456-C-A 16660576-C-A YY*
5720964-C-T 5852923-C-T ****
12826705-GA-G,GAA 18×A*
22264263-G-T 20102377-G-T DYZ19 *
10807293-T-A *
56847959-G-A *
19476786-CCACA-C 17364906-CCACA-C 12×CA*
13474549-C-G 11318873-C-G *
10687972-C-A ****
9498943-C-A 9661334-C-A *
14062049-C-A 11941343-C-A YY*
13907791-C-A 11787085-C-A YY*
11666614-C-A ***
28375653-T-TA 26229506-T-TA P1_gr2 14×A*
9936413-C-A 10098804-C-A Y*
28111763-C-A 25965616-C-A P1_Y2 *
56835055-A-T *
7391781-G-T 7523740-G-T YY****
7391814-T-C 7523773-T-C YY***
10682821-C-A *
10762979-T-C *
23468376-CTT-C 21306490-CTT-C 11×T*
17346267-T-C 15234387-T-C YY****
8854120-G-T 8986079-G-T YY****
10866346-C-A *
10959324-C-A ****
56847881-G-A *
6734852-C-CT 6866811-C-CT 10×T***
17527419-T-A 15415539-T-A YY*
13470435-G-A 11314759-G-A *
28549933-G-T 26403786-G-T ***
10933352-C-A ***
10931246-G-T ***
3815184-G-C 3947143-G-C ***
17021226-T-TA 14909346-T-TA 9×A*
13421455-C-A 11265779-C-A *
4241665-C-A 4373624-C-A ****
10895007-C-T ***
10895003-T-C ***
10894999-G-T ***
10885618-C-A ***
10885400-C-A ***
13588590-C-A 11432914-C-A *
2888722-T-A 3020681-T-A A19580 YY*
10880221-C-A *
7040007-G-T 7171966-G-T Y***
15280746-C-A 13168845-C-A YY****
16344400-C-CCTT,CCTTCTT 14232520-C-CCTT,CCTTCTT 5×CTT*
10669564-T-C *
10658151-C-A ***
56842899-G-T *
22903728-C-T 20741842-C-T YY*
56839593-T-C *
56707261-G-A *
56707259-C-G *
22309927-T-C 20148041-T-C DYZ19 *
13466169-G-T 11310493-G-T ***
10657351-A-T *
16528431-TA-T 14416551-TA-T 9×A*
7166776-C-A 7298735-C-A Y*
13212438-T-C 11056762-T-C ****
15687625-C-A 13575745-C-A YY****
7058283-C-A 7190242-C-A YY***
23981934-CT-C,CTT 21835787-CT-C,CTT 14×T*
7061135-T-C 7193094-T-C Y***
58979233-C-T 56833086-C-T *
7145592-C-A 7277551-C-A YY****
21451442-GTATA-G 19289556-GTATA-G 8×TA*
22361586-C-A 20199700-C-A DYZ19 *
11018241-T-A ****
13480837-C-T 11325161-C-T *
10804684-G-T ***
13480429-G-A 11324753-G-A *
15687891-C-A 13576011-C-A YY***
22855048-T-G 20693162-T-G Y***
15743815-C-T 13631935-C-T Y****
26593442-CT-C 24447295-CT-C P1_g2 11×T*
22295355-C-A 20133469-C-A DYZ19 *
13745274-C-G 11589598-C-G *
13745377-A-T 11589701-A-T *
22488163-G-T 20326277-G-T DYZ19 *
17942113-T-TC 15830233-T-TC ****
22503119-T-C 20341233-T-C DYZ19 *
17788819-TA-T 15676939-TA-T ****
22503129-G-C 20341243-G-C DYZ19 *
5204664-G-A 5336623-G-A BY58574 *
9967189-T-C 10129580-T-C Y*
22190201-T-C 20028315-T-C PF7530 YY*
9311531-T-G 9473922-T-G Y*
13728980-A-G 11573304-A-G *
13483963-T-G 11328287-T-G *
14125248-GAAA-G 12004542-GAAA-G 14×A*
9692087-A-C 9854478-A-C IR3_Prx *
22360257-T-A 20198371-T-A DYZ19 *
13465489-G-C 11309813-G-C *
13466465-G-A 11310789-G-A *
13510205-G-GA 11354529-G-GA 11×A*
13846803-C-A 11726097-C-A FT328702 ***
14062055-G-A 11941349-G-A Z10533 YY*
15178065-C-A 13066151-C-A Y*
16366979-GTC-G 14255099-GTC-G *
25256413-G-GAT 23110266-G-GAT P2_r1 21×AT*
27715118-A-T 25568971-A-T FGC11563 P1_Y2 *
28805535-C-G 26659388-C-G BY40026 *
18159285-G-T 16047405-G-T Y***
13465394-A-T 11309718-A-T FGC82291 *
15762810-C-A 13650930-C-A Y***
28805538-C-G 26659391-C-G *
28805505-T-G 26659358-T-G *
25885852-A-AAAGG 23739705-A-AAAGG P1_Y1 7×AAGG*
13805216-C-A 11684510-C-A *
13483994-C-T 11328318-C-T BY86129 *
27290770-CT-C 25144623-CT-C P1_g3 11×T*
58833981-TCCATC-T 56756880-AATGGG-A *
58979023-T-C 56832876-T-C *
22502781-T-A 20340895-T-A DYZ19 *
22360234-A-C 20198348-A-C DYZ19 *
24124757-GT-G 21978610-GT-G P3_b1 10×T*
21148628-G-A 18986742-G-A YY*
22366547-G-A 20204661-G-A DYZ19 *
9333987-C-A 9496378-C-A Y*
28149455-G-A 26003308-G-A P1_b4 *
18196524-G-T 16084644-G-T YY****
26170451-C-CAGA 24024304-C-CAGA P1_Y1 23×AGA*
14062047-G-A 11941341-G-A YY*
9311499-T-G 9473890-T-G Y*
27035480-CT-C 24889333-CT-C P1_r4 16×T*
27315588-G-GA 25169441-G-GA P1_g3 10×A*
58978958-CTCCAA-C 56832811-CTCCAA-C *
13740882-G-C 11585206-G-C *
13740887-C-T 11585211-C-T *
9368799-T-C 9531190-T-C Y*
22361432-G-C 20199546-G-C DYZ19 *
21230509-TAA-T 19068623-TAA-T 14×A*
13463424-C-A 11307748-C-A *
58875139-A-C 56715732-T-G *
22502146-C-A 20340260-C-A DYZ19 *
22962414-GTTTT-G 20800528-GTTTT-G 20×T*
13480428-A-T 11324752-A-T *
13728985-A-T 11573309-A-T *
9207198-GA-G 9369589-GA-G 10×A*
22502796-T-C 20340910-T-C DYZ19 *
22249357-T-A 20087471-T-A DYZ19 *
58866077-C-G 56724794-G-C *
13489616-C-A 11333940-C-A *
22220030-A-C 20058144-A-C DYZ19 *
58979018-CTCTAT-C 56832871-CTCTAT-C *
58994005-C-A 56847858-C-A *
22431410-T-G 20269524-T-G DYZ19 *
20104256-GGAGA-G 17992376-GGAGA-G P5_Dst 22×GA*
16930131-C-T 14818251-C-T Y***
16707129-C-CG 14595249-C-CG ****
13728999-G-A 11573323-G-A *
22284411-G-T 20122525-G-T DYZ19 *
13489612-AC-A 11333936-AC-A *
13474408-G-A 11318732-G-A *
19345100-C-A 17233220-C-A F3024 YY*
13466445-G-C 11310769-G-C *
22279851-G-C 20117965-G-C FGC78957 DYZ19 *
13473931-C-T 11318255-C-T *
58834028-C-T 56756843-G-A *
10925567-T-A *
22233341-C-A 20071455-C-A DYZ19 *
19500150-GTAGATAGATAGA-G,GTAGA 17388270-GTAGATAGATAGA-G,GTAGA 14×TAGA*
13474412-C-A 11318736-C-A *
20819998-CTTTTTT-C 18658112-CTTTTTT-C P4_Gap 21×T*
20603841-GGAGAGA-G 18441955-GGAGAGA-G P5_Dst 18×GA*
17169703-A-G 15057823-A-G YY*
22341563-G-T 20179677-G-T DYZ19 *
22295408-T-G 20133522-T-G DYZ19 *
6313885-CA-C 6445844-CA-C IR3_Dst 9×A*
18838746-C-A 16726866-C-A YY*
25850768-G-T 23704621-G-T P1_Y1 *
15480386-T-A 13368506-T-A YY*
4890074-G-T 5022033-G-T ****
9967100-C-A 10129491-C-A Y*
17375603-G-T 15263723-G-T Y****
13726649-A-G 11570973-A-G *
58840994-C-T 56749877-G-A 9×CCATT*
13489628-A-T 11333952-A-T *
22341556-G-A 20179670-G-A DYZ19 *
22361448-C-T 20199562-C-T DYZ19 *
22488212-A-T 20326326-A-T DYZ19 *
26344249-CAA-C 24198102-CAA-C P1_Y1 14×A*
8801381-G-GGAAGAA 8933340-G-GGAAGAA 10×GAA*
10880292-C-G ***
13483089-C-T 11327413-C-T FGC46958FGC46952 *
10660408-C-T FT414803 ****
19966688-AAAGAAGAAGAAG-A,AAAGAAGAAGAAGAAG 17854808-AAAGAAGAAGAAG-A,AAAGAAGAAGAAGAAG P5_Prx 26×AAG*
15558431-GAGATAGATAGAT-G,GAGAT 13446551-GAGATAGATAGAT-G,GAGAT 17×AGAT*
13688218-AATGGC-A 11532542-AATGGC-A *
22366559-T-A 20204673-T-A DYZ19 *
9368856-G-C 9531247-G-C Y*
22359715-A-C 20197829-A-C DYZ19 *
13461096-G-C 11305420-G-C *
22366421-G-A 20204535-G-A DYZ19 *
19129567-C-A 17017687-C-A **
10971348-G-A **
24406512-C-A 22260365-C-A **
16041115-C-A 13929235-C-A **
4171651-C-A 4303610-C-A **
10841983-C-T FT91843 **
14080107-G-T 11959401-G-T **
22215183-C-A 20053297-C-A FT106117 **
10957840-C-A **
19297362-C-A 17185482-C-A **
19206705-C-A 17094825-C-A **
4201626-A-T 4333585-A-T **
3548424-G-A 3680383-G-A **
3559686-C-A 3691645-C-A **
3626375-T-C 3758334-T-C **
3704524-C-A 3836483-C-A **
3728694-A-G 3860653-A-G **
3790799-A-G 3922758-A-G **
3802789-C-A 3934748-C-A **
3804904-G-T 3936863-G-T **
4201588-A-T 4333547-A-T **
4201872-C-A 4333831-C-A **
3528704-A-T 3660663-A-T **
4208213-T-C 4340172-T-C **
4223466-A-G 4355425-A-G **
4353814-C-T 4485773-C-T **
4357968-G-A 4489927-G-A **
4358083-T-C 4490042-T-C **
4370807-G-T 4502766-G-T **
4432267-C-A 4564226-C-A **
4448982-T-G 4580941-T-G **
4459309-C-A 4591268-C-A **
3545891-A-G 3677850-A-G **
3517706-C-A 3649665-C-A **
6516897-C-A 6648856-C-A **
2948820-C-A 3080779-C-A **
7721322-C-A 7853281-C-A **
10754440-C-A **
14858628-C-A 12746694-C-A **
56849927-C-A **
17225892-C-A 15114012-C-A **
13902222-C-A 11781516-C-A **
2670756-C-T 2802715-C-T **
2679327-G-A 2811286-G-A **
2963111-AT-A 3095070-AT-A 9×T**
3513988-T-A 3645947-T-A **
2979054-A-T 3111013-A-T **
2992828-G-T 3124787-G-T **
3035175-G-A 3167134-G-A **
3051332-G-A 3183291-G-A FT97474 **
3099629-C-A 3231588-C-A **
3130710-G-A 3262669-G-A **
3156258-G-T 3288217-G-T **
3504086-G-T 3636045-G-T **
3507059-G-T 3639018-G-T **
6646863-C-A 6778822-C-A **
15157660-C-A 13045747-C-A **
6830641-C-A 6962600-C-A **
10879623-C-A **
6461715-C-A 6593674-C-A **
4388591-C-A 4520550-C-A **
7645236-G-A 7777195-G-A **
13937084-C-A 11816378-C-A **
10657064-G-C **
28687351-C-A 26541204-C-A **
19692990-T-TC 17581110-T-TC P5_Prx **
10846894-T-A **
19531492-C-A 17419612-C-A **
17871909-C-A 15760029-C-A **
17074693-G-C 14962813-G-C **
16598980-TCAAC-T 14487100-TCAAC-T **
15556810-T-G 13444930-T-G **
6648350-TA-T 6780309-TA-T **
8094691-C-A 8226650-C-A **
4538688-A-T 4670647-A-T **
7433621-C-A 7565580-C-A **
7390155-C-A 7522114-C-A **
8913185-G-T 9045144-G-T **
10657039-G-C **
7243273-C-A 7375232-C-A **
28658592-C-A 26512445-C-A **
22257342-T-TG 20095456-T-TG DYZ19 **
16945317-T-C 14833437-T-C **
22257357-C-T 20095471-C-T DYZ19 **
15882061-C-T 13770181-C-T **
23052518-C-A 20890632-C-A **
22252137-A-T 20090251-A-T DYZ19 **
23311293-A-T 21149407-A-T **
13963391-C-A 11842685-C-A Y65698 **
10980090-T-C **
8333480-TTTCTTCTTCTTCTTCTTCTTC-T 8465439-TTTCTTCTTCTTCTTCTTCTTC-T 31×TTC**
3156204-G-T 3288163-G-T **
13855769-C-A 11735063-C-A **
4957764-C-A 5089723-C-A **
23438878-AC-A 21276992-AC-A **
16384681-C-A 14272801-C-A **
10657011-T-A **
56843359-C-G **
13610822-C-A 11455146-C-A **
22076957-G-A 19915071-G-A **
19270534-AT-A 17158654-AT-A **
14558636-C-A 12446837-C-A **
10846900-T-C **
24597833-T-G 22451686-T-G P3_t2 **
13947028-C-A 11826322-C-A **
14273761-C-A 12153055-C-A **
14667897-C-A 12555963-C-A **
10973884-A-C **
10846873-C-T **
10846875-C-A **
10846895-T-C **
23065102-C-A 20903216-C-A **
8980043-G-T 9142434-G-T **
18173136-C-A 16061256-C-A **
21009204-T-TCA 18847318-T-TCA P4_Dst **
7783069-C-A 7915028-C-A FT303646 **
21037355-C-A 18875469-C-A **
14187183-C-A 12066477-C-A **
4108300-C-A 4240259-C-A **
22166565-G-A 20004679-G-A **
22950284-C-A 20788398-C-A **
10657073-T-A **
6874819-C-A 7006778-C-A **
10846880-C-T **
10839954-T-G **
13197066-C-A 11041390-C-A **
10657054-G-T **
5976883-C-A 6108842-C-A **
10951405-C-A **
7832170-C-T 7964129-C-T 12×TCTT**
10846929-G-A **
15111500-C-A 12999587-C-A **
10980095-T-C **
14093516-C-A 11972810-C-A **
10802798-C-A **
10860981-C-A **
4444264-C-T 4576223-C-T **
7314336-C-A 7446295-C-A **
13460984-A-C 11305308-A-C **
17218282-C-A 15106402-C-A **
20825611-C-A 18663725-C-A P4_Gap **
13941102-C-A 11820396-C-A **
26355367-C-A 24209220-C-A P1_Y1 **
16030293-C-A 13918413-C-A **
4483979-A-T 4615938-A-T **
5765681-G-T 5897640-G-T **
4654605-T-G 4786564-T-G **
15400656-G-T 13288776-G-T **
15793435-C-A 13681555-C-A **
15732232-T-A 13620352-T-A **
15679755-C-A 13567875-C-A **
15599920-C-A 13488040-C-A **
15556819-C-CTT 13444939-C-CTT **
15556809-A-G 13444929-A-G **
15423871-G-T 13311991-G-T **
15386568-C-A 13274688-C-A **
15834169-C-T 13722289-C-T FT180508 **
15366863-G-T 13254983-G-T **
15366114-G-T 13254234-G-T **
15290019-C-T 13178118-C-T **
15252759-C-G 13140845-C-G **
15219077-C-T 13107163-C-T **
15218803-A-C 13106889-A-C **
15179010-C-T 13067096-C-T 25×A**
15172628-G-T 13060714-G-T **
15793919-A-T 13682039-A-T **
15909328-C-A 13797448-C-A **
15103650-T-A 12991738-T-A **
16421129-C-A 14309249-C-A **
16993703-G-T 14881823-G-T **
16993356-A-C 14881476-A-C **
16990292-T-C 14878412-T-C **
16987233-T-C 14875353-T-C **
16952638-C-A 14840758-C-A **
16938334-C-A 14826454-C-A **
16931984-G-A 14820104-G-A **
16710300-C-A 14598420-C-A **
16411084-T-A 14299204-T-A **
15909380-CTCTT-C 13797500-CTCTT-C Y3692 **
16147495-A-G 14035615-A-G P8_Dst **
16146585-C-T 14034705-C-T P8_Dst **
16050259-C-A 13938379-C-A **
16046963-T-C 13935083-T-C **
16046585-C-A 13934705-C-A **
16046542-C-A 13934662-C-A **
16029318-C-A 13917438-C-A **
15959149-C-T 13847269-C-T **
15138113-G-A 13026200-G-A **
15047560-C-A 12935651-C-A **
10318-T-G **
11676010-G-A FT451393 **
14135307-C-T 12014601-C-T **
13999331-T-C 11878625-T-C **
13960991-G-A 11840285-G-A **
13951634-A-G 11830928-A-G **
13940628-C-A 11819922-C-A **
13937071-C-A 11816365-C-A **
13932981-C-A 11812275-C-A **
11676003-T-A **
14281084-C-A 12160378-C-A **
11675997-A-C **
11675996-T-G **
11675992-A-G **
11673221-G-T **
11665418-T-C **
11646070-A-G **
11644169-A-G **
4654614-T-C 4786573-T-C **
14273748-T-G 12153042-T-G **
14324486-A-G 12203780-A-G **
15044792-G-T 12932882-G-T **
14608078-A-G 12496280-A-G **
14960293-G-A 12848368-G-A **
14931857-C-A 12819922-C-A **
14757901-C-A 12645970-C-A **
14727341-T-G 12615409-T-G **
14725580-G-T 12613648-G-T **
14717877-T-C 12605945-T-C **
14675200-T-G 12563266-T-G **
14658243-C-T 12546308-C-T **
14593749-C-A 12481949-C-A **
14387624-AT-A 12266920-AT-A **
14561499-C-T 12449700-C-T **
14537980-C-T 12426181-C-T **
14517369-T-G 12405570-T-G **
14510071-G-A 12398276-G-A **
12379441-G-A **
14490940-A-T 12370209-A-T **
14449863-G-T 12329136-G-T **
14391695-GA-G 12270991-GA-G **
17074685-G-T 14962805-G-T **
7818-T-C **
11644147-A-G **
22257364-C-T 20095478-C-T DYZ19 **
22012171-C-A 19850285-C-A **
22045652-C-A 19883766-C-A **
22052411-C-A 19890525-C-A **
22065030-A-G 19903144-A-G **
18223759-A-G 16111879-A-G **
22215205-C-T 20053319-C-T **
18151921-T-A 16040041-T-A **
22277599-TTAA-T 20115713-TTAA-T DYZ19 **
21836340-C-A 19674454-C-A **
18132355-A-C 16020475-A-C **
22346212-G-T 20184326-G-T DYZ19 **
17786681-C-T 15674801-C-T **
22513090-C-A 20351204-C-A **
22518395-T-C 20356509-T-C **
17786585-T-C 15674705-T-C **
22587734-C-T 20425848-C-T **
22619325-AC-A 20457439-AC-A **
21993970-C-T 19832084-C-T **
21584227-A-G 19422341-A-G **
22809263-C-A 20647377-C-A **
20048961-A-G 17937081-A-G P5_Prx **
19330116-C-T 17218236-C-T **
19146599-AG-A 17034719-AG-A **
18795109-A-G 16683229-A-G **
19464072-G-T 17352192-G-T **
19479261-G-A 17367381-G-A **
18793827-A-G 16681947-A-G **
18750092-C-T 16638212-C-T **
18728750-G-A 16616870-G-A **
20230212-C-A 18068326-C-A P5_Dst **
21435189-T-A 19273303-T-A **
20249276-CA-C 18087390-CA-C P5_Dst 22×A**
18710391-C-A 16598511-C-A **
18626100-T-C 16514220-T-C **
18625972-G-T 16514092-G-T FTB23181 **
18443540-C-T 16331660-C-T FT252225 P6_Dst **
18361348-G-T 16249468-G-T P6_Prx **
18340490-AC-A 16228610-AC-A P6_Prx **
21377662-A-G 19215776-A-G **
22690144-A-G 20528258-A-G **
17728630-G-A 15616750-G-A **
56852722-G-T **
28610310-C-A 26464163-C-A **
27216600-T-A 25070453-T-A P1_g3 **
17297355-T-C 15185475-T-C **
27919825-A-T 25773678-A-T P1_Y2 **
28157463-T-G 26011316-T-G P1_b4 **
28486081-G-T 26339934-G-T **
17135919-GCAATA-G 15024039-GCAATA-G **
28498546-A-G 26352399-A-G **
28622098-C-A 26475951-C-A **
17362989-C-A 15251109-C-A **
17122832-G-T 15010952-G-T **
28632765-A-C 26486618-A-C **
28673088-C-A 26526941-C-A **
28694888-C-A 26548741-C-A **
28739807-C-A 26593660-C-A **
17122670-T-C 15010790-T-C **
56843555-C-A **
56845721-G-T **
27053733-G-A 24907586-G-A P1_r4 **
26467268-G-T 24321121-G-T P1_Y1 **
22963730-T-A 20801844-T-A **
23442733-C-A 21280847-C-A **
17721017-TCC-T 15609137-TCC-T **
23041226-A-AG 20879340-A-AG **
17667079-T-G 15555199-T-G **
23193134-C-T 21031248-C-T **
23231326-C-A 21069440-C-A **
17548210-C-A 15436330-C-A Z36128 **
23305784-C-A 21143898-C-A **
23340917-AG-A 21179031-AG-A **
17511722-CA-C 15399842-CA-C **
26046024-A-T 23899877-A-T P1_Y1 **
23476253-G-A 21314367-G-A **
23476260-G-A 21314374-G-A **
17454481-A-T 15342601-A-T **
23723256-T-A 21561370-T-A **
23734330-C-A 21572444-C-A **
17440414-G-A 15328534-G-A **
24388803-A-G 22242656-A-G **
24389220-G-T 22243073-G-T **
11644148-C-G **
11644151-A-T **
18159859-C-T 16047979-C-T **
9541632-C-G 9704023-C-G IR3_Prx **
9955722-C-A 10118113-C-A **
9925183-C-A 10087574-C-A **
9825972-C-A 9988363-C-A **
9824409-C-A 9986800-C-A **
9824012-C-A 9986403-C-A **
9806785-A-G 9969176-A-G **
9574705-G-T 9737096-G-T IR3_Prx **
9047084-G-T 9209475-G-T **
9959185-A-T 10121576-A-T **
9055908-C-A **
8218139-C-T 8350098-C-T **
8111334-G-C 8243293-G-C **
7452813-A-G 7584772-A-G IR1_L **
7385680-C-A 7517639-C-A **
7383695-A-C 7515654-A-C **
7374898-C-A 7506857-C-A **
7374877-C-A 7506836-C-A **
9956484-T-C 10118875-T-C **
9962511-A-G 10124902-A-G **
7330366-C-A 7462325-C-A **
10657010-C-T **
13622137-G-T 11466461-G-T **
10659693-C-A **
10657094-C-T **
10657076-ACTCTG-A **
10657072-T-C **
10657062-T-C **
10657049-CT-G **
10657004-C-G **
9969093-T-A 10131484-T-A **
10656545-C-G **
10654414-C-T **
10654407-C-CTCTATTCT **
10632618-T-C **
10073739-G-T 10236130-G-T **
10073344-G-T 10235735-G-T **
10050234-C-A 10212625-C-A **
10018044-C-A 10180435-C-A **
7349019-CT-C 7480978-CT-C **
7303191-G-A 7435150-G-A **
10671301-G-T **
5335999-C-A 5467958-C-A **
19297335-C-T 17185455-C-T **
5712266-G-T 5844225-G-T **
5690182-C-A 5822141-C-A **
5670862-C-A 5802821-C-A **
5658739-G-T 5790698-G-T **
5535156-T-TAA 5667115-T-TAA **
5519632-C-A 5651591-C-A FGC58113 **
5267124-A-G 5399083-A-G **
5904880-T-C 6036839-T-C **
5219361-G-A 5351320-G-A **
5112146-G-T 5244105-G-T **
5093321-T-C 5225280-T-C **
5086364-C-A 5218323-C-A **
5017509-G-T 5149468-G-T **
4702884-G-T 4834843-G-T **
4700349-T-G 4832308-T-G **
4654626-T-G 4786585-T-G **
5800395-A-T 5932354-A-T **
5961949-T-C 6093908-T-C **
7141945-C-A 7273904-C-A FT359964 **
6519593-A-G 6651552-A-G **
7045721-C-A 7177680-C-A **
7028715-GACCAC-G 7160674-GACCAC-G **
7015324-CTTTTTTT-C 7147283-CTTTTTTT-C 23×T**
6926387-GT-G 7058346-GT-G **
6770197-C-G 6902156-C-G **
6606794-G-T 6738753-G-T **
6593487-T-G 6725446-T-G **
6459894-T-A 6591853-T-A **
5987822-T-A 6119781-T-A **
6445152-A-T 6577111-A-T **
6402694-C-A 6534653-C-A **
6180325-A-AT 6312284-A-AT IR3_Dst **
6149296-G-T 6281255-G-T IR3_Dst **
6149290-C-A 6281249-C-A IR3_Dst **
6134747-C-A 6266706-C-A **
6088582-C-A 6220541-C-A **
6074657-C-A 6206616-C-A **
10666038-G-T **
10665470-C-A **
10671310-G-T **
10976495-T-A **
10980062-C-T **
10980051-A-ACACCT **
10980049-C-T **
10976523-C-A **
10976522-T-C **
10976519-T-C **
10976504-C-CATACA **
10976488-C-T **
10980576-C-T **
10976479-A-C **
10971840-C-A **
10956737-T-A **
10950961-C-A **
10950795-C-A **
10945163-C-A **
10673738-C-A **
10924183-C-A **
10980107-T-C **
10980611-C-A **
10911872-C-A **
11033160-T-A **
13594687-T-A 11439011-T-A **
13594316-C-A 11438640-C-A **
13564982-A-C 11409306-A-C **
13556774-C-A 11401098-C-A FT445324 **
13433611-C-A 11277935-C-A **
13288937-A-C 11133261-A-C **
11034043-G-T **
11033150-T-TAC **
10981026-C-A FT439042 **
11033149-A-ACTCGTTTT **
11033123-C-A **
11031750-C-A **
11026224-C-T **
11024502-T-C **
11017457-T-A **
11007837-T-C **
11004374-C-G **
10924105-A-G FT132269 **
10942861-G-T **
10911262-C-A **
10767087-C-A **
10840966-T-G **
10839992-C-T **
10839934-T-A **
10686334-T-C **
10746428-C-A **
10838203-C-T FT371307 **
10838097-T-G **
10777193-T-G **
10769118-G-T **
10821791-C-G FT225522 **
10821790-T-C **
10821372-C-A **
10818745-GCT-G **
10818738-TTCC-T **
10805008-C-A **
10840967-T-A **
10798806-C-A **
10840968-G-A **
10677024-T-A **
10879951-A-C **
10873893-A-T **
10867842-C-A **
10863717-A-G **
10863712-G-A **
10863709-A-G **
10863505-C-G **
10862074-C-A **
10846857-C-CCATTTTATTG **
10859290-C-A **
10679243-A-T **
10685739-C-A **
10846930-A-C **
34151-G-C ***
10686684-T-TGCACC ***
18864961-A-T 16753081-A-T ***
13456244-C-T 11300568-C-T ***
6000112-C-A 6132071-C-A ***
5828999-A-C 5960958-A-C ***
28324736-C-A 26178589-C-A P1_b4 ***
13803920-T-G 11683214-T-G FGC26129 ***
10894656-C-A ***
21549297-T-G 19387411-T-G ***
15626494-C-A 13514614-C-A ***
10686700-C-G ***
14610695-C-A 12498897-C-A ***
17633852-CAA-C,CA 15521972-CAA-C,CA 13×A***
6674465-ATTTTT-A,ATTTTTT 6806424-ATTTTT-A,ATTTTTT 16×T***
6979869-G-A 7111828-G-A ***
13645478-T-C 11489802-T-C FT447042 ***

In the table above, the meaning of the confidence field depends on whether the data comes from an FTDNA kit or an FGC kit. For FTDNA kits, + implies a "PASS" result with just one possible variant, * indicates a "PASS" but with multiple variants, ** indicates "REJECTED" with just a single variant, and *** indicates "REJECTED" with multiple possible variants. 'A*' are heterozygous variants not called by FTDNA, but still pulled from the VCF file. For FGC kits, + indicates over 99% likely genuine (95% for INDELs); * over 95% likely genuine (90% for INDELs); ** about 40% likely genuine; *** about 10% likely genuine. Manual entries read directly from a BAM file will be either + indicating positive, or * indicating that the data show a mixture of possible variants.

For the FTDNA kits, the BED data is encoded in the background color of the cells. Those cells with a white background have coverage, those with a grey background indicate no coverage in the BED file, and those with a pink background indicate the mutation is on the edge of a coverage region. These pink regions often indicate that the individual may be positive for a SNP even if there is no corresponding entry in the vcf file.

The combBED column indicates whether or not the mutation is a SNP and falls in the combBED region defined in Defining a New Rate Constant for Y-Chromosome SNPs based on Full Sequencing Data by Dmitry Adamov, Vladimir Guryanov, Sergey Karzhavin, Vladimir Tagankin, Vadim Urasin.

The McDonald BED column indicates whether or not the mutation is a SNP and falls in the BED region used by Dr. Iain McDonald in the age analysis he does for R-U106 men.

Age Analysis Information (work in progress)

AllMcDonaldYFull
Kit: 191764993551080630757931734
Kit: 1917641073894482478788019356
Used in age calculations1073894482478788019356
Counts of SNPs15190
Variant counts last updated 2022-09-10 02:46:36.



Big Tree Main Page