Tree Position

R-P312/S116 > Z40481 > ZZ11 > U152/S28 > L2/S139 > Z41150 > DF90 > FGC14641 > ~22237861-G-A > FGC59581

Unique Mutations

The mutations unique to this man are summarized in the table below. Those with a '+' or '*' confidence level are considered by FamilyTreeDNA or FullGenomesCorp to be high quality SNPs/INDELs. For completeness, all other mutations of lesser confidence are included as well. These additional mutations may be useful for distinguishing between very closely related men.

Occasionally, some of the mutations listed here will be thought to be shared with other men in which case they might appear in upstream blocks on the tree. When this happens, the 'Blocks' field will indicate what block they appear in. Such a situation might arise with BigY men if the BED data suggests another man may be positive for a SNP, even though it doesn't appear in his VCF data. It might also happen if Chromo2 testing or Sanger sequencing of other men not on the tree show the SNP to be shared.

POS-REF-ALT (hg19) POS-REF-ALT (hg38) Blocks Names Region McDonald BED combBED STRBigY3
362045
BigY2
362045
25957285-G-A 23811138-G-A P1_Y1 A*A*
20643042-T-A 18481156-T-A P4_Prx A*A*
25879866-T-C 23733719-T-C P1_Y1 A*A*
28817895-T-A 26671748-T-A A*
28817026-G-A 26670879-G-A A*A*
26389116-G-A 24242969-G-A P1_Y1 A*A*
16097564-A-C 13985684-A-C P8_Prx A*
9361295-C-T 9523686-C-T BY34442 YA*
19643700-C-T 17531820-C-T P5_Prx A*
19719399-T-C 17607519-T-C P5_Prx A*A*
20536078-G-A 18374192-G-A P5_Dst A*
14818691-A-G 12706762-A-G BY97766 YY++
6040238-G-A 6172197-G-A FT97810 +**
22443335-C-G 20281449-C-G BY219229 DYZ19 **+
17871408-T-C 15759528-T-C BY117967 YY++
10872962-T-C +
22489275-A-T 20327389-A-T BY225067 DYZ19 +
22858044-G-A 20696158-G-A BY141262 YY++
8665842-C-T 8797801-C-T BY75051 YY++
23987542-C-A 21841395-C-A BY149049 Y++
17367428-G-A 15255548-G-A BY114234 YY++
14469839-GT-G 12349108-GT-G **+
8969909-C-A 9132300-C-A BY76959 **+
13224460-T-C 11068784-T-C BY84636 ++
16858278-T-C 14746398-T-C BY110628 YY++
16770380-AC-A 14658500-AC-A ++
16733728-T-C 14621848-T-C FT98232 YY+**
13862123-A-G 11741417-A-G BY50613 ++
15441380-T-C 13329500-T-C BY101598 YY++
15456139-T-C 13344259-T-C BY101674 YY++
15513802-T-G 13401922-T-G BY102118 YY++
14515985-TAAAC-T 12404186-TAAAC-T ++
9838718-C-T 10001109-C-T BY81330 YY++
7209050-G-C 7341009-G-C BY63917 YY++
4384582-G-GA 4516541-G-GA +
13572748-C-T 11417072-C-T +**
13583395-A-T 11427719-A-T +
13670214-C-T 11514538-C-T BY87781 ++
10667065-A-G +
13670627-C-G 11514951-C-G ++
7630807-C-T 7762766-C-T FT97900 Y+
5706866-C-G 5838825-C-G FT97769 +
19093455-T-C 16981575-T-C BY126195 YY++
20828972-T-C 18667086-T-C BY212705 P4_Gap ++
21207025-C-T 19045139-C-T FT98444 YY+**
15988072-G-A 13876192-G-A FT98179 YY+
21262083-C-T 19100197-C-T BY131549 YY++
3619411-G-A 3751370-G-A FT97523 +
21480171-C-A 19318285-C-A BY133225 YY++
21485370-C-T 19323484-C-T BY133301 YY++
18225475-T-C 16113595-T-C BY55063 Y++
19415185-A-T 17303305-A-T FT98427 YY+**
12361-C-T **+
22228556-A-G 20066670-A-G BY213221 DYZ19 ++
22316679-A-T 20154793-A-T DYZ19 *
22279347-G-C 20117461-G-C DYZ19 *
22279348-C-A 20117462-C-A DYZ19 *
3413677-G-T 3545636-G-T *
4446690-G-GA 4578649-G-GA 9×A*
15677345-A-T 13565465-A-T **
11646531-C-A **
18407034-A-G 16295154-A-G P6_Gap **
13857713-C-A 11737007-C-A **
18343567-G-T 16231687-G-T P6_Prx **
18309898-C-A 16198018-C-A P6_Prx **
13880017-C-A 11759311-C-A **
13961809-C-A 11841103-C-A **
18309886-A-T 16198006-A-T P6_Prx **
14079664-A-T 11958958-A-T **
18093958-G-T 15982078-G-T **
14283630-G-T 12162924-G-T **
14284678-C-A 12163972-C-A **
14285796-C-A 12165090-C-A **
18088409-T-G 15976529-T-G **
18088407-T-G 15976527-T-G **
14339168-C-A 12218463-C-A **
17876242-C-A 15764362-C-A **
18743344-C-T 16631464-C-T **
13704698-G-T 11549022-G-T **
14620948-C-A 12509146-C-A **
19623503-A-G 17511623-A-G P5_Prx **
19855478-C-A 17743598-C-A P5_Prx **
19724622-T-A 17612742-T-A P5_Prx **
13234619-C-G 11078943-C-G **
19724595-T-A 17612715-T-A P5_Prx **
19724590-T-A 17612710-T-A P5_Prx **
19724583-T-A 17612703-T-A P5_Prx **
13238240-A-G 11082564-A-G **
19600448-TA-T 17488568-TA-T P5_Prx **
18756185-G-T 16644305-G-T **
19598783-A-C 17486903-A-C P5_Prx **
19507062-T-A 17395182-T-A **
13258717-G-A 11103041-G-A **
19358114-C-A 17246234-C-A **
19302128-C-A 17190248-C-A **
19128659-T-C 17016779-T-C **
19121993-C-A 17010113-C-A **
8057337-C-T 8189296-C-T FT310920 **
14546761-A-T 12434962-A-T **
14639226-A-C 12527295-A-C **
15864107-A-T 13752227-A-T **
16603318-C-A 14491438-C-A **
15370862-G-T 13258982-G-T **
15394419-G-T 13282539-G-T **
15394482-C-A 13282602-C-A FT143826 **
15397813-A-T 13285933-A-T **
16701807-G-A 14589927-G-A FGC35119 **
16654714-C-A 14542834-C-A **
19926886-G-T 17815006-G-T P5_Prx **
15435239-G-T 13323359-G-T **
16884005-G-T 14772125-G-T **
15650454-C-A 13538574-C-A **
16320432-T-A 14208552-T-A **
16060465-C-A 13948585-C-A **
16028316-T-G 13916436-T-G **
16013740-G-T 13901860-G-T **
16008755-C-A 13896875-C-A **
15922461-G-A 13810581-G-A **
15921852-T-C 13809972-T-C **
16881634-C-A 14769754-C-A **
17142133-T-C 15030253-T-C **
14721567-T-C 12609635-T-C **
17538083-T-A 15426203-T-A **
14741639-C-A 12629707-C-A **
17867507-A-C 15755627-A-C **
17783064-G-T 15671184-G-T **
14743021-G-C 12631089-G-C **
17666707-C-A 15554827-C-A **
17597950-C-A 15486070-C-A **
17547668-C-A 15435788-C-A **
17504054-G-T 15392174-G-T **
17215850-C-A 15103970-C-A **
14788770-C-A 12676841-C-A **
14815994-C-A 12704065-C-A **
17492278-G-T 15380398-G-T **
17380762-G-T 15268882-G-T **
14994102-A-G 12882187-A-G **
15210847-A-T 13098933-A-T **
17250232-G-T 15138352-G-T **
17215908-T-G 15104028-T-G **
19855482-A-T 17743602-A-T P5_Prx **
20621555-C-A 18459669-C-A P4_Prx **
19965495-C-A 17853615-C-A P5_Prx **
27828710-AAAAAAC-A 25682563-AAAAAAC-A P1_Y2 **
28535644-T-G 26389497-T-G **
28511061-C-A 26364914-C-A **
28147137-A-T 26000990-A-T P1_b4 **
28102357-G-T 25956210-G-T P1_Y2 **
28102336-T-A 25956189-T-A P1_Y2 **
27876680-A-T 25730533-A-T P1_Y2 **
27876666-G-T 25730519-G-T P1_Y2 **
27876662-A-T 25730515-A-T P1_Y2 **
27876661-A-T 25730514-A-T P1_Y2 **
27876645-A-T 25730498-A-T P1_Y2 **
27810333-GAAGG-T 25664186-GAAGG-T P1_Y2 **
28606081-C-A 26459934-C-A **
27155037-T-G 25008890-T-G P1_g3 **
26320961-C-A 24174814-C-A P1_Y1 **
26199739-G-T 24053592-G-T P1_Y1 **
26199724-C-A 24053577-C-A P1_Y1 **
26199717-A-T 24053570-A-T P1_Y1 **
26085532-A-G 23939385-A-G P1_Y1 **
25988495-C-A 23842348-C-A P1_Y1 **
25966177-T-G 23820030-T-G P1_Y1 **
25966170-T-G 23820023-T-G P1_Y1 **
25966160-A-C 23820013-A-C P1_Y1 **
28583665-C-A 26437518-C-A **
28625849-T-G 26479702-T-G **
24582483-A-C 22436336-A-C P3_t2 **
3889019-CTTTT-C 4020978-CTTTT-C 15×T**
28569533-A-G 26423386-A-G **
28076194-T-C 25930047-T-C P1_Y2 **
24267556-G-T 22121409-G-T P3_b1 **
22480617-T-G 20318731-T-G DYZ19 **
14682883-G-A 12570949-G-A **
13485357-A-C 11329681-A-C **
9830370-T-C 9992761-T-C **
5701369-C-T 5833328-C-T **
5667411-G-GT 5799370-G-GT **
3901399-C-T 4033358-C-T **
3543166-C-CAA 3675125-C-CAA 14×A**
28754990-C-A 26608843-C-A **
3452154-C-T 3584113-C-T **
20775186-G-A 18613300-G-A P4_Prx **
56854792-C-G **
56846528-G-T **
56839695-A-C **
56771216-G-T **
56771215-A-T **
56771208-G-T **
56678118-G-C **
28814951-G-T 26668804-G-T **
28798184-A-C 26652037-A-C **
24892497-G-T 22746350-G-T g1 **
24450532-T-C 22304385-T-C **
20255076-T-A 18093190-T-A P5_Dst **
20621542-G-C 18459656-G-C P4_Prx **
22065185-A-G 19903299-A-G **
21796551-G-A 19634665-G-A F24700 **
21380623-G-T 19218737-G-T **
21363162-A-G 19201276-A-G **
21207566-T-G 19045680-T-G **
21164684-C-A 19002798-C-A **
20635013-A-T 18473127-A-T P4_Prx **
20634996-A-T 18473110-A-T P4_Prx **
11035276-C-G **
20621547-T-A 18459661-T-A P4_Prx **
20621539-T-A 18459653-T-A P4_Prx **
22297888-A-G 20136002-A-G DYZ19 **
20621537-T-A 18459651-T-A P4_Prx **
20621529-C-A 18459643-C-A P4_Prx **
20621517-G-T 18459631-G-T P4_Prx **
20621511-T-A 18459625-T-A P4_Prx **
20621500-G-T 18459614-G-T P4_Prx **
20621489-T-A 18459603-T-A P4_Prx **
20473366-G-T 18311480-G-T P5_Dst **
20340124-T-G 18178238-T-G P5_Dst **
20340119-T-C 18178233-T-C P5_Dst **
20330532-A-G 18168646-A-G P5_Dst **
20255115-T-A 18093229-T-A P5_Dst **
22155455-A-T 19993569-A-T **
22297895-C-A 20136009-C-A Z45910 DYZ19 **
24404318-C-A 22258171-C-A **
24245654-G-T 22099507-G-T P3_b1 **
24392029-AAGTACTTACAACACTTGGCCC-A 22245882-AAGTACTTACAACACTTGGCCC-A ****
24392028-A-C 22245881-A-C ****
24363754-C-A 22217607-C-A **
24296129-T-G 22149982-T-G P3_t1 **
24245726-C-G 22099579-C-G P3_b1 **
24245723-A-T 22099576-A-T P3_b1 **
24245722-A-T 22099575-A-T P3_b1 **
24245698-G-T 22099551-G-T P3_b1 **
24245693-A-T 22099546-A-T P3_b1 **
24245677-G-T 22099530-G-T P3_b1 **
24072725-T-A 21926578-T-A P3_b1 **
22297899-C-T 20136013-C-T DYZ19 **
24072724-C-A 21926577-C-A P3_b1 **
23818418-G-T 21656532-G-T **
23723598-T-G 21561712-T-G **
23415342-A-ATT 21253456-A-ATT 21×T**
23361676-T-A 21199790-T-A **
23144236-C-A 20982350-C-A **
23006592-C-A 20844706-C-A **
22834007-C-A 20672121-C-A **
22765516-G-T 20603630-G-T **
22485561-T-C 20323675-T-C DYZ19 **
22297903-T-A 20136017-T-A DYZ19 **
13194787-C-G 11039111-C-G **
13696504-G-T 11540828-G-T **
11035270-T-A **
9416869-C-A 9579260-C-A **
3079457-C-A 3211416-C-A **
2966474-T-A 3098433-T-A **
2785284-TTTTTCAGCAGTGTATTGTAGTTTTCCTTGTAGAGATC-T 2917243-TTTTTCAGCAGTGTATTGTAGTTTTCCTTGTAGAGATC-T **
17597947-T-A 15486067-T-A **
10991546-G-T **
24363885-C-A 22217738-C-A **
4174972-T-A 4306931-T-A **
10964597-C-A **
10775461-C-A **
15541698-AT-A 13429818-AT-A **
10657424-C-A **
4804669-C-A 4936628-C-A **
3235405-C-A 3367364-C-A **
56823102-G-T **
4133346-C-A 4265305-C-A **
10677095-G-A **
15355089-C-A 13243208-C-A **
7107576-C-A 7239535-C-A **
10657244-C-A **
22273562-C-A 20111676-C-A DYZ19 **
15557995-C-A 13446115-C-A **
10785695-C-A **
16520847-G-T 14408967-G-T **
10771872-G-A **
2970082-C-A 3102041-C-A **
3176448-A-T 3308407-A-T **
3276202-C-A 3408161-C-A **
13941664-A-T 11820958-A-T **
4792375-T-G 4924334-T-G **
5716008-T-C 5847967-T-C **
5606154-C-A 5738113-C-A **
5513111-C-A 5645070-C-A **
5449980-T-A 5581939-T-A **
5446287-T-A 5578246-T-A **
5200266-A-C 5332225-A-C **
5060182-C-A 5192141-C-A **
5035364-T-A 5167323-T-A **
5017670-T-C 5149629-T-C **
5017561-G-T 5149520-G-T **
4959907-C-A 5091866-C-A **
4908137-C-T 5040096-C-T **
11035263-A-C **
3550349-G-A 3682308-G-A **
4465202-A-G 4597161-A-G **
4426089-A-C 4558048-A-C **
4416677-G-T 4548636-G-T **
4334599-G-T 4466558-G-T **
4202359-A-G 4334318-A-G **
4201752-C-A 4333711-C-A **
4201671-C-A 4333630-C-A **
4142334-G-A 4274293-G-A **
4136167-C-A 4268126-C-A **
4077607-C-A 4209566-C-A **
3951538-T-G 4083497-T-G **
3641391-C-A 3773350-C-A **
28147148-G-T 26001001-G-T P1_b4 **
16095227-G-T 13983347-G-T **
5720884-T-A 5852843-T-A **
18901112-C-A 16789232-C-A **
10970734-T-G **
6693059-C-A 6825018-C-A **
15189656-T-G 13077742-T-G **
20635015-G-T 18473129-G-T P4_Prx **
20404507-C-A 18242621-C-A P5_Dst **
10805827-T-G **
8351581-C-A 8483540-C-A **
3109107-G-T 3241066-G-T **
27398546-G-A 25252399-G-A P1_g3 **
28658426-C-A 26512279-C-A **
17597956-T-A 15486076-T-A **
28483573-C-A 26337426-C-A **
11669301-C-A **
20340112-T-G 18178226-T-G P5_Dst **
5458510-C-A 5590469-C-A **
15423176-G-T 13311296-G-T **
24518004-C-A 22371857-C-A **
10925486-T-A **
14743709-C-A 12631778-C-A **
13372061-C-A 11216385-C-A **
10940338-C-G **
24245661-A-T 22099514-A-T P3_b1 **
24245716-A-T 22099569-A-T FGC42958 P3_b1 **
20340126-C-T 18178240-C-T P5_Dst **
16084176-C-A 13972296-C-A FGC78622 **
4229428-A-T 4361387-A-T **
19290508-C-G 17178628-C-G **
19271542-C-A 17159662-C-A **
14226587-C-A 12105881-C-A **
8854301-C-A 8986260-C-A **
4437862-C-A 4569821-C-A **
26228716-TGAG-T 24082569-TGAG-T P1_Y1 **
20340114-A-T 18178228-A-T P5_Dst **
6275752-A-T 6407711-A-T IR3_Dst **
4700407-C-A 4832366-C-A **
7704809-C-A 7836768-C-A **
56838593-C-A **
16048873-C-A 13936993-C-A **
10884721-C-A **
10677841-C-A **
10926719-A-G **
4178814-C-A 4310773-C-A **
28147146-A-T 26000999-A-T P1_b4 **
22176203-C-A 20014317-C-A **
17143888-C-A 15032008-C-A **
10992866-C-A **
13209439-C-A 11053763-C-A **
10771879-C-T **
14512005-G-T 12400210-G-T **
28585774-C-A 26439627-C-A **
21426975-G-T 19265089-G-T **
22949878-C-A 20787992-C-A 23×T**
3407905-C-A 3539864-C-A **
2730110-C-T 2862069-C-T **
28147150-A-T 26001003-A-T P1_b4 **
5716239-A-T 5848198-A-T **
4521492-A-C 4653451-A-C **
5824753-C-T 5956712-C-T FT93803 **
10661139-C-A **
10808948-C-A **
10804837-T-G **
10803517-T-C **
10790233-C-A **
10789139-CCATT-C **
10771920-C-T **
10757239-C-A **
10747592-T-C **
10684766-C-A **
10678096-G-T **
6156669-A-T 6288628-A-T IR3_Dst **
10654374-T-G **
10835101-C-G **
10653407-C-A **
10651573-C-A **
10039908-C-A 10202299-C-A **
9928437-C-A 10090828-C-A **
9826047-A-T 9988438-A-T **
9826025-C-G 9988416-C-G **
9764190-C-T 9926581-C-T **
9670392-A-T 9832783-A-T IR3_Prx **
9670391-A-T 9832782-A-T IR3_Prx **
9670385-A-T 9832776-A-T IR3_Prx **
9670378-A-T 9832769-A-T IR3_Prx **
10821767-C-A **
10860712-T-G **
9438093-CTTTCTCT-C 9600484-CTTTCTCT-C **
10974235-T-G **
11020266-TC-T **
11019921-A-T **
11004393-GCCATTCCATTCCATTCCATTCCATTCCATT-G **
10998767-T-A **
10995892-C-A **
10992895-C-A **
10992877-C-A **
10986654-N-C **
10986511-C-A **
10977083-C-A **
10974419-C-A **
10951726-A-G **
10866024-T-G **
10950923-C-G **
10939739-C-A **
10929698-A-T **
10925608-CCGT-C **
10925593-CTGTTCCATACTG-C **
10925593-C-A **
10914299-A-G FT272261 **
10913049-C-A **
10899500-G-T **
10868813-C-T **
10866238-CTTCCATTCCATTCCATTCCATTCCATTCCACTCCA-C **
9670362-A-T 9832753-A-T IR3_Prx **
10665893-C-A **
9416851-A-T 9579242-A-T **
6275801-A-T 6407760-A-T IR3_Dst **
6790490-G-T 6922449-G-T **
6748677-A-T 6880636-A-T **
6682205-C-A 6814164-C-A **
6634277-T-A 6766236-T-A **
6535360-C-A 6667319-C-A **
6339263-T-A 6471222-T-A IR3_Dst **
6339248-T-A 6471207-T-A IR3_Dst **
6339241-T-A 6471200-T-A IR3_Dst **
6339221-T-A 6471180-T-A IR3_Dst **
6339219-C-A 6471178-C-A IR3_Dst **
6339208-G-T 6471167-G-T IR3_Dst **
6275787-A-T 6407746-A-T IR3_Dst **
7040287-G-T 7172246-G-T **
6275782-G-T 6407741-G-T IR3_Dst **
6275777-C-G 6407736-C-G IR3_Dst **
6275766-A-T 6407725-A-T IR3_Dst **
6275751-A-T 6407710-A-T IR3_Dst **
6245756-C-A 6377715-C-A IR3_Dst **
6202168-G-T 6334127-G-T IR3_Dst **
6156728-A-T 6288687-A-T IR3_Dst **
6156711-A-T 6288670-A-T IR3_Dst **
6156705-A-T 6288664-A-T IR3_Dst **
6156704-A-T 6288663-A-T IR3_Dst **
6156690-C-G 6288649-C-G IR3_Dst **
6978381-C-G 7110340-C-G **
6339231-T-A 6471190-T-A IR3_Dst **
7045149-G-T 7177108-G-T **
7202216-C-A 7334175-C-A **
7409488-A-T 7541447-A-T **
7360567-T-C 7492526-T-C 13×A**
7319290-C-A 7451249-C-A **
8842335-G-T 8974294-G-T **
7253942-T-C 7385901-T-C **
7236471-T-G 7368430-T-G **
7990374-C-T 8122333-C-T **
7142275-C-A 7274234-C-A **
7159111-C-A 7291070-C-A **
9055263-G-T **
11016383-A-G ***
7713479-C-G 7845438-C-G ***
8095379-T-C 8227338-T-C ***
8016924-C-A 8148883-C-A 8×T***
5218706-C-A 5350665-C-A ***
8016922-C-A 8148881-C-A ***
56828244-C-A ***
11022824-C-A ***
14697129-C-A 12585195-C-A ***
23623200-G-T 21461314-G-T ***
11656491-C-A ***
7646928-A-AT 7778887-A-AT 11×AT***
28566034-C-T 26419887-C-T ***
19844880-G-T 17733000-G-T P5_Prx ***
8481967-TA-T,TAA 8613926-TA-T,TAA 15×A***
22476498-T-C 20314612-T-C DYZ19 ***
10866238-CTTCCATTCCATTCCATTCCATTCCATTCCACTCCA-C,CTTCCATTCCATTCCATTCCATTCCACACCACTCCC ***
13299266-G-T 11143590-G-T ***
8751094-A-G 8883053-A-G ***
8124888-C-A 8256847-C-A ***
17030992-CAAAAA-C,CAAAA 14919112-CAAAAA-C,CAAAA 19×A***
13884911-C-A 11764205-C-A ***
5534908-C-A 5666867-C-A ***
14415573-A-AAT 12294870-A-AAT ***
13482577-C-A 11326901-C-A ***
13522567-T-A 11366891-T-A ***
9945377-A-G 10107768-A-G ***
14144239-C-A 12023533-C-A ***
56834983-C-T ***
10797541-C-A ***
2986322-C-A 3118281-C-A ***
10755392-A-C,CGT ***
18176570-C-A 16064690-C-A ***
15041044-C-A 12929134-C-A ***
19302619-G-T 17190739-G-T ***
18949688-C-A 16837808-C-A ***
10878297-T-C ***
18951759-T-C 16839879-T-C ***
18953051-G-A 16841171-G-A ***
17703236-TAAAA-T 15591356-TAAAA-T 22×A***
28722411-C-A 26576264-C-A ***
9499465-G-T 9661856-G-T ***
7537655-C-A 7669614-C-A ***
21253814-G-T 19091928-G-T ***
16264562-C-A 14152682-C-A ***
4778178-CAAAA-C 4910137-CAAAA-C 15×A***
10789893-CTTCCATTCCA-C ***
14488533-A-G 12367802-A-G ***
25720380-GA-G 23574233-GA-G P1_b3 9×A***
24886464-CAA-C 22740317-CAA-C g1 13×A***
10691173-A-T ***
6786911-ATTT-A,AT 6918870-ATTT-A,AT 17×T***
13950947-CTTT-C,CT 11830241-CTTT-C,CT 23×T***
10768025-C-T ***
3490345-C-T 3622304-C-T ***
56861838-ACCTG-A,ACCTA ***

In the table above, the meaning of the confidence field depends on whether the data comes from an FTDNA kit or an FGC kit. For FTDNA kits, + implies a "PASS" result with just one possible variant, * indicates a "PASS" but with multiple variants, ** indicates "REJECTED" with just a single variant, and *** indicates "REJECTED" with multiple possible variants. 'A*' are heterozygous variants not called by FTDNA, but still pulled from the VCF file. For FGC kits, + indicates over 99% likely genuine (95% for INDELs); * over 95% likely genuine (90% for INDELs); ** about 40% likely genuine; *** about 10% likely genuine. Manual entries read directly from a BAM file will be either + indicating positive, or * indicating that the data show a mixture of possible variants.

For the FTDNA kits, the BED data is encoded in the background color of the cells. Those cells with a white background have coverage, those with a grey background indicate no coverage in the BED file, and those with a pink background indicate the mutation is on the edge of a coverage region. These pink regions often indicate that the individual may be positive for a SNP even if there is no corresponding entry in the vcf file.

The combBED column indicates whether or not the mutation is a SNP and falls in the combBED region defined in Defining a New Rate Constant for Y-Chromosome SNPs based on Full Sequencing Data by Dmitry Adamov, Vladimir Guryanov, Sergey Karzhavin, Vladimir Tagankin, Vadim Urasin.

The McDonald BED column indicates whether or not the mutation is a SNP and falls in the BED region used by Dr. Iain McDonald in the age analysis he does for R-U106 men.

Age Analysis Information (work in progress)

AllMcDonaldYFull
Kit: 362045977274379631037841511
Kit: 3620451479204892672798257978
Used in age calculations1479204892672798257978
Counts of SNPs2121
Variant counts last updated 2020-11-07 02:45:09.



Big Tree Main Page