Tree Position

R-M269 > L23 > Z2103 > PF331

Unique Mutations

The mutations unique to this man are summarized in the table below. Those with a '+' or '*' confidence level are considered by FamilyTreeDNA or FullGenomesCorp to be high quality SNPs/INDELs. For completeness, all other mutations of lesser confidence are included as well. These additional mutations may be useful for distinguishing between very closely related men.

Occasionally, some of the mutations listed here will be thought to be shared with other men in which case they might appear in upstream blocks on the tree. When this happens, the 'Blocks' field will indicate what block they appear in. Such a situation might arise with BigY men if the BED data suggests another man may be positive for a SNP, even though it doesn't appear in his VCF data. It might also happen if Chromo2 testing or Sanger sequencing of other men not on the tree show the SNP to be shared.

POS-REF-ALT (hg19) POS-REF-ALT (hg38) Blocks Names Region McDonald BED combBED STRBigY3
557529
BigY2
557529
23897202-A-C 21735316-A-C YA+
28014446-A-C 25868299-A-C P1_Y2 A+
13447336-C-A 11291660-C-A A*
13451631-A-T 11295955-A-T 4×TCCATA*
17951468-A-T 15839588-A-T ZS7786 YYA*
28817717-G-T 26671570-G-T A*
25958439-T-C 23812292-T-C P1_Y1 A*A*
13451536-G-GCCAC 11295860-G-GCCAC A*
56831681-G-GACTCC A*
10961373-T-G A*
3195537-A-G 3327496-A-G A*
19667773-G-A 17555893-G-A BY211891 P5_Prx A*+
20255094-T-TA 18093208-T-TA P5_Dst 20×AA*
28816671-T-G 26670524-T-G A*
13463989-C-T 11308313-C-T A*
13449247-C-A 11293571-C-A A*
28817069-C-A 26670922-C-A A*
20872434-A-AT 18710548-A-AT P4_Dst 25×TA*
20859789-G-GA 18697903-G-GA P4_Dst 13×AA*
13449164-G-GTTCCACTCCT 11293488-G-GTTCCACTCCT A*
10961386-C-A A*
13451309-C-T 11295633-C-T A*
13448419-A-C 11292743-A-C A*
13451650-A-G 11295974-A-G A*
20453570-C-CT 18291684-C-CT P5_Dst 12×TA*
13451212-G-C 11295536-G-C A*
26098991-G-T 23952844-G-T P1_Y1 A*A*
26063453-T-C 23917306-T-C P1_Y1 A*A*
13450857-A-C 11295181-A-C A*
20512003-C-T 18350117-C-T P5_Dst A*
6271369-G-A 6403328-G-A IR3_Dst A*A*
18314096-G-C 16202216-G-C P6_Prx A*A*
19683425-G-A 17571545-G-A P5_Prx A*A*
20714261-C-A 18552375-C-A P4_Prx A*A*
58979889-C-A 56833742-C-A A*
26393313-A-G 24247166-A-G P1_Y1 A*
25947929-T-G 23801782-T-G P1_Y1 A*
20798766-T-A 18636880-T-A BY196760 P4_Prx A*
25614942-G-A 23468795-G-A P1_gr1 A*
26099192-C-T 23953045-C-T P1_Y1 A*A*
56836092-A-T A*
22311018-C-A 20149132-C-A DYZ19 A*A*
22252843-G-T 20090957-G-T DYZ19 A*A*
19735538-A-G 17623658-A-G P5_Prx A*
28816838-G-T 26670691-G-T A*
22265949-G-A 20104063-G-A DYZ19 A*A*
19727853-C-A 17615973-C-A P5_Prx A*
13633018-C-T 11477342-C-T FT225303 9×TCT+**
16747923-T-A 14636043-T-A Y97166 YY++
16556794-C-T 14444914-C-T Y96678 YY++
18832024-G-C 16720144-G-C Y102804 YY++
19108520-G-A 16996640-G-A Y103662 YY++
18924018-C-T 16812138-C-T Y103055 YY++
13707957-G-C 11552281-G-C BY89371 ++
16590552-A-G 14478672-A-G Y96781 YY++
9521917-G-T 9684308-G-T Y89078 ++
13705942-T-A 11550266-T-A BY51979 ++
16680261-T-A 14568381-T-A Y97003 YY++
13661070-A-T 11505394-A-T BY87432 ++
18945942-C-T 16834062-C-T BY3719 YY++
28478364-A-G 26332217-A-G FGC35095 +**
13646061-C-T 11490385-C-T BY49653 ++
14051084-A-G 11930378-A-G Y90157 YY++
6388427-G-A 6520386-G-A BY60073 ++
15714003-G-T 13602123-G-T Y94531 YY++
15037365-C-G 12925453-C-G Y92852 YY++
15250580-G-T 13138666-G-T Y93350 Y++
21462982-C-T 19301096-C-T Y106546 YY++
15359474-G-A 13247594-G-A Y93626 YY**+
22460458-A-C 20298572-A-C BY51554 DYZ19 ++
22475374-T-C 20313488-T-C BY223340 DYZ19 **+
22475694-T-G 20313808-T-G FT459778 DYZ19 +
22560278-T-G 20398392-T-G Y109087 YY++
14705831-T-C 12593897-T-C Y92001 YY++
22676149-T-C 20514263-T-C Y109432 YY++
15575890-TC-T 13464010-TC-T ++
3078849-A-G 3210808-A-G Y81805 ++
13821918-G-A 11701212-G-A Y89700 ++
14528307-T-C 12416508-T-C FT133912 YY+**
14368004-C-T 12247300-C-T Y91219 YY+**
23589609-C-T 21427723-C-T Y111976 YY++
14337590-A-G 12216885-A-G Y91136 YY++
14282044-C-T 12161338-C-T BY94543 YY++
8192063-C-G 8324022-C-G Y86047 YY++
9880192-GT-G 10042583-GT-G 8×T++
16250729-C-G 14138849-C-G Y95733 YY++
16268534-A-G 14156654-A-G Y95799 YY++
6365042-C-A 6497001-C-A Y82131 ++
13852150-T-C 11731444-T-C Y89811 ++
18394696-G-A 16282816-G-A PR2842 Y101873 P6_Gap ++
18821808-G-A 16709928-G-A Y102775 YY++
21883299-A-G 19721413-A-G Y107778 YY++
13629923-C-T 11474247-C-T FT225304 +
19301928-C-T 17190048-C-T Z19696 Y+
17774798-G-T 15662918-G-T BY117348 YY++
9057246-T-C FT133643 +
17322726-GA-G 15210846-GA-G ++
8652993-G-A 8784952-G-A Y87624 YY++
7892643-G-T 8024602-G-T Y85281 YY++
3018338-C-G 3150297-C-G FT132355 +
3158133-A-G 3290092-A-G FT132385 +
3811870-T-G 3943829-T-G FT132574 +
8595286-C-T 8727245-C-T Y87411 YY++
3955856-G-A 4087815-G-A FT132615 +
17872571-C-T 15760691-C-T Y100473 YY++
4015140-C-G 4147099-C-G FT132635 +
4027076-C-T 4159035-C-T FT132639 +
4437408-G-A 4569367-G-A FT132754 +
20392426-C-T 18230540-C-T BY30974 BY67410BY30987 P5_Dst ++
5245520-G-T 5377479-G-T FT132969 +
5323430-C-T 5455389-C-T +
5526356-G-A 5658315-G-A FT133047 +
5632738-C-T 5764697-C-T FT133086 +
10788205-ACATTTCATTTCAC-A +
5803286-T-C 5935245-T-C +
8680166-G-C 8812125-G-C Y87710 YY++
19299490-A-G 17187610-A-G FT134593 Y+
7823214-A-G 7955173-A-G Y85080 YY++
28790586-G-T 26644439-G-T +*
7092235-TCATC-T 7224194-TCATC-T 8×CATC+**
17970808-G-A 15858928-G-A Y100819 YY++
17352964-A-G 15241084-A-G BY114105 YY++
8046231-G-T 8178190-G-T Y85698 YY++
19966688-AAAG-A 17854808-AAAG-A P5_Prx 26×AAG+
17288715-A-G 15176835-A-G Y98679 YY++
17146120-C-A 15034240-C-A Y98315 YY++
28652316-G-A 26506169-G-A FT135119 +
10664116-T-G FT225305 +
17033535-C-G 14921655-C-G Y98003 YY++
28712094-G-T 26565947-G-T FT135137 +
6183212-G-GCA 6315171-G-GCA IR3_Dst 20×CA*
11000397-GCATTC-G *
7144386-G-GGT 7276345-G-GGT 15×GT****
5458736-G-T 5590695-G-T *
22254475-G-T 20092589-G-T DYZ19 *
22238236-G-A 20076350-G-A BY213781 DYZ19 *
10801667-C-G FT44709 *
10892542-TCATTCCATTCCATTCCATTC-T *
58976432-T-C 56830285-T-C *
10875752-G-GTTCCA ****
22280313-C-G 20118427-C-G DYZ19 *
7250545-G-GGTGT 7382504-G-GGTGT 19×GT*
58986808-C-A 56840661-C-A ***
22422475-T-G 20260589-T-G DYZ19 ***
10662418-C-A *
4272991-T-TTG 4404950-T-TTG 11×TG*
28796340-A-C 26650193-A-C ****
13843713-AGGAAT-A 11723007-AGGAAT-A 10×GGAAT**
4964479-C-CGT 5096438-C-CGT 19×GT*
22099633-TTTATTATTA-T,TTTA 19937747-TTTATTATTA-T,TTTA 16×TTA*
22281111-A-G 20119225-A-G BY17342 DYZ19 **
15358564-C-A 13246683-C-A FT60109 **
15127183-C-A 13015270-C-A **
15126819-T-C 13014906-T-C **
15733815-A-G 13621935-A-G **
15758544-T-C 13646664-T-C **
15556826-A-T 13444946-A-T **
15495194-T-A 13383314-T-A **
15541788-G-A 13429908-G-A **
15394497-T-C 13282617-T-C **
15495198-T-A 13383318-T-A **
15424795-G-T 13312915-G-T **
15423185-G-T 13311305-G-T **
15402829-T-C 13290949-T-C **
17407840-C-A 15295960-C-A **
15158793-CAA-C 13046879-CAA-C 12×A**
15395001-T-G 13283121-T-G **
15289997-C-A 13178096-C-A **
16990216-T-A 14878336-T-A **
15805480-GGCCATT-G 13693600-GGCCATT-G **
16654776-C-T 14542896-C-T **
16475236-A-C 14363356-A-C **
16502499-A-T 14390619-A-T **
16506951-T-A 14395071-T-A **
16516200-T-G 14404320-T-G **
17217170-T-C 15105290-T-C **
17159020-A-C 15047140-A-C **
15106692-G-T 12994780-G-T **
16652017-G-T 14540137-G-T **
17136986-C-A 15025106-C-A **
16462553-C-A 14350673-C-A **
16654777-A-G 14542897-A-G **
16654785-C-T 14542905-C-T **
16662687-C-T 14550807-C-T **
17136984-T-G 15025104-T-G **
17128582-C-A 15016702-C-A **
16876840-C-A 14764960-C-A **
16989015-A-G 14877135-A-G **
16990196-C-A 14878316-C-A **
16475168-T-G 14363288-T-G **
16379271-A-C 14267391-A-C **
15882072-CTCAAA-C 13770192-CTCAAA-C **
16990244-AAAAG-A 14878364-AAAAG-A **
16015926-T-C 13904046-T-C **
16021033-C-A 13909153-C-A **
16030178-C-G 13918298-C-G **
16038084-C-A 13926204-C-A **
17306400-A-C 15194520-A-C **
16039267-G-T 13927387-G-T **
16052749-T-C 13940869-T-C **
16052760-T-C 13940880-T-C **
16058977-C-T 13947097-C-T **
16336897-GTTTTTTTTT-G 14225017-GTTTTTTTTT-G 23×T**
16059028-CTTTT-C 13947148-CTTTT-C 19×T**
16092986-G-A 13981106-G-A **
16108702-C-CTTTTCTTTTCT 13996822-C-CTTTTCTTTTCT P8_Prx 10×TTTCT**
16270369-C-A 14158489-C-A **
16271828-G-A 14159948-G-A **
16271838-T-A 14159958-T-A **
16292543-A-G 14180663-A-G **
16309221-C-T 14197341-C-T **
16320490-A-G 14208610-A-G **
16058975-G-T 13947095-G-T **
14224390-A-G 12103684-A-G **
15104874-C-A 12992962-C-A **
13457775-C-CCCCTG 11302099-C-CCCCTG **
11024628-C-T **
11030014-G-T **
11030036-C-A **
11038060-A-T **
13305647-G-A 11149971-G-A **
13355081-A-C 11199405-A-C **
13394821-A-G 11239145-A-G **
13457727-A-T 11302051-A-T **
13457741-C-CGGATG 11302065-C-CGGATG **
13460648-G-AA 11304972-G-AA **
11019399-CG-A **
13461076-G-T 11305400-G-T **
13462244-C-T 11306568-C-T **
13467921-G-A 11312245-G-A **
13474443-A-G 11318767-A-G **
13488973-T-A 11333297-T-A **
13504082-C-A 11348406-C-A **
13558289-C-A 11402613-C-A **
13587514-C-A 11431838-C-A **
13604677-A-T 11449001-A-T **
13604697-A-T 11449021-A-T **
11021792-A-T **
11019391-TTCCA-T **
11646078-G-C **
10987990-A-G **
10982341-C-T **
10982371-C-T **
10985023-G-T **
10985261-T-G **
10987022-A-C **
10987457-A-G **
10987828-CCA-C **
10987983-C-G **
10987989-A-T **
10987994-A-T **
11013441-C-A **
10988011-TTCCAC-T **
10988650-T-C **
10993552-C-A **
10997162-T-C **
10997163-T-C **
11000031-T-G **
11000114-G-C **
11000146-T-C **
11001573-C-CTACTG **
11001995-C-A **
13624023-C-A 11468347-C-A **
11647987-A-G **
15061731-G-A 12949823-G-A FT201554 **
14714985-T-C 12603052-T-C **
14539359-C-A 12427560-C-A **
14559983-A-T 12448184-A-T **
14589195-G-T 12477395-G-T **
14606458-C-A 12494660-C-A **
14609798-T-A 12498000-T-A **
14610691-ACCT-A 12498893-ACCT-A 5×CCT**
14620334-C-A 12508532-C-A **
14648656-C-A 12536721-C-A **
14667704-C-A 12555769-C-A **
14743488-A-G 12631557-A-G **
14513210-T-G 12401415-T-G **
14798667-C-A 12686738-C-A **
14799936-A-T 12688007-A-T **
14862928-A-T 12750994-A-T **
14862935-A-T 12751001-A-T **
14862939-A-T 12751005-A-T 12×T**
14911919-C-A 12799986-C-A **
14926458-GTC-G 12814523-GTC-G **
14933551-A-T 12821616-A-T **
14933552-G-A 12821617-G-A **
14994105-C-A 12882190-C-A **
14530906-A-G 12419107-A-G **
14495798-G-T 12383995-G-T **
11649142-C-T **
13962523-CCCTGAT-C 11841817-CCCTGAT-C **
11651736-G-T **
11658128-C-A **
11659062-C-T **
11670591-T-A **
13809294-A-T 11688588-A-T **
13809902-T-A 11689196-T-A **
13855576-GAATGC-G 11734870-GAATGC-G **
13859223-C-A 11738517-C-A **
13870386-A-G 11749680-A-G **
13962077-G-A 11841371-G-A **
13974693-CTTTT-C 11853987-CTTTT-C 17×T**
14392826-C-G 12272122-C-G **
14038232-T-G 11917526-T-G **
14074659-G-T 11953953-G-T **
14080196-C-G 11959490-C-G **
14080200-A-G 11959494-A-G **
14093596-C-A 11972890-C-A **
14176395-C-A 12055689-C-A **
14195093-G-T 12074387-G-T **
14224393-T-C 12103687-T-C **
14344078-C-A 12223373-C-A **
14351223-G-A 12230518-G-A **
17413413-TG-T 15301533-TG-T **
19189481-T-C 17077601-T-C **
17428444-G-T 15316564-G-T **
21766753-A-AC **
56845224-C-A **
56845233-G-C **
56845238-T-C **
27872568-A-T 25726421-A-T P1_Y2 **
56728169-A-T **
13466321-G-A 11310645-G-A **
28481236-C-A 26335089-C-A **
25970738-CT-C 23824591-CT-C P1_Y1 **
13453396-TTCCTTTCCTA-T 11297720-TTCCTTTCCTA-T **
25966246-T-TC 23820099-T-TC P1_Y1 **
27499382-C-T 25353235-C-T P1_Y2 **
21751040-G-T **
21766795-T-C **
23952731-A-C 21806584-A-C **
24115156-G-A 21969009-G-A P3_b1 **
24245785-T-G 22099638-T-G P3_b1 **
24264289-T-TC 22118142-T-TC P3_b1 **
24302317-T-A 22156170-T-A P3_t1 **
24302334-T-TC 22156187-T-TC P3_t1 **
24353306-C-A 22207159-C-A P3_t1 **
24472483-C-A 22326336-C-A **
24595384-G-C 22449237-G-C P3_t2 **
24280881-A-AC 22134734-A-AC P3_t1 **
24904548-T-G 22758401-T-G g1 **
23439042-C-A 21277156-C-A **
22782069-T-C 20620183-T-C **
22842294-C-A 20680408-C-A **
22961984-GT-G 20800098-GT-G 8×T**
23185888-A-T 21024002-A-T **
23200740-C-A 21038854-C-A **
23333676-T-C 21171790-T-C **
23342000-T-A 21180114-T-A **
23350654-G-T 21188768-G-T **
23360741-C-A 21198855-C-A **
23439896-G-GT 21278010-G-GT 8×T**
56728160-A-T **
23465844-T-C 21303958-T-C **
23512197-A-T 21350311-A-T **
23516602-T-G 21354716-T-G **
23818438-G-T 21656552-G-T **
23831291-C-G 21669405-C-G **
23875432-T-A 21713546-T-A **
23884436-A-AG 21722550-A-AG **
23898002-A-ACT 21736116-A-ACT **
28778854-T-TC 26632707-T-TC *****
23981934-CTT-C 21835787-CTT-C 14×T**
24541388-A-AG 22395241-A-AG P3_t2 **
24910877-T-C 22764730-T-C g1 **
22774948-G-A 20613062-G-A **
13565490-C-T 11409814-C-T FT225306 **
28649311-A-T 26503164-A-T **
28650611-T-C 26504464-T-C **
28655031-C-A 26508884-C-A **
28659950-C-A 26513803-C-A **
28757995-C-A 26611848-C-A **
56841311-C-A **
56842823-G-C **
56844485-C-A **
56846963-G-T **
9639082-A-T 9801473-A-T IR3_Prx **
28597362-A-T 26451215-A-T **
12372815-ATTT-A **
6605511-T-TTATA 6737470-T-TTATA 14×TA**
5347324-C-T 5479283-C-T **
9371844-A-G 9534235-A-G **
17065452-A-G 14953572-A-G **
17643729-C-T 15531849-C-T **
18365653-A-G 16253773-A-G P6_Prx **
20048080-T-A 17936200-T-A P5_Prx **
25885223-T-A 23739076-T-A P1_Y1 **
25885228-T-TC 23739081-T-TC P1_Y1 **
28613042-C-A 26466895-C-A **
28558891-A-G 26412744-A-G **
24910927-A-T 22764780-A-T g1 **
27898428-A-G 25752281-A-G P1_Y2 **
24950951-G-A 22804804-G-A g1 **
25720449-G-A 23574302-G-A BY25017 P1_b3 **
25861826-T-C 23715679-T-C P1_Y1 **
25966272-C-A 23820125-C-A P1_Y1 **
25966295-G-T 23820148-G-T P1_Y1 **
26018408-TGTG-T 23872261-TGTG-T P1_Y1 **
26118975-A-G 23972828-A-G P1_Y1 **
27546766-C-G 25400619-C-G P1_Y2 **
27898409-T-TC 25752262-T-TC P1_Y2 **
27898429-G-T 25752282-G-T P1_Y2 **
28558874-T-A 26412727-T-A **
27898433-A-T 25752286-A-T P1_Y2 **
27898441-C-T 25752294-C-T P1_Y2 **
27898443-G-A 25752296-G-A P1_Y2 **
27898451-A-G 25752304-A-G P1_Y2 **
27971705-C-A 25825558-C-A P1_Y2 **
28068167-GA-G 25922020-GA-G P1_Y2 **
28479723-C-A 26333576-C-A **
28500882-C-A 26354735-C-A **
28501059-C-A 26354912-C-A **
28545694-TACAAAAAA-T 26399547-TACAAAAAA-T **
22774950-C-A 20613064-C-A **
22739679-C-A 20577793-C-A **
17452542-T-C 15340662-T-C **
18972836-C-A 16860956-C-A **
18728870-C-A 16616990-C-A **
18753399-G-T 16641519-G-T **
18780584-A-G 16668704-A-G **
18792075-C-T 16680195-C-T **
18850484-G-T 16738604-G-T **
18850618-AC-A 16738738-AC-A **
18875742-C-A 16763862-C-A **
18924864-C-A 16812984-C-A **
18937437-A-G 16825557-A-G **
19062258-A-C 16950378-A-C **
18546995-C-A 16435115-C-A **
19062317-C-A 16950437-C-A **
19187410-TTTTG-T 17075530-TTTTG-T **
19187443-A-T 17075563-A-T **
19189467-AG-A 17077587-AG-A **
19189473-A-G 17077593-A-G **
10982317-T-TTACTTCAC **
19189487-G-C 17077607-G-C **
19231345-A-T 17119465-A-T **
19244780-C-A 17132900-C-A **
19246191-G-A 17134311-G-A **
18630956-T-G 16519076-T-G **
18491455-C-A 16379575-C-A P6_Dst **
19301974-C-A 17190094-C-A **
18188133-C-A 16076253-C-A **
17452871-T-G 15340991-T-G **
17693689-A-G 15581809-A-G **
17693723-A-C 15581843-A-C **
17693729-T-A 15581849-T-A **
17693734-TC-T 15581854-TC-T **
17714945-G-A 15603065-G-A **
17830911-G-T 15719031-G-T **
17883957-C-T 15772077-C-T **
17901772-G-T 15789892-G-T **
18230513-C-A 16118633-C-A **
18447640-C-CT 16335760-C-CT P6_Dst **
18256270-C-A 16144390-C-A **
18271018-GTTT-G 16159138-GTTT-G 17×T**
18344312-T-A 16232432-T-A P6_Prx **
18344339-T-TA 16232459-T-TA P6_Prx **
18378961-T-TG 16267081-T-TG P6_Prx **
18378977-T-TC 16267097-T-TC P6_Prx **
18406914-GCAAATCC-G 16295034-GCAAATCC-G P6_Gap **
18412400-A-G 16300520-A-G P6_Gap **
18423908-A-G 16312028-A-G P6_Gap **
18443540-C-A 16331660-C-A P6_Dst **
19275308-C-A 17163428-C-A **
19399895-C-A 17288015-C-A **
22654973-C-A 20493087-C-A **
23187710-C-A 21025824-C-A **
21488762-C-A 19326876-C-A **
21500368-A-C 19338482-A-C **
21515846-G-A 19353960-G-A **
21515860-C-T 19353974-C-T **
21540963-T-C 19379077-T-C **
21603966-T-TA 19442080-T-TA 11×A**
21703125-C-A 19541239-C-A **
21856617-G-T 19694731-G-T **
56833201-C-T **
56850903-C-T **
21455459-C-A 19293573-C-A **
21991097-A-T 19829211-A-T **
22011961-A-T 19850075-A-T **
22012358-A-C 19850472-A-C **
22023222-GA-G 19861336-GA-G **
22052664-C-A 19890778-C-A **
22092856-C-T 19930970-C-T **
22205533-A-G 20043647-A-G **
22427999-G-C 20266113-G-C DYZ19 **
22625001-C-A 20463115-C-A **
22638272-A-C 20476386-A-C **
21482836-CA-C 19320950-CA-C **
21367269-A-G 19205383-A-G **
19555829-G-T 17443949-G-T **
20434786-G-A 18272900-G-A P5_Dst **
19558297-A-G 17446417-A-G **
19609539-A-T 17497659-A-T P5_Prx **
19613753-G-A 17501873-G-A P5_Prx **
19667752-A-T 17555872-A-T P5_Prx **
19667890-C-T 17556010-C-T P5_Prx **
19732412-C-CT 17620532-C-CT P5_Prx **
19795159-A-T 17683279-A-T P5_Prx **
11028281-C-A **
20021529-T-C 17909649-T-C P5_Prx **
20434788-T-A 18272902-T-A P5_Dst **
21325686-G-T 19163800-G-T **
20629018-TC-T 18467132-TC-T P4_Prx **
20661843-C-CT 18499957-C-CT P4_Prx **
20700680-C-CAA 18538794-C-CAA P4_Prx **
20888611-C-A 18726725-C-A P4_Dst **
20993599-A-AG 18831713-A-AG P4_Dst **
21012076-A-T 18850190-A-T P4_Dst **
21072375-C-A 18910489-C-A **
21125688-G-A 18963802-G-A **
21187810-A-C 19025924-A-C **
21240559-C-A 19078673-C-A **
10982322-TCAA-T **
6918459-C-A 7050418-C-A **
10982308-G-T **
5270693-CTTTTTTTTT-C 5402652-CTTTTTTTTT-C 22×T**
4704099-G-C 4836058-G-C **
4795492-G-T 4927451-G-T **
4957688-C-A 5089647-C-A **
4957716-A-C 5089675-A-C **
5065475-A-T 5197434-A-T **
5077542-G-T 5209501-G-T **
5092675-C-A 5224634-C-A **
5107873-C-A 5239832-C-A **
5189616-G-A 5321575-G-A **
5240913-T-C 5372872-T-C **
5240916-T-C 5372875-T-C **
5309513-C-A 5441472-C-A **
4703105-G-A 4835064-G-A **
5358518-T-C 5490477-T-C **
5358551-C-A 5490510-C-A **
5393507-C-A 5525466-C-A **
5444030-A-G 5575989-A-G **
5526836-T-G 5658795-T-G **
5635240-G-T 5767199-G-T 5×TTTGT**
5817541-A-G 5949500-A-G **
5824736-T-C 5956695-T-C **
5864004-G-T 5995963-G-T **
5864817-C-A 5996776-C-A **
5895875-C-A 6027834-C-A Y82101 **
4704061-A-C 4836020-A-C **
4674326-G-T 4806285-G-T **
5926697-G-T 6058656-G-T **
4282183-T-G 4414142-T-G **
3875951-T-A 4007910-T-A **
3986290-A-C 4118249-A-C **
3991913-C-A 4123872-C-A **
4063888-C-A 4195847-C-A **
4103165-C-A 4235124-C-A **
4167555-G-T 4299514-G-T **
4171641-C-T 4303600-C-T **
4201653-C-A 4333612-C-A **
4229282-A-C 4361241-A-C **
4241823-C-A 4373782-C-A **
4256755-T-A 4388714-T-A **
4366176-T-C 4498135-T-C **
4672242-C-A 4804201-C-A FGC22742 **
4388615-G-C 4520574-G-C **
4505388-C-T 4637347-C-T **
4505392-C-T 4637351-C-T **
4505402-C-T 4637361-C-T **
4505403-A-G 4637362-A-G **
4505406-C-T 4637365-C-T **
4505414-A-T 4637373-A-T 22×T**
4521612-TAAA-T 4653571-TAAA-T 17×A**
4545343-G-T 4677302-G-T **
4554524-C-A 4686483-C-A **
4635299-T-C 4767258-T-C **
4638291-C-A 4770250-C-A **
5911225-C-A 6043184-C-A **
6124569-T-G 6256528-T-G **
3759362-T-C 3891321-T-C **
7286877-A-T 7418836-A-T **
7163119-C-A 7295078-C-A **
7183733-C-T 7315692-C-T **
7185527-G-T 7317486-G-T **
7188432-T-C 7320391-T-C **
7211314-C-A 7343273-C-A **
7217445-C-G 7349404-C-G **
7217473-A-C 7349432-A-C **
7217485-G-T 7349444-G-T **
7217506-T-C 7349465-T-C **
7217516-A-C 7349475-A-C **
7270315-G-T 7402274-G-T **
7314576-A-G 7446535-A-G **
7162993-C-T 7294952-C-T **
7335736-G-A 7467695-G-A **
7353164-G-T 7485123-G-T **
7363314-CA-C 7495273-CA-C 10×A**
7363902-A-C 7495861-A-C **
7370086-C-A 7502045-C-A **
7534564-C-T 7666523-C-T **
7579037-C-A 7710996-C-A **
7645202-ATT-A 7777161-ATT-A 17×T**
7861524-G-A 7993483-G-A **
7897581-C-G 8029540-C-G **
8058481-G-T 8190440-G-T **
8067435-G-T 8199394-G-T **
7163042-G-T 7295001-G-T **
7157036-C-A 7288995-C-A **
6131011-G-T 6262970-G-T **
6576758-TG-T 6708717-TG-T **
6147467-A-T 6279426-A-T IR3_Dst **
6147471-G-T 6279430-G-T IR3_Dst **
6159132-C-A 6291091-C-A IR3_Dst **
6267186-CAAAAGATGATGGAG-C 6399145-CAAAAGATGATGGAG-C IR3_Dst **
6273847-A-T 6405806-A-T IR3_Dst **
6359640-TAAAA-T 6491599-TAAAA-T 22×A**
6368126-C-A 6500085-C-A **
6392521-T-G 6524480-T-G **
6414310-C-A 6546269-C-A **
6453995-G-C 6585954-G-C **
6510261-C-T 6642220-C-T **
6756907-TC-T 6888866-TC-T **
7063850-A-C 7195809-A-C **
6765876-A-G 6897835-A-G **
6765881-A-C 6897840-A-C **
6775996-G-C 6907955-G-C **
6786929-G-T 6918888-G-T **
6795253-C-A 6927212-C-A **
6827905-C-A 6959864-C-A **
6839690-C-A 6971649-C-A **
6891928-T-C 7023887-T-C **
6892375-C-A 7024334-C-A **
6923057-T-G 7055016-T-G **
7021809-C-T 7153768-C-T **
7053880-T-A 7185839-T-A **
3859572-T-C 3991531-T-C **
3745450-A-T 3877409-A-T **
8481393-T-A 8613352-T-A **
58905191-G-C 56685680-C-G **
15374441-GTT-G 13262561-GTT-G 20×T**
13460653-C-T 11304977-C-T **
13460677-C-T 11305001-C-T **
13460678-C-A 11305002-C-A **
13460669-AC-A 11304993-AC-A **
7335695-C-A 7467654-C-A **
24235448-C-A 22089301-C-A P3_b1 **
13571665-A-AT 11415989-A-AT 17×T**
20326075-G-T 18164189-G-T P5_Dst **
13488991-G-A 11333315-G-A **
7275188-T-TAA 7407147-T-TAA 20×A**
58997030-A-G 56850883-A-G **
58991349-T-C 56845202-T-C **
13474656-G-T 11318980-G-T **
58834006-T-C 56756865-A-G **
22023229-A-G 19861343-A-G **
17718412-GTT-G 15606532-GTT-G 20×T**
58977632-C-T 56831485-C-T **
58997119-T-G 56850972-T-G **
4908175-CAA-C 5040134-CAA-C 17×A**
13457755-C-G 11302079-C-G **
3276018-G-C 3407977-G-C **
13394839-C-G 11239163-C-G 13×G**
21515842-G-A 19353956-G-A **
58991335-G-T 56845188-G-T **
24595405-A-T 22449258-A-T P3_t2 **
10987764-C-A **
17387294-G-GTA 15275414-G-GTA 12×TA**
13140173-T-C 10629659-T-C **
17319948-G-A 15208068-G-A FGC9533 **
13711403-A-T 11555727-A-T **
9414414-CTG-C 9576805-CTG-C 17×TG**
27499360-T-C 25353213-T-C P1_Y2 **
27499376-C-T 25353229-C-T P1_Y2 **
27499448-A-G 25353301-A-G P1_Y2 **
27971753-AC-A 25825606-AC-A P1_Y2 **
16290775-G-GTA 14178895-G-GTA 19×TA**
17466768-G-GA 15354888-G-GA 18×A**
13460657-C-G 11304981-C-G **
2773714-T-G 2905673-T-G **
7414259-C-A 7546218-C-A **
6765637-TC-T 6897596-TC-T **
9774421-TTTTC-T 9936812-TTTTC-T 5×TTTC*****
13588226-T-A 11432550-T-A **
16401967-GTA-G 14290087-GTA-G **
16990260-G-A 14878380-G-A **
19189484-G-T 17077604-G-T **
18195154-AT-A 16083274-AT-A 29×T**
13856984-A-T 11736278-A-T FT328796 **
14568803-TAC-T 12457003-TAC-T 8×AC**
58997021-G-A 56850874-G-A **
21515852-G-A 19353966-G-A **
6359674-G-A 6491633-G-A **
15753178-CTTTTTT-C 13641298-CTTTTTT-C 20×T**
14123536-G-T 12002830-G-T **
3745409-T-G 3877368-T-G **
3218466-C-G 3350425-C-G **
2785226-T-G 2917185-T-G **
2845805-G-A 2977764-G-A **
2845807-G-C 2977766-G-C **
2845818-T-C 2977777-T-C **
2884145-A-G 3016104-A-G Y81701 **
2900748-A-G 3032707-A-G **
2947898-TTGATTATCTC-T 3079857-TTGATTATCTC-T **
2980191-C-A 3112150-C-A **
3048343-C-A 3180302-C-A **
3058837-T-C 3190796-T-C **
3155857-A-T 3287816-A-T FTB84685 **
3218563-G-T 3350522-G-T **
2774871-C-A 2906830-C-A **
3218661-C-T 3350620-C-T **
3253030-T-C 3384989-T-C **
3254574-AT-A 3386533-AT-A 11×T**
3277040-C-A 3408999-C-A **
3286572-C-A 3418531-C-A **
3364526-G-T 3496485-G-T **
3405453-T-C 3537412-T-C **
3453564-C-A 3585523-C-A **
3491601-G-T 3623560-G-T **
3564974-G-C 3696933-G-C **
3571316-C-T 3703275-C-T **
3686468-G-T 3818427-G-T **
2785169-A-T 2917128-A-T **
2772838-G-C 2904797-G-C **
10887387-C-A **
10987201-C-T **
10961205-C-A **
10951003-CTCCTA-C **
10951023-T-C **
11020066-C-A **
10687227-C-G **
10687245-C-T **
10687249-A-ACTCCACTCTG **
10973970-T-C **
10974022-C-G **
10987173-A-G **
10987185-T-A **
10775045-C-A **
2758331-G-T 2890290-G-T **
13480486-T-A 11324810-T-A **
10673920-T-C **
10992974-C-A **
10993527-T-C **
10993536-C-A **
10993542-C-A **
2649667-G-T 2781626-G-T **
2665435-G-C 2797394-G-C **
2684012-C-T 2815971-C-T **
2697794-T-TAA 2829753-T-TAA 10×A**
2718913-C-T 2850872-C-T **
2718921-G-T 2850880-G-T **
8351597-C-A 8483556-C-A **
6248925-A-T 6380884-A-T IR3_Dst **
20021497-T-TAG 17909617-T-TAG P5_Prx **
10770308-CTCCAT-C **
10961245-G-C **
10961238-C-T **
10914671-G-T **
10961237-T-A **
10914666-G-A **
10961230-C-T **
10918785-C-A **
10764936-C-A **
10794254-C-CACTAT **
10759947-T-TTTAAC **
10902141-C-T FT436005 **
10794266-C-A **
10794275-A-G **
10794293-C-G BY83837 **
10796651-C-T **
10899082-C-G **
10796677-C-CCCTGCAGTCGGGTTG **
10808891-C-A **
10961480-T-C **
10759944-G-T **
10812367-T-C **
10754014-C-G **
10686433-A-T **
10691155-T-C **
10961500-A-T **
10946816-C-T **
10691364-T-A **
10691372-C-CACCCT **
10744293-A-G **
10746999-G-GTTCCA **
10754930-TCCTCTCCA-T **
10914687-C-A **
10754940-TCC-T **
10754950-TC-T **
10754986-C-G **
10961497-A-C **
10914719-A-C **
10759937-C-T **
10759942-C-G **
10961484-C-T **
10808977-C-A **
10820970-C-A **
10673915-T-C **
10959319-C-A **
10846929-G-T **
10846936-T-A **
10961215-T-TCACAC **
10850306-C-A **
10861363-G-A **
10861737-C-A **
10861744-G-C **
10861761-A-G **
10958456-C-T **
10846141-T-C **
10888004-T-A **
10887370-T-C **
10887361-T-A **
10887360-T-C **
10958473-C-T **
10884617-C-T **
10958467-A-T **
10866101-C-G **
10846922-G-T **
10846131-T-C **
10824663-C-T **
10888007-C-A **
10827061-C-T **
10896375-C-T **
10827063-C-G **
10827068-C-A **
10827076-C-T **
10827091-T-A **
10888021-C-G BY83954 **
10831397-G-T **
10843751-A-C **
10846119-TACAAC-T **
10845633-T-C **
10845642-TTTCCA-T **
10956141-A-T **
10845675-C-CT **
10845679-T-TAATA **
10846061-C-A **
10846100-T-A **
10846110-CCATTT-C **
10679634-G-A **
10691354-T-A **
10673815-C-T **
10914735-G-A **
9537706-GTGTGT-G 9700097-GTGTGT-G IR3_Prx **
9577072-G-T 9739463-G-T IR3_Prx **
9577078-A-C 9739469-A-C IR3_Prx **
10916330-G-C **
10914751-C-A **
10939007-A-T **
9761184-C-A 9923575-C-A **
9930344-G-A 10092735-G-A **
9416906-A-G 9579297-A-G **
10964224-T-C **
10961524-T-C **
9949356-C-A 10111747-C-A **
10914734-G-C **
9956624-A-G 10119015-A-G **
10668340-C-CAATCCAATCCACTCA **
10015102-C-T 10177493-C-T ****
10019781-T-G 10182172-T-G **
9416906-A-AG 9579297-A-AG **
9416899-A-T 9579290-A-T **
10040173-A-G 10202564-A-G **
10973989-C-T **
10918610-C-A **
8690242-C-G 8822201-C-G **
8699653-A-C 8831612-A-C **
8699670-C-A 8831629-C-A **
10927893-G-T **
8699717-T-A 8831676-T-A **
8710064-C-A 8842023-C-A **
8712152-T-A 8844111-T-A **
8746331-C-A 8878290-C-A **
10938997-C-A **
8856470-G-T 8988429-G-T **
10916377-C-T **
8913425-C-A 9045384-C-A **
9107608-N-G **
9117236-C-A 9279627-C-A **
10935237-G-T **
9416872-A-ATT 9579263-A-ATT **
9416884-TTTTCGTAG-T 9579275-TTTTCGTAG-T **
10040147-A-C 10202538-A-C **
10010610-T-C 10173001-T-C **
10069962-T-C 10232353-T-C **
10661280-A-C **
10660204-T-A **
10944778-T-C **
10945545-G-T **
10660205-A-C **
10629632-C-G **
10660225-T-C **
10961519-T-C **
10914728-A-T **
10944769-C-T **
10661289-C-T **
10664773-C-T FT90196FT90196 **
10961511-C-T **
10961508-G-A **
10666929-C-G **
10666932-T-A **
10667057-A-C **
10668332-A-T **
10660038-G-T **
10877952-G-T **
10648112-C-T **
10659989-C-T **
10944767-G-A FT178258 **
10629633-A-G **
10659985-A-G **
10659979-T-C **
10914731-G-C **
10659990-AC-A **
10629663-A-ACTCTACTCCCCTCTT **
10629689-T-A **
10629646-C-CAATTT **
10659973-C-T **
28787958-T-A 26641811-T-A ***
11017528-C-A ***
11001548-A-C,G ***
13611988-G-GTTTTTTT 11456312-G-GTTTTTTT 19×T***
19356963-CAA-C 17245083-CAA-C 14×A***
7135386-A-AT 7267345-A-AT 22×T***
13484030-A-T 11328354-A-T BY26189 ***
17346142-CTT-C 15234262-CTT-C 18×T***
21558714-A-T 19396828-A-T ***
58976450-C-A 56830303-C-A ***
58905247-T-C 56685624-A-G ***
14693761-T-TA 12581827-T-TA 16×A***
13453390-A-T 11297714-A-T ***
56836052-A-T ***
13453384-G-C 11297708-G-C ***
13294177-C-A 11138501-C-A ***
4848574-G-GT 4980533-G-GT 29×T***
4581638-ATT-A 4713597-ATT-A 13×T***
13453372-T-A 11297696-T-A ***
56830297-C-T ***
11013181-C-A ***
56830188-C-A ***
8703659-ATTTT-A 8835618-ATTTT-A 18×T***
23350626-C-CT 21188740-C-CT 21×T***
58981655-T-G 56835508-T-G ***
10869965-CCCATTCCATT-C ***
13375826-ATT-A 11220150-ATT-A 12×T***
10986874-T-G ***
10986864-C-A ***
13482041-A-G 11326365-A-G ***
3148420-CTTTTT-C 3280379-CTTTTT-C 18×T***
14564947-C-T 12453147-C-T ***
16340147-GA-G,GAAA 14228267-GA-G,GAAA 22×A***
10986837-C-A ***
26544618-G-GAT 24398471-G-GAT P1_g2 14×AT***
10986726-C-A ***
13471981-C-A 11316305-C-A ***
8870041-CTTT-C 9002000-CTTT-C 14×T***
58981663-C-A 56835516-C-A ***
20778689-TACAC-T 18616803-TACAC-T P4_Prx 13×AC***
21964153-G-A 19802267-G-A ***
22486611-C-A 20324725-C-A BY224825 DYZ19 ***
58981662-C-A 56835515-C-A ***
58981679-A-T 56835532-A-T ***
58981650-A-T 56835503-A-T ***
10968381-C-T ***
28787959-G-A 26641812-G-A ***
18889266-CT-C 16777386-CT-C 11×T***
17872639-C-CT 15760759-C-CT 17×T***
10980653-C-G ***
14392735-CTTTT-C 12272031-CTTTT-C 17×T***
2810412-A-T 2942371-A-T ***
3086544-CAAA-C 3218503-CAAA-C 18×A***
8562849-T-A 8694808-T-A ***
13850265-A-AGGAATGGAAT 11729559-A-AGGAATGGAAT 15×GGAAT***
28817689-GAATGGA-G 26671542-GAATGGA-G ***
13696666-A-T 11540990-A-T ***
16267217-C-T 14155337-C-T ***
13487743-T-A 11332067-T-A ***
58980937-C-A 56834790-C-A ***
21558716-G-T 19396830-G-T ***
10896442-C-CT,CTT ***
14934305-TC-T 12822370-TC-T ***
10038603-A-G 10200994-A-G ***
7149622-CT-C,CTT 7281581-CT-C,CTT 19×T***
10038537-T-C 10200928-T-C ***
3559501-C-A 3691460-C-A FT90287 ***
5539267-TC-T 5671226-TC-T ***
9952664-G-A 10115055-G-A ***
15002050-AT-A,ATT 12890135-AT-A,ATT 14×T***
9952663-A-C 10115054-A-C ***
9952647-G-C 10115038-G-C ***
28814318-A-C 26668171-A-C ***
3838601-CTT-C 3970560-CTT-C 31×T***
16842867-ATGTG-A,ATG 14730987-ATGTG-A,ATG 22×TG***
4983777-CTTTT-C,CTTT 5115736-CTTTT-C,CTTT 22×T***
58975006-C-A 56828859-C-A ***
19270535-T-A 17158655-T-A ***
13223497-A-AG 11067821-A-AG ***
9524289-CTA-C 9686680-CTA-C 8×TA***
10924712-C-T FT436719 ***
8631408-TTG-T 8763367-TTG-T ***
13445185-AAAATATCACTTTATTTTTTACAGTGTTGACTTTGATATTCTAAACTTGTC-A 11289509-AAAATATCACTTTATTTTTTACAGTGTTGACTTTGATATTCTAAACTTGTC-A ***
14953605-CAA-C 12841679-CAA-C 14×A***
15969945-G-A 13858065-G-A ***
15904142-T-C 13792262-T-C ***
10664794-C-G ***
10664809-C-CCATGT ***
5640726-G-T 5772685-G-T ***
20326036-TGCA-T,TTCT 18164150-TGCA-T,TTCT P5_Dst ***
15394238-CA-C 13282358-CA-C 9×A***
21220240-CTTT-C,CTT 19058354-CTTT-C,CTT 19×T***
15076180-CTTTT-C 12964270-CTTTT-C 16×T***
10755388-ACTCATCTCTGTTTCATTCCG-A,ACTCATCTCTTTTTCATTCCG ***
21732683-A-T 19570797-A-T ***
56835183-CCACTCCACTT-C,CCACTCCACTC ***
19537901-CAAA-C,CAA 17426021-CAAA-C,CAA 17×A***
56833280-C-G ***
10760366-A-T ***
14324894-CTT-C 12204188-CTT-C 26×T***
10760375-C-T ***
21923316-C-T 19761430-C-T ***
22115622-AT-A,ATT 19953736-AT-A,ATT 14×T***
56830350-T-C,G ***
56835358-TTCCAC-T ***
10764549-TC-C,T ***
10788004-C-A ***
21946462-G-A 19784576-G-A ***
16020924-T-G 13909044-T-G ***
19436734-AAGAA-A,AAGAG 17324854-AAGAA-A,AAGAG ***
14549296-C-A 12437497-C-A ***
9702967-GA-G,GAA 9865358-GA-G,GAA IR3_Prx 11×A***
8425698-GT-G 8557657-GT-G 13×T***
8389589-TTTTTTG-G,TTTTTT 8521548-TTTTTTG-G,TTTTTT ***
7985920-C-A 8117879-C-A ***
7623468-G-A 7755427-G-A ***
8843536-ATTTTTTT-A 8975495-ATTTTTTT-A 23×T***
8890986-TAA-T,TA 9022945-TAA-T,TA 14×A***
18019832-CTTTTT-C 15907952-CTTTTT-C 22×T***
16825020-C-A 14713140-C-A ***
7233297-TAAAA-T 7365256-TAAAA-T 17×A***
16651433-CTT-C,CT 14539553-CTT-C,CT 16×T***
16562755-C-A 14450875-C-A ***
16545628-ATT-A 14433748-ATT-A 15×T***
19392778-GTT-G 17280898-GTT-G 12×T***
9793445-AT-A 9955836-AT-A 10×T***
18634734-A-G 16522854-A-G ***
16478341-C-A 14366461-C-A ***
9941167-A-T 10103558-A-T ***
18806044-CTTT-C,CT 16694164-CTTT-C,CT 19×T***
16320394-C-CA 14208514-C-CA 10×A***
6674465-ATT-A,AT 6806424-ATT-A,AT 16×T***
16199737-C-A 14087857-C-A ***
19204005-C-A 17092125-C-A ***
10982227-TCCATTCC-T ***
19337633-CTT-C,CT 17225753-CTT-C,CT 22×T***
12555747-TAA-T 12×A***
10828077-C-A ***
13447142-CATTCCATTCCATTCT-C,CATTCCATTCTATTCT 11291466-CATTCCATTCCATTCT-C,CATTCCATTCTATTCT ***
21134925-A-AT 18973039-A-AT 22×T***
10911757-G-T ***
13601058-TTA-T 11445382-TTA-T ***
25733063-G-T 23586916-G-T P1_b3 ***
13487704-G-C 11332028-G-C ***
13485860-G-T 11330184-G-T ***
13484066-G-T 11328390-G-T ***
10658581-C-T ***
13468270-A-G 11312594-A-G ***
13468259-T-C 11312583-T-C ***
13468250-A-G 11312574-A-G ***
3695724-C-CA 3827683-C-CA 14×A***
13468247-C-T 11312571-C-T ***
18147509-CTT-C 16035629-CTT-C 28×T***
58856006-C-T 56734865-G-A ***
58975062-A-T 56828915-A-T ***
16679134-A-G 14567254-A-G ***
13461020-T-A 11305344-T-A ***
4067508-CTT-C 4199467-CTT-C 29×T***
4896649-CAA-C 5028608-CAA-C 16×A***
58974991-G-A,C 56828844-G-A,C ***
24485745-A-T 22339598-A-T ***
14363185-G-T 12242480-G-T ***
14926462-CAA-C 12814527-CAA-C 26×A***
19121920-CTT-C 17010040-CTT-C 17×T***
10654591-T-C ***
13688268-A-T 11532592-A-T ***
10842025-G-T ***
28787962-G-A 26641815-G-A BY209176 ***
14315408-ATTT-A,ATT 12194702-ATTT-A,ATT 16×T***
3111157-C-A 3243116-C-A ***
23415308-GTATG-G,GTATA 21253422-GTATG-G,GTATA ***
13996118-C-A 11875412-C-A ***
2835607-CTTT-C 2967566-CTTT-C 16×T***
2810386-TTTTG-G,TTTTT 2942345-TTTTG-G,TTTTT ***
10866066-C-A ***
10866070-T-C ***
10866074-T-C FT434679 ***
10866099-C-T ***
28787949-A-G 26641802-A-G ***
8453324-AG-A 8585283-AG-A 8×G***
16250624-GTTTTT-G 14138744-GTTTTT-G 28×T***
28788008-G-A 26641861-G-A ***
10866100-T-A ***
21992963-TAAAAA-T 19831077-TAAAAA-T 23×A***
11677473-G-A ***
2702987-GT-G 2834946-GT-G 10×T***
10866121-C-A ***
13453371-T-A 11297695-T-A ***
10866122-C-A ***
10693740-ATTCAATTCCT-A ***
22536983-TAAA-T 20375097-TAAA-T 16×A***
20104255-GGGA-G 17992375-GGGA-G P5_Dst ***
13461034-A-C,T 11305358-A-C,T ***
28787980-A-ATTGCC 26641833-A-ATTGCC ***

In the table above, the meaning of the confidence field depends on whether the data comes from an FTDNA kit or an FGC kit. For FTDNA kits, + implies a "PASS" result with just one possible variant, * indicates a "PASS" but with multiple variants, ** indicates "REJECTED" with just a single variant, and *** indicates "REJECTED" with multiple possible variants. 'A*' are heterozygous variants not called by FTDNA, but still pulled from the VCF file. For FGC kits, + indicates over 99% likely genuine (95% for INDELs); * over 95% likely genuine (90% for INDELs); ** about 40% likely genuine; *** about 10% likely genuine. Manual entries read directly from a BAM file will be either + indicating positive, or * indicating that the data show a mixture of possible variants.

For the FTDNA kits, the BED data is encoded in the background color of the cells. Those cells with a white background have coverage, those with a grey background indicate no coverage in the BED file, and those with a pink background indicate the mutation is on the edge of a coverage region. These pink regions often indicate that the individual may be positive for a SNP even if there is no corresponding entry in the vcf file.

The combBED column indicates whether or not the mutation is a SNP and falls in the combBED region defined in Defining a New Rate Constant for Y-Chromosome SNPs based on Full Sequencing Data by Dmitry Adamov, Vladimir Guryanov, Sergey Karzhavin, Vladimir Tagankin, Vadim Urasin.

The McDonald BED column indicates whether or not the mutation is a SNP and falls in the BED region used by Dr. Iain McDonald in the age analysis he does for R-U106 men.

Age Analysis Information (work in progress)

AllMcDonaldYFull
Kit: 557529980320079621177844091
Kit: 5575291496775893726898312400
Used in age calculations1496775893726898312400
Counts of SNPs4341
Variant counts last updated 2022-07-30 03:29:52.



Big Tree Main Page