Tree Position

R-U106/S21 > Z2265 > Z381/S263 > Z301/S499 > L48 > Z9 > Z30/S271 > Z349 > Z2 > Z7 > FGC910 > CTS10893 > ZZ59 > A294 > Y10790 > Exact position not yet finalized.

Unique Mutations

The mutations unique to this man are summarized in the table below. Those with a '+' or '*' confidence level are considered by FamilyTreeDNA or FullGenomesCorp to be high quality SNPs/INDELs. For completeness, all other mutations of lesser confidence are included as well. These additional mutations may be useful for distinguishing between very closely related men.

Occasionally, some of the mutations listed here will be thought to be shared with other men in which case they might appear in upstream blocks on the tree. When this happens, the 'Blocks' field will indicate what block they appear in. Such a situation might arise with BigY men if the BED data suggests another man may be positive for a SNP, even though it doesn't appear in his VCF data. It might also happen if Chromo2 testing or Sanger sequencing of other men not on the tree show the SNP to be shared.

POS-REF-ALT (hg19) POS-REF-ALT (hg38) Blocks Names Region McDonald BED combBED STRFTDNA
B144284
BigY2
B144284
19576291-T-G 17464411-T-G P5_Prx Y***A*
26171289-A-C 24025142-A-C P1_Y1 ***A*
24336655-T-G 22190508-T-G P3_t1 ***A*
6180852-G-A 6312811-G-A IR3_Dst ***A*
6105902-C-CA 6237861-C-CA 8×A***A*
12076-C-G +
17234567-T-C 15122687-T-C Y98545 YY++
17528190-GT-G 15416310-GT-G ++
17659175-T-A 15547295-T-A Y99841 YY++
17667594-C-T 15555714-C-T Y99870 YY++
17780367-C-T 15668487-C-T Y100201 YY++
18615142-G-A 16503262-G-A Y102233 YY++
19381936-A-G 17270056-A-G Y104565 YY++
19390842-C-T 17278962-C-T Y104590 Y++
19515714-G-A 17403834-G-A Y105016 YY++
6210547-AC-A 6342506-AC-A IR3_Dst +
15898030-A-G 13786150-A-G Y95065 YY++
22030050-A-T 19868164-A-T Y108188 YY+
22104022-A-T 19942136-A-T Y108397 YY+**
22299820-A-T 20137934-A-T BY216811 DYZ19 ++
22473100-C-T 20311214-C-T FT71959BY174785 DYZ19 ++
22819745-G-A 20657859-G-A Y109870 YY++
22978390-TAAAC-T 20816504-TAAAC-T ++
23151309-G-A 20989423-G-A Y110814 YY++
23496333-G-A 21334447-G-A PR7374 Y111707 YY++
28799284-C-A 26653137-C-A Y113513 ++
22030049-AA-T 19868163-AA-T +
16796758-A-G 14684878-A-G Y97328 YY++
23582651-A-G 21420765-A-G Y111959 YY++
15715117-A-T 13603237-A-T Y94537 YY++
9163284-T-A 9325675-T-A Y88756 ++
7661273-T-C 7793232-T-C Y84596 YY++
6738788-C-G 6870747-C-G Y82430 YY++
4770131-A-G 4902090-A-G BY58307 ++
15313678-A-G 13201783-A-G BY100763 YY++
22230781-C-T 20068895-C-T DYZ19 ****
14497373-TT-T,TG 12385578-TT-T,TG *
22304224-C-G 20142338-C-G DYZ19 ****
22237812-A-T 20075926-A-T DYZ19 ****
15317478-G-T 13205584-G-T **
15376395-C-A 13264515-C-A **
15380410-G-T 13268530-G-T **
15395030-G-T 13283150-G-T **
15400215-T-A 13288335-T-A **
15648847-A-C 13536967-A-C **
15468404-C-A 13356524-C-A **
15619396-C-A 13507516-C-A **
15623444-C-T 13511564-C-T **
15187735-T-G 13075821-T-G **
15717804-C-A 13605924-C-A **
15745781-A-C 13633901-A-C **
15745863-C-A 13633983-C-A **
15749282-A-G 13637402-A-G **
15216515-T-C 13104601-T-C **
15103491-C-A 12991579-C-A **
15187649-G-T 13075735-G-T **
14794409-A-T 12682480-A-T **
14598966-A-C 12487166-A-C **
14622800-C-A 12510998-C-A **
14660442-A-T 12548507-A-T **
14716999-G-T 12605067-G-T **
14720446-C-A 12608514-C-A **
14727319-A-C 12615387-A-C 23×T**
18299545-T-TTATGC 16187665-T-TTATGC P6_Prx **
15178979-C-A 13067065-C-A **
14823758-C-A 12711825-C-A **
14908452-C-A 12796519-C-A **
15049873-G-A 12937964-G-A **
15092326-C-A 12980415-C-A **
15842918-C-A 13731038-C-A **
15120733-C-A 13008820-C-A **
15140856-G-T 13028943-G-T **
15776903-C-A 13665023-C-A FT201645 **
15988001-T-G 13876121-T-G **
15918560-C-A 13806680-C-A **
16926194-T-C 14814314-T-C **
17929085-A-C 15817205-A-C **
17854355-T-C 15742475-T-C **
17850145-C-A 15738265-C-A **
16912539-T-A 14800659-T-A **
17831112-C-A 15719232-C-A **
17756717-A-T 15644837-A-T **
17636443-A-T 15524563-A-T **
18101905-CA-C 15990025-CA-C **
17465001-G-T 15353121-G-T **
17318307-C-A 15206427-C-A **
17210875-T-C 15098995-T-C **
17085749-A-T 14973869-A-T **
17081219-C-CTATA 14969339-C-CTATA 14×TA**
17002677-C-A 14890797-C-A **
18059800-C-A 15947920-C-A **
18186451-T-C 16074571-T-C **
15926855-T-G 13814975-T-G **
16355092-CCA-C 14243212-CCA-C **
15963965-C-CTT 13852085-C-CTT 9×T**
15987967-T-G 13876087-T-G **
16050438-T-A 13938558-T-A **
16070014-T-A 13958134-T-A **
16115499-T-A 14003619-T-A P8_Prx **
16147490-A-G 14035610-A-G P8_Dst **
16425630-A-C 14313750-A-C **
14588970-T-G 12477170-T-G **
16624530-C-A 14512650-C-A **
16700300-C-A 14588420-C-A Y97065 **
18261792-A-T 16149912-A-T **
16703409-C-A 14591529-C-A **
16848454-A-C 14736574-A-C **
18196237-G-T 16084357-G-T **
18195975-C-A 16084095-C-A **
14589184-T-G 12477384-T-G **
13935054-C-A 11814348-C-A **
14558297-C-A 12446498-C-A **
13522884-C-A 11367208-C-A **
13405037-T-A 11249361-T-A **
13469037-C-A 11313361-C-A **
13505461-C-A 11349785-C-A **
13509258-C-A 11353582-C-A **
13514663-G-T 11358987-G-T **
13522860-C-A 11367184-C-A **
13533209-C-A 11377533-C-A **
13323519-T-TAAA 11167843-T-TAAA **
13539232-C-A 11383556-C-A **
13574792-T-C 11419116-T-C **
13592058-C-A 11436382-C-A **
13594435-C-A 11438759-C-A **
13626563-C-A 11470887-C-A **
13638016-A-T 11482340-A-T **
13698545-A-T 11542869-A-T **
13326970-A-T 11171294-A-T **
13318020-C-A 11162344-C-A **
13714484-T-A 11558808-T-A **
13223579-G-A 11067903-G-A **
11013212-C-G **
11014434-T-A **
11018245-T-G **
11037085-C-CTCGAT **
13205331-T-G 11049655-T-G **
13212817-C-A 11057141-C-A **
13227861-A-T 11072185-A-T **
13311041-C-A 11155365-C-A **
13245383-G-A 11089707-G-A FT441764 **
13253520-C-G 11097844-C-G **
13257465-C-A 11101789-C-A **
13271587-G-C 11115911-G-C **
13271592-C-A 11115916-C-A **
13297635-C-T 11141959-C-T **
13308616-T-A 11152940-T-A **
13713434-A-G 11557758-A-G **
13723048-A-T 11567372-A-T **
14546732-C-A 12434933-C-A **
14283367-A-G 12162661-A-G FT201428 **
13973219-C-A 11852513-C-A **
13997771-CTTTTT-C 11877065-CTTTTT-C 17×T**
14069056-G-T 11948350-G-T **
14198339-C-T 12077633-C-T **
14255152-C-A 12134446-C-A **
14279740-T-G 12159034-T-G **
14296917-C-A 12176211-C-A FT201430 **
13920211-C-A 11799505-C-A **
14383798-G-T 12263094-G-T **
14412902-A-C 12292199-A-C **
14450341-T-A 12329614-T-A **
12370823-C-A **
14510003-C-A 12398208-C-A **
14523979-T-A 12412180-T-A **
14524090-C-A 12412291-C-A **
18461727-C-A 16349847-C-A P6_Dst **
13907205-A-C 11786499-A-C **
13723072-G-T 11567396-G-T **
11677214-A-C **
13723084-A-T 11567408-A-T **
11643696-A-C **
11646545-G-T **
11659046-G-T **
11663657-C-A **
11667144-C-A **
13846977-A-C 11726271-A-C **
13894312-T-G 11773606-T-G **
13859397-A-C 11738691-A-C **
13859399-G-C 11738693-G-C **
13859406-A-T 11738700-A-T **
13859408-T-TA 11738702-T-TA **
13881405-C-A 11760699-C-A **
13884876-C-CA 11764170-C-CA **
13892648-G-T 11771942-G-T **
18344355-AT-A 16232475-AT-A P6_Prx 4×TATT**
19436813-A-T 17324933-A-T **
18611696-C-A 16499816-C-A **
25956393-A-T 23810246-A-T P1_Y1 **
25296912-A-T 23150765-A-T P2_r1 **
25376438-T-A 23230291-T-A P2_r2 **
25521452-T-A 23375305-T-A P1_gr1 **
25880107-T-A 23733960-T-A P1_Y1 **
25956370-A-C 23810223-A-C P1_Y1 **
25956383-A-T 23810236-A-T P1_Y1 **
25956394-A-T 23810247-A-T P1_Y1 **
25296884-A-T 23150737-A-T P2_r1 **
25956402-A-T 23810255-A-T P1_Y1 **
25956408-A-T 23810261-A-T P1_Y1 **
25956418-A-T 23810271-A-T P1_Y1 **
25956423-A-T 23810276-A-T P1_Y1 **
25995528-A-C 23849381-A-C P1_Y1 **
25995542-A-C 23849395-A-C P1_Y1 **
26115850-A-T 23969703-A-T P1_Y1 **
25296899-A-T 23150752-A-T P2_r1 **
25296870-A-T 23150723-A-T P2_r1 **
26254100-A-T 24107953-A-T P1_Y1 **
23715768-T-A 21553882-T-A **
23202783-G-T 21040897-G-T **
23447584-C-A 21285698-C-A **
23475517-C-A 21313631-C-A **
23715749-C-A 21553863-C-A **
23715760-T-A 21553874-T-A **
23715766-G-T 21553880-G-T **
23715784-C-A 21553898-C-A **
24637311-CGT-C 22491164-CGT-C P3_t2 **
23790223-C-A 21628337-C-A **
23817954-C-A 21656068-C-A **
23838594-G-T 21676708-G-T **
23848227-G-T 21686341-G-T **
21751050-T-G **
24070716-C-T 21924569-C-T P3_b1 **
24264644-C-A 22118497-C-A P3_b1 **
26248791-G-T 24102644-G-T P1_Y1 **
26421445-C-A 24275298-C-A P1_Y1 **
23185822-C-A 21023936-C-A **
56835408-T-G **
28743101-A-C 26596954-A-C **
28773021-T-A 26626874-T-A **
28808580-T-C 26662433-T-C **
28808592-G-T 26662445-G-T **
56827339-T-G **
56830079-A-C **
56838452-C-A **
28533706-T-A 26387559-T-A **
56838459-A-T **
56838498-A-C **
56838925-C-A **
56840887-G-T **
56850861-A-G **
56850873-G-C **
56850948-C-A **
28614058-G-T 26467911-G-T **
28532093-C-A 26385946-C-A **
26428102-C-A 24281955-C-A P1_Y1 **
28046824-A-T 25900677-A-T P1_Y2 **
26465477-C-A 24319330-C-A P1_Y1 **
27424099-G-T 25277952-G-T P1_g3 **
27466747-G-T 25320600-G-T P1_Y2 **
27732476-A-AT 25586329-A-AT P1_Y2 **
27991685-T-A 25845538-T-A P1_Y2 **
28046816-C-A 25900669-C-A P1_Y2 **
28046838-A-T 25900691-A-T P1_Y2 **
28532082-C-A 26385935-C-A **
28046853-A-T 25900706-A-T P1_Y2 **
28234495-T-C 26088348-T-C P1_b4 **
28461999-A-G 26315852-A-G **
28483046-C-A 26336899-C-A **
28499381-C-A 26353234-C-A **
28504586-C-A 26358439-C-A **
28530902-A-C 26384755-A-C **
23198200-C-A 21036314-C-A **
23058603-C-A 20896717-C-A **
18630751-C-A 16518871-C-A **
19809471-G-T 17697591-G-T P5_Prx **
19479215-A-T 17367335-A-T **
19532609-C-A 17420729-C-A **
19673291-C-A 17561411-C-A P5_Prx **
19673296-T-A 17561416-T-A P5_Prx **
19673315-T-G 17561435-T-G P5_Prx **
19763333-C-A 17651453-C-A P5_Prx **
19857623-G-T 17745743-G-T P5_Prx **
19436830-A-T 17324950-A-T **
19857687-G-T 17745807-G-T P5_Prx **
19922782-T-A 17810902-T-A P5_Prx **
19948111-T-A 17836231-T-A P5_Prx 4×TTCC**
19948131-C-A 17836251-C-A P5_Prx **
19948133-C-T 17836253-C-T P5_Prx **
19963748-T-A 17851868-T-A P5_Prx **
20405661-T-A 18243775-T-A P5_Dst **
19479207-A-C 17367327-A-C **
11003722-C-T **
20439857-G-T 18277971-G-T P5_Dst **
18850396-A-T 16738516-A-T **
18707882-C-A 16596002-C-A **
18710231-T-A 16598351-T-A **
18767391-G-T 16655511-G-T **
18779225-A-C 16667345-A-C **
18800473-A-C 16688593-A-C **
18810773-C-A 16698893-C-A **
18902064-T-A 16790184-T-A **
19436808-A-T 17324928-A-T **
18966225-C-A 16854345-C-A **
19053457-C-A 16941577-C-A **
19138730-C-A 17026850-C-A **
19200940-CAGAGAG-C 17089060-CAGAGAG-C 10×AG**
19246929-C-A 17135049-C-A **
19251356-T-A 17139476-T-A **
19412680-A-C 17300800-A-C **
20438701-C-G 18276815-C-G P5_Dst **
20640996-A-T 18479110-A-T P4_Prx **
23041246-A-T 20879360-A-T **
22027809-C-A 19865923-C-A **
21803362-G-T 19641476-G-T **
21919404-C-A 19757518-C-A 16×T**
21920610-C-A 19758724-C-A FT229633 **
21998202-T-G 19836316-T-G **
21998208-A-C 19836322-A-C **
22011433-C-A 19849547-C-A **
22204379-C-A 20042493-C-A **
21677362-C-A 19515476-C-A **
22204510-C-A 20042624-C-A **
22211472-A-T 20049586-A-T **
22211487-G-T 20049601-G-T **
22218803-T-A 20056917-T-A DYZ19 **
22546988-G-T 20385102-G-T **
22881303-C-A 20719417-C-A **
23009121-C-A 20847235-C-A **
21700614-A-T 19538728-A-T **
21602768-T-G 19440882-T-G **
20641039-C-A 18479153-C-A P4_Prx **
21033044-T-G 18871158-T-G **
20641057-C-A 18479171-C-A P4_Prx **
20641064-A-T 18479178-A-T P4_Prx **
20689841-G-T 18527955-G-T P4_Prx **
20711545-T-G 18549659-T-G P4_Prx **
20848061-T-TGG 18686175-T-TGG P4_Dst **
20970354-A-AAT 18808468-A-AAT P4_Dst **
21108729-G-T 18946843-G-T **
21540888-T-A 19379002-T-A **
21139537-C-T 18977651-C-T **
21151922-C-A 18990036-C-A **
21315261-T-A 19153375-T-A **
21387078-G-GT 19225192-G-GT 8×T**
21448212-T-G 19286326-T-G **
21488843-C-A 19326957-C-A **
21488933-C-A 19327047-C-A **
11007472-C-A **
23029071-T-A 20867185-T-A CTS11237 **
11003718-C-G **
3759329-G-T 3891288-G-T **
3532850-T-G 3664809-T-G **
3560189-T-A 3692148-T-A **
3560998-C-A 3692957-C-A **
3625916-C-A 3757875-C-A **
3705236-T-A 3837195-T-A **
3739004-G-T 3870963-G-T **
3837472-C-A 3969431-C-A **
3329248-C-A 3461207-C-A **
3849320-T-G 3981279-T-G **
3974912-G-T 4106871-G-T **
3974986-G-T 4106945-G-T **
3995454-A-T 4127413-A-T **
3996915-G-T 4128874-G-T **
4048010-C-A 4179969-C-A **
3359496-A-C 3491455-A-C **
3243079-A-G 3375038-A-G **
4077773-A-G 4209732-A-G FT200419 **
10888021-C-T **
10844149-T-A **
14580995-C-A 12469195-C-A **
28688429-C-A 26542282-C-A **
10887997-C-G **
10888003-A-C **
10888007-C-T **
10888027-C-G **
3116586-A-T 3248545-A-T **
2729690-C-A 2861649-C-A **
2770704-G-C 2902663-G-C **
2947578-G-T 3079537-G-T **
2948322-C-A 3080281-C-A **
3079526-C-A 3211485-C-A **
3089473-C-A 3221432-C-A **
4048062-C-A 4180021-C-A **
4094309-C-A 4226268-C-A **
20774943-A-C 18613057-A-C P4_Prx **
5592214-A-T 5724173-A-T **
5184191-A-C 5316150-A-C **
5205328-A-T 5337287-A-T **
5264330-G-T 5396289-G-T **
5340777-G-T 5472736-G-T **
5365530-T-G 5497489-T-G **
10996866-C-T **
5592229-C-G 5724188-C-G **
4949672-G-A 5081631-G-A **
5592255-A-T 5724214-A-T **
5602630-C-A 5734589-C-A **
5603500-C-A 5735459-C-A **
5627557-A-C 5759516-A-C **
5688401-C-A 5820360-C-A **
5759500-G-T 5891459-G-T **
5054200-G-T 5186159-G-T **
4900392-A-T 5032351-A-T **
4192658-A-C 4324617-A-C **
4301832-A-C 4433791-A-C **
4208208-C-A 4340167-C-A **
4208252-A-T 4340211-A-T **
4208267-A-T 4340226-A-T **
4241963-G-T 4373922-G-T **
4245025-C-A 4376984-C-A FT129784 **
4256780-C-A 4388739-C-A **
4375417-CTTTT-C 4507376-CTTTT-C 22×T**
4898124-A-G 5030083-A-G **
4467819-C-G 4599778-C-G FTA44130 **
4537793-C-A 4669752-C-A **
4720979-C-G 4852938-C-G **
4730961-AT-A 4862920-AT-A **
4783374-G-T 4915333-G-T **
4863324-G-T 4995283-G-T **
4874278-T-A 5006237-T-A **
22345997-C-TGG 20184111-C-TGG DYZ19 **
18186144-C-A 16074264-C-A **
5791459-T-C 5923418-T-C FT200762 **
28567333-A-T 26421186-A-T 13×T**
10825295-C-G **
10688157-C-A **
5292178-C-A 5424137-C-A **
11033892-A-T **
10942649-C-A **
10988537-TTTTATTCCACTCC-T **
10992908-C-A **
19088088-C-A 16976208-C-A **
16938218-C-A 14826338-C-A 19×T**
14352790-C-A 12232085-C-A **
10887994-C-A **
56858082-G-A **
13856963-C-A 11736257-C-A **
6465469-C-A 6597428-C-A **
23152726-C-A 20990840-C-A **
19853797-T-A 17741917-T-A P5_Prx **
10892554-A-G **
6765641-T-G 6897600-T-G **
18338332-ATG-A 16226452-ATG-A P6_Prx **
14451330-G-A 12330603-G-A CTS2732 Z2758 ****
59004300-T-TAAA 56858153-T-TAAA 9×A**
3732733-C-A 3864692-C-A **
4764839-GTA-G 4896798-GTA-G **
9416730-TG-T 9579121-TG-T **
23225658-C-A 21063772-C-A PF5836 ****
56839426-T-C **
19948119-C-A 17836239-C-A P5_Prx **
19948123-C-A 17836243-C-A P5_Prx **
13695477-A-T 11539801-A-T **
7239603-C-A 7371562-C-A **
56839388-C-G **
56839392-T-C **
10825301-A-T **
10996877-C-T **
10887941-C-CCTTTG **
10992975-A-G **
26428085-C-A 24281938-C-A P1_Y1 **
28623434-C-A 26477287-C-A **
14328300-C-A 12207594-C-A **
8799682-C-A 8931641-C-A **
10892569-A-AC **
10892572-C-CACT **
11013228-C-T FT97412 **
14598963-A-C 12487163-A-C **
11013244-A-T **
21821464-C-A 19659578-C-A **
3347697-C-A 3479656-C-A **
14398218-C-A 12277514-C-A **
11001442-C-A **
11001466-G-C **
10819927-T-G **
10941651-C-A **
10996893-A-T **
7451222-C-A 7583181-C-A IR1_L **
10996912-C-A **
10996924-C-T **
10996933-T-C **
10996947-G-C **
10996950-GT-G **
19211625-C-A 17099745-C-A **
17714012-C-A 15602132-C-A FT181186 **
16572757-C-A 14460877-C-A **
10851978-C-A **
10988505-C-T **
13698538-G-T 11542862-G-T **
3374111-G-T 3506070-G-T **
10988585-T-A **
19436835-A-T 17324955-A-T **
13457712-T-C 11302036-T-C **
5768570-A-T 5900529-A-T **
5455209-A-T 5587168-A-T **
5791475-T-C 5923434-T-C **
10659221-ATTCCT-A **
10797945-T-A **
10797926-A-G **
10797892-T-C **
10797237-C-A **
10780153-C-A **
10761182-C-T **
10761167-C-T **
10753907-TCCAGA-T **
10693744-AATTCCT-A **
10693742-T-TA **
10691988-C-A **
10691442-C-A **
10687888-T-C FT91574 **
10677006-C-CA **
10652982-T-G **
10822081-C-A **
10024990-G-T 10187381-G-T **
10001058-CTTTT-C 10163449-CTTTT-C 16×T**
9973438-C-A 10135829-C-A **
9908462-C-A 10070853-C-A **
9540150-T-G 9702541-T-G IR3_Prx **
5868224-C-A 6000183-C-A **
9514268-T-G 9676659-T-G **
9513880-A-T 9676271-A-T **
9471713-T-A 9634104-T-A **
9386143-G-T 9548534-G-T **
9373571-C-A 9535962-C-A **
9063617-C-A 9226008-C-A **
9040779-T-C 9203170-T-C **
8987054-C-A 9149445-C-A **
10808823-T-C **
10825295-C-CA **
8799724-C-A 8931683-C-A **
10940381-C-CATTAA **
10995391-C-A **
10994228-T-A **
10992985-A-ATACTG **
10987092-TATTCC-T **
10986641-C-A **
10978127-A-T **
10978114-A-T **
10978101-A-T **
10977215-C-T **
10964383-A-T **
10962917-C-G **
23029118-T-A 20867232-T-A CTS11238 **
10940550-ACATTC-A **
10940418-C-G **
10932935-C-A **
10825297-T-TTAAA **
10924615-C-A **
10919552-A-T **
10919208-T-C **
10917162-C-A **
10879356-C-A **
10851965-C-T **
10851936-T-G **
10849253-C-T **
10849241-T-C **
10849240-C-T **
10849213-T-A **
10845676-C-CAGTAT **
10844155-C-T **
10844152-C-T **
9056524-G-T **
9514304-A-T 9676695-A-T **
10956747-C-A **
7085579-A-C 7217538-A-C **
6911451-A-T 7043410-A-T **
6996823-A-C 7128782-A-C **
7017113-T-A 7149072-T-A **
7028614-G-A 7160573-G-A **
7044916-G-T 7176875-G-T Y83209 **
7080858-C-A 7212817-C-A **
7110441-T-A 7242400-T-A **
6806845-T-G 6938804-T-G **
7132709-C-A 7264668-C-A **
7149619-C-A 7281578-C-A **
7156081-T-A 7288040-T-A **
7163136-C-A 7295095-C-A **
7209178-C-A 7341137-C-A **
7214436-C-T 7346395-C-T **
6833278-C-A 6965237-C-A **
6791143-C-A 6923102-C-A **
7390194-A-C 7522153-A-C **
6346099-TA-T 6478058-TA-T **
5923728-A-T 6055687-A-T **
5923730-G-C 6055689-G-C **
5967284-C-A 6099243-C-A **
6092200-C-A 6224159-C-A **
6134758-T-C 6266717-T-C **
6191324-C-A 6323283-C-A IR3_Dst **
6347618-G-T 6479577-G-T **
6787007-C-A 6918966-C-A **
6585088-C-A 6717047-C-A **
6596177-A-C 6728136-A-C **
6709218-C-A 6841177-C-A **
6714613-C-A 6846572-C-A **
6765821-T-G 6897780-T-G **
6776122-A-T 6908081-A-T **
7336918-T-G 7468877-T-G BY64644 **
7094594-G-T 7226553-G-T **
7390251-T-A 7522210-T-A **
7590603-C-A 7722562-C-A **
8720364-T-C 8852323-T-C **
8710173-C-A 8842132-C-A **
8371655-T-A 8503614-T-A **
8333626-A-ACAC 8465585-A-ACAC 25×CTT**
8296890-C-A 8428849-C-A **
8140472-C-A 8272431-C-A **
7390272-T-A 7522231-T-A **
8110679-C-A 8242638-C-A **
8085394-G-T 8217353-G-T **
8061842-T-TA 8193801-T-TA **
7897642-G-T 8029601-G-T **
8140340-G-T 8272299-G-T **
7580111-A-C 7712070-A-C **
7448007-T-A 7579966-T-A IR1_L **
7451227-C-A 7583186-C-A IR1_L **
7422725-C-A 7554684-C-A **
7428090-C-A 7560049-C-A **
7409524-T-C 7541483-T-C **
7433904-C-A 7565863-C-A **
9300160-ACACACACACACC-A 9462551-ACACACACACACC-A ***
13355233-T-C 11199557-T-C ***
58985501-A-C 56839354-A-C ***
9117211-C-A 9279602-C-A ***
13485654-T-G 11329978-T-G ***
9063859-CT-C,CTT 9226250-CT-C,CTT 16×T***
28557630-A-G 26411483-A-G CTS12278 ***
13317456-C-G 11161780-C-G ***
19811649-CAAAAAAAAA-C 17699769-CAAAAAAAAA-C P5_Prx 22×A***
17193269-G-GTA 15081389-G-GTA ***
2903232-CTCCTTCCTTCCT-C,CTCCT 3035191-CTCCTTCCTTCCT-C,CTCCT 18×TCCT***
17426286-C-A 15314406-C-A ***
28784744-A-T 26638597-A-T ***
11011826-GCTCCA-G ***
19763364-GA-G 17651484-GA-G P5_Prx 15×A***
3148252-C-T 3280211-C-T ***
22364354-T-C 20202468-T-C DYZ19 ***
10763302-A-ACCA,T ***
13404760-G-A 11249084-G-A ***
26771900-G-T 24625753-G-T P1_g2 ***
19826844-AG-A 17714964-AG-A P5_Prx ***
9735427-A-T 9897818-A-T IR3_Prx ***
23188664-C-A 21026778-C-A ***
7717631-TTCCC-T 7849590-TTCCC-T 7×TCCC***
10677355-C-A ***
10776514-T-A ***
4778529-C-A 4910488-C-A ***
18908086-G-T 16796206-G-T ***
13450411-CTCCATTCCATTCCATTCTATTCCATTCCATTCCAT-C,CTCCATTCCATTCCATTCCATTCCATTCCATTCCAT 11294735-CTCCATTCCATTCCATTCTATTCCATTCCATTCCAT-C,CTCCATTCCATTCCATTCCATTCCATTCCATTCCAT ***
7146776-G-GT,GTTT 7278735-G-GT,GTTT 18×T***
9735423-A-G 9897814-A-G IR3_Prx ***
22241531-C-T 20079645-C-T DYZ19 ***
9735422-A-G 9897813-A-G IR3_Prx ***
14794293-G-T 12682364-G-T ***
10814930-C-A ***
13859261-C-A 11738555-C-A ***
10785283-C-CAGAAG ***
9342211-C-T 9504602-C-T ***
9177433-G-T 9339824-G-T ***
14588854-G-T 12477054-G-T ***
26664376-T-C 24518229-T-C P1_g2 ***
14570756-ATTT-A,ATTTTT 12458956-ATTT-A,ATTTTT 22×T***

In the table above, the meaning of the confidence field depends on whether the data comes from an FTDNA kit or an FGC kit. For FTDNA kits, + implies a "PASS" result with just one possible variant, * indicates a "PASS" but with multiple variants, ** indicates "REJECTED" with just a single variant, and *** indicates "REJECTED" with multiple possible variants. 'A*' are heterozygous variants not called by FTDNA, but still pulled from the VCF file. For FGC kits, + indicates over 99% likely genuine (95% for INDELs); * over 95% likely genuine (90% for INDELs); ** about 40% likely genuine; *** about 10% likely genuine. Manual entries read directly from a BAM file will be either + indicating positive, or * indicating that the data show a mixture of possible variants.

For the FTDNA kits, the BED data is encoded in the background color of the cells. Those cells with a white background have coverage, those with a grey background indicate no coverage in the BED file, and those with a pink background indicate the mutation is on the edge of a coverage region. These pink regions often indicate that the individual may be positive for a SNP even if there is no corresponding entry in the vcf file.

The combBED column indicates whether or not the mutation is a SNP and falls in the combBED region defined in Defining a New Rate Constant for Y-Chromosome SNPs based on Full Sequencing Data by Dmitry Adamov, Vladimir Guryanov, Sergey Karzhavin, Vladimir Tagankin, Vadim Urasin.

The McDonald BED column indicates whether or not the mutation is a SNP and falls in the BED region used by Dr. Iain McDonald in the age analysis he does for R-U106 men.

Age Analysis Information (work in progress)

AllMcDonaldYFull
Kit: B1442841079957979150768017476
Kit: B144284993839080899597954899
Used in age calculations1079957980899598017476
Counts of SNPs2119
Variant counts last updated 2021-09-26 03:56:37.



Big Tree Main Page