Tree Position

R-P312/S116 > Z40481 > ZZ11 > DF27/S250 > Z195/S355 > Z272 > S450 > Z295/S1217 > S25783 > CTS4065 > BY12171

Unique Mutations

The mutations unique to this man are summarized in the table below. Those with a '+' or '*' confidence level are considered by FamilyTreeDNA or FullGenomesCorp to be high quality SNPs/INDELs. For completeness, all other mutations of lesser confidence are included as well. These additional mutations may be useful for distinguishing between very closely related men.

Occasionally, some of the mutations listed here will be thought to be shared with other men in which case they might appear in upstream blocks on the tree. When this happens, the 'Blocks' field will indicate what block they appear in. Such a situation might arise with BigY men if the BED data suggests another man may be positive for a SNP, even though it doesn't appear in his VCF data. It might also happen if Chromo2 testing or Sanger sequencing of other men not on the tree show the SNP to be shared.

POS-REF-ALT (hg19) POS-REF-ALT (hg38) Blocks Names Region McDonald BED combBED STRFTDNA
B110977
BigY3
B110977
BigY2
B110977
18347449-A-G 16235569-A-G P6_Prx +A+
23977267-G-T 21831120-G-T YA+
3749954-C-G 3881913-C-G A+
23977268-G-GT 21831121-G-GT A+
28001350-A-AT 25855203-A-AT P1_Y2 A+
16099087-C-CTG 13987207-C-CTG P8_Prx 23×TGA*
26389033-T-G 24242886-T-G P1_Y1 ***A*
26067609-C-G 23921462-C-G P1_Y1 ***A*A*
25961026-C-CA 23814879-C-CA P1_Y1 ***A*
58978648-C-G 56832501-C-G A*
13449631-A-T 11293955-A-T A*
28816652-A-C 26670505-A-C A*
13449693-T-G 11294017-T-G A*
13449316-A-ATTCCTTTCCCTTCCC 11293640-A-ATTCCTTTCCCTTCCC A*
20693453-G-C 18531567-G-C P4_Prx ***A*A*
6348440-C-A 6480399-C-A ***A*A*
56832472-C-T A*
19927235-G-A 17815355-G-A P5_Prx ***A*A*
20252540-C-T 18090654-C-T P5_Dst A*
20313601-G-C 18151715-G-C P5_Dst A*
13687329-C-A 11531653-C-A A*
56836831-T-G A*
19876511-T-G 17764631-T-G P5_Prx A*A*
9574853-C-CA 9737244-C-CA IR3_Prx 12×AA*
22313902-C-T 20152016-C-T DYZ19 A*A*
56832492-C-T A*
13686968-A-T 11531292-A-T A*A*
28817885-T-C 26671738-T-C A*A*
19765809-C-CT 17653929-C-CT P5_Prx 22×TA*
17717583-C-T 15605703-C-T BY116899 YY+++
17554763-G-T 15442883-G-T BY115673 YY+++
21111464-A-G 18949578-A-G BY130477 YY+++
18940913-G-T 16829033-G-T BY124949 YY+++
17915810-T-C 15803930-T-C BY118408 YY+++
17477083-C-G 15365203-C-G BY115090 YY+++
2964110-TA-T 3096069-TA-T +
3840221-T-C 3972180-T-C FT93595 +
21071208-A-C 18909322-A-C BY130242 YY+++
21098221-C-T 18936335-C-T BY130397 YY+++
15881807-G-A 13769927-G-A FT94002 YY++**
3773997-G-A 3905956-G-A FT93584 +
24368065-C-A 22221918-C-A BY149388 +++
21763439-C-T 19601553-C-T BY156946 YY+++
28658634-G-A 26512487-G-A BY150863 Y+++
17097040-G-T 14985160-G-T FT1980 Y+**
4541223-T-A 4673182-T-A FT16598 +**
4501114-A-G 4633073-A-G FT16549 +**
7935702-G-A 8067661-G-A FT93891 YY+**
10021972-C-T 10184363-C-T FT38045 Y+**
10848838-A-G FT38046 +**
28189531-A-G 26043384-A-G P1_b4 +
22318304-T-A 20156418-T-A BY217344 DYZ19 ****+
24418373-A-T 22272226-A-T BY149735 Y+++
15501114-G-T 13389234-G-T BY102016 YY+++
23505756-A-G 21343870-A-G BY145828 YY+++
23330861-T-G 21168975-T-G YY+++
23241848-A-AT 21079962-A-AT **++
23154480-C-A 20992594-C-A BY143437 YY+++
22459153-G-A 20297267-G-A BY220254 DYZ19 ***++
15747433-C-A 13635553-C-A BY103798 YY+++
17426876-A-G 15314996-A-G FT94046 YY+**
15371230-C-T 13259350-C-T BY101157 YY+++
17001970-T-A 14890090-T-A FT23149 Y+
19413334-C-T 17301454-C-T Y35910 PR3120 FT72835 YY++**
5139685-A-G 5271644-A-G FT17236 +
5686902-T-A 5818861-T-A FT17896 +
9117544-G-A FT20232 +
13512475-T-A 11356799-T-A FT94217 +
16468797-T-C 14356917-T-C FT94019 Y+
18157449-G-T 16045569-G-T FT24117 Y+
2785853-C-T 2917812-C-T BY56411 YY+**+
22480382-A-G 20318496-A-G BY46161 DYZ19 +++
21247423-G-A 19085537-G-A Y+
18995237-A-T 16883357-A-T FGC41891PF5101 YY5×ATTT+**+
28472067-T-C 26325920-T-C FT31826 +
21750397-A-T FT26893 +
15129980-T-C 13018067-T-C BY99838 YY+++
5018820-C-T 5150779-C-T FT17101 +
2794520-C-G 2926479-C-G CTS188CTS188 YY+++
3406221-A-G 3538180-A-G BY57601 +++
3891896-G-A 4023855-G-A FT71486 +
13999003-A-G 11878297-A-G BY92180 YY+++
14508841-C-T 12397046-C-T BY96229 YY+++
4199086-G-A 4331045-G-A FT93644 +
6993798-A-T 7125757-A-T BY62780 YY+++
4499362-CT-C 4631321-CT-C +
4836850-G-A 4968809-G-A FT16903 +
9519226-G-T 9681617-G-T +
9377711-A-G 9540102-A-G BY78923 Y+++
4519949-C-A 4651908-C-A FT16572 +
8068939-C-G 8200898-C-G BY69708 YY+++
7674149-A-C 7806108-A-C BY66742 YY+++
7894217-C-T 8026176-C-T BY68565 YY+++
7849185-T-A 7981144-T-A BY68198 YY+++
13456597-G-GATTCC 11300921-G-GATTCC 6×ATTCC*******
17317720-TCA-T 15205840-TCA-T 23×CA*
56827952-TT-T,TC *
11022537-T-TCATTC *
58972817-GTCCA-G 56826670-GTCCA-G ****
8573727-T-TCA 8705686-T-TCA BY41583 10×CA*****
15060671-G-T 12948763-G-T **
10946586-G-A **
14680093-G-T 12568159-G-T **
14717449-G-T 12605517-G-T **
14717575-T-G 12605643-T-G **
14994154-T-G 12882239-T-G **
15412308-G-T 13300428-G-T **
15080774-A-C 12968864-A-C **
15100566-G-C 12988654-G-C **
15321327-TG-T 13209445-TG-T **
15221354-G-T 13109440-G-T **
14667900-A-T 12555966-A-T **
15491941-G-T 13380061-G-T 19×TA**
15221361-G-A 13109447-G-A **
15468551-C-A 13356671-C-A **
15173534-C-A 13061620-C-A **
14423921-T-G 12303196-T-G **
14620815-T-A 12509013-T-A **
14100233-A-C 11979527-A-C **
13951701-C-A 11830995-C-A **
13962939-G-T 11842233-G-T **
13998209-C-A 11877503-C-A **
14029331-A-T 11908625-A-T **
14074005-C-A 11953299-C-A **
14074229-T-G 11953523-T-G **
14086135-C-A 11965429-C-A **
14242018-A-C 12121312-A-C **
14608292-C-A 12496494-C-A **
14250613-C-A 12129907-C-A **
14361940-C-A 12241235-C-A **
15622416-T-C 13510536-T-C **
14488300-C-A 12367569-C-A **
14526850-G-A 12415051-G-A **
14528454-T-G 12416655-T-G **
14530831-C-A 12419032-C-A **
15617962-C-A 13506082-C-A **
15918449-C-A 13806569-C-A **
15732792-G-A 13620912-G-A **
17006315-C-A 14894435-C-A **
16617013-G-T 14505133-G-T **
16679404-ATTTTT-A 14567524-ATTTTT-A 18×T**
16720502-G-T 14608622-G-T **
16738422-G-T 14626542-G-T **
16738673-A-T 14626793-A-T **
16738692-A-C 14626812-A-C **
16869576-C-A 14757696-C-A **
17043000-T-G 14931120-T-G **
10935529-CTACAT-C **
17092896-A-G 14981016-A-G **
17146579-T-TA 15034699-T-TA 8×A**
17181678-G-T 15069798-G-T **
17217355-T-G 15105475-T-G **
17270562-C-A 15158682-C-A **
17373311-CG-C 15261431-CG-C **
17379772-G-A 15267892-G-A **
17379875-A-C 15267995-A-C **
16605547-C-A 14493667-C-A **
15734215-C-A 13622335-C-A **
15922972-C-A 13811092-C-A **
15743923-C-A 13632043-C-A FGC81921 **
15756507-A-C 13644627-A-C **
15774204-C-A 13662324-C-A **
15815224-C-A 13703344-C-A **
15834275-G-T 13722395-G-T **
15881845-G-C 13769965-G-C **
15921748-C-A 13809868-C-A **
15987990-C-A 13876110-C-A **
16605163-C-A 14493283-C-A **
16064620-C-A 13952740-C-A **
16279108-C-A 14167228-C-A **
16344658-C-A 14232778-C-A **
16410253-C-A 14298373-C-A **
16423718-C-A 14311838-C-A **
13951501-GTATA-G 11830795-GTATA-G 9×TA**
16553981-C-A 14442101-C-A **
16467363-T-C 14355483-T-C **
10950447-C-CATCT **
13884318-C-A 11763612-C-A **
11006100-T-C **
10988820-C-A **
10988888-T-C **
10992094-GTCCAC-G **
10993954-C-A **
11003271-G-C **
11006068-A-T **
11006072-C-G **
11010427-C-A **
10988809-C-CA **
11011696-C-A **
11015993-C-A **
11019202-T-A **
11024358-T-G **
17538303-C-T 15426423-C-T **
11025239-A-T **
11025247-C-T **
10988810-CA-C **
10988792-C-G **
11027566-C-A **
10961330-C-A **
10973997-C-T **
10972877-C-A **
10972124-C-A **
10974031-C-A **
10970952-C-A **
10965348-C-A **
10965347-C-A **
10976647-T-A **
10988784-C-T **
10976662-C-A **
10976680-T-C **
10982345-C-A **
10984200-C-A **
10950586-T-A **
10984510-GGC-G **
10984514-A-AC **
10986618-T-A **
11025282-C-CCATTA **
11033837-ACTCTG-A **
13857047-G-A 11736341-G-A **
13696453-T-G 11540777-T-G **
13592135-G-T 11436459-G-T **
13644092-A-G 11488416-A-G **
10949390-G-A **
13690255-C-A 11534579-C-A **
13695497-G-C 11539821-G-C **
13695542-A-T 11539866-A-T **
13696448-G-T 11540772-G-T **
13696459-A-G 11540783-A-G **
13493247-C-A 11337571-C-A **
13698628-G-T 11542952-G-T **
13710338-G-T 11554662-G-T **
13718545-G-T 11562869-G-T **
13720543-G-A 11564867-G-A **
11654473-C-A **
11662505-G-T **
11677221-G-A **
13854795-C-A 11734089-C-A **
13574616-G-T 11418940-G-T **
13484716-T-C 11329040-T-C **
11033850-CC-G **
13222663-G-C 11066987-G-C **
11034164-A-C **
11034414-C-A **
11034519-C-A **
13197982-C-A 11042306-C-A **
13217652-C-A 11061976-C-A **
13222654-G-T 11066978-G-T **
13222657-G-A 11066981-G-A **
13236682-C-A 11081006-C-A **
13484705-T-G 11329029-T-G **
13250305-G-T 11094629-G-T **
13252851-C-A 11097175-C-A **
13253875-C-A 11098199-C-A **
13299137-G-T 11143461-G-T **
13299503-C-A 11143827-C-A **
13453290-A-ATTCGG 11297614-A-ATTCGG **
13457666-C-A 11301990-C-A **
13457682-A-G 11302006-A-G **
11024607-C-A **
20733314-T-G 18571428-T-G P4_Prx **
17567541-A-C 15455661-A-C **
26152231-C-A 24006084-C-A P1_Y1 **
25967529-G-T 23821382-G-T P1_Y1 **
25967538-A-T 23821391-A-T P1_Y1 **
25967543-G-T 23821396-G-T P1_Y1 **
25967548-A-T 23821401-A-T P1_Y1 **
25985418-C-A 23839271-C-A P1_Y1 **
26046074-C-A 23899927-C-A P1_Y1 **
26146694-T-A 24000547-T-A P1_Y1 **
26421437-GCCT-G 24275290-GCCT-G P1_Y1 **
25883299-C-A 23737152-C-A P1_Y1 **
26421452-C-A 24275305-C-A P1_Y1 12×T**
26421545-C-A 24275398-C-A P1_Y1 **
27570940-G-T 25424793-G-T P1_Y2 **
27810360-G-T 25664213-G-T P1_Y2 **
27935829-G-T 25789682-G-T P1_Y2 **
28001446-C-A 25855299-C-A P1_Y2 **
28001455-A-T 25855308-A-T P1_Y2 **
28001496-G-T 25855349-G-T P1_Y2 **
25967503-G-T 23821356-G-T P1_Y1 **
25883296-G-T 23737149-G-T P1_Y1 **
28481054-C-A 26334907-C-A **
23188550-C-A 21026664-C-A **
22816314-T-C 20654428-T-C **
22816316-C-T 20654430-C-T **
22816319-C-T 20654433-C-T **
22816326-G-C 20654440-G-C **
22816330-GCAGTCCG-A 20654444-GCAGTCCG-A **
22836775-A-T 20674889-A-T **
22991134-C-A 20829248-C-A **
23564675-A-C 21402789-A-C **
25883288-G-T 23737141-G-T P1_Y1 **
23723612-T-G 21561726-T-G **
24259802-G-T 22113655-G-T P3_b1 **
24275842-A-T 22129695-A-T P3_b1 **
24275911-C-A 22129764-C-A P3_b1 **
24363759-T-G 22217612-T-G **
24878621-T-G 22732474-T-G g1 **
25883262-T-A 23737115-T-A P1_Y1 **
25883279-C-A 23737132-C-A P1_Y1 **
28480902-C-A 26334755-C-A **
28484343-C-A 26338196-C-A **
22816304-G-T 20654418-G-T **
10073766-T-C 10236157-T-C **
26098049-T-A 23951902-T-A P1_Y1 **
5784602-A-AT 5916561-A-AT 9×AT**
18846011-CAA-C 16734131-CAA-C 25×A**
22303554-C-A 20141668-C-A DYZ19 **
16627745-T-C 14515865-T-C **
3897226-G-C 4029185-G-C **
6233684-A-T 6365643-A-T IR3_Dst **
13276215-G-T 11120539-G-T **
36468-A-C **
13482961-A-G 11327285-A-G **
16503195-T-A 14391315-T-A **
19318178-CTTTTTTTT-C 17206298-CTTTTTTTT-C 28×T**
22303555-A-G 20141669-A-G DYZ19 **
24148197-G-A 22002050-G-A P3_b1 **
24164041-C-T 22017894-C-T P3_b1 **
24254153-C-A 22108006-C-A P3_b1 **
28683512-G-A 26537365-G-A **
14776923-C-CAA 12664992-C-CAA 15×A**
30388-T-C **
28508558-C-A 26362411-C-A **
28759592-C-A 26613445-C-A **
28580337-C-A 26434190-C-A **
28612196-C-A 26466049-C-A **
28612225-G-T 26466078-G-T **
28659861-A-G 26513714-A-G **
28676917-G-T 26530770-G-T **
28699880-C-A 26553733-C-A **
28708420-C-A 26562273-C-A **
28793038-G-T 26646891-G-T **
56866377-G-C **
28802763-G-T 26656616-G-T **
28804014-G-T 26657867-G-T **
28811870-C-G 26665723-C-G **
28818032-G-T 26671885-G-T **
28819278-A-C 26673131-A-C **
56734818-A-T **
56823993-G-T **
56835143-G-T **
22816309-G-A 20654423-G-A **
22816292-G-A 20654406-G-A **
17597811-A-G 15485931-A-G **
19582821-T-A 17470941-T-A P5_Prx **
19071327-C-A 16959447-C-A **
19213613-C-A 17101733-C-A **
19286267-C-A 17174387-C-A **
19479138-G-T 17367258-G-T **
19524533-C-A 17412653-C-A **
19582811-T-A 17470931-T-A P5_Prx **
19582817-T-A 17470937-T-A P5_Prx **
19582826-T-A 17470946-T-A P5_Prx **
19052158-G-A 16940278-G-A **
19582838-C-A 17470958-C-A P5_Prx **
19753402-T-A 17641522-T-A P5_Prx **
19753424-A-T 17641544-A-T P5_Prx **
19791349-C-A 17679469-C-A P5_Prx **
20379350-G-C 18217464-G-C P5_Dst **
20379353-A-T 18217467-A-T P5_Dst **
20379364-A-T 18217478-A-T P5_Dst **
20379367-A-T 18217481-A-T P5_Dst **
19055583-G-T 16943703-G-T **
19042572-A-T 16930692-A-T **
20459166-A-C 18297280-A-C P5_Dst **
18360246-C-A 16248366-C-A P6_Prx **
17782538-G-T 15670658-G-T **
17963688-T-TA 15851808-T-TA **
17963745-T-G 15851865-T-G **
18165599-C-A 16053719-C-A **
18201163-C-A 16089283-C-A **
18360217-T-A 16248337-T-A P6_Prx **
18360230-T-A 16248350-T-A P6_Prx **
18360254-C-A 16248374-C-A P6_Prx **
19031451-C-A 16919571-C-A **
18360272-T-A 16248392-T-A P6_Prx **
18838921-C-A 16727041-C-A **
18864641-C-A 16752761-C-A **
18906484-A-C 16794604-A-C **
18926897-G-T 16815017-G-T **
18931914-C-A 16820034-C-A **
18966064-T-G 16854184-T-G **
19000603-C-A 16888723-C-A **
20379387-A-T 18217501-A-T P5_Dst **
20612071-G-T 18450185-G-T P5_Dst **
22816277-G-C 20654391-G-C **
22084826-C-A 19922940-C-A **
21691993-C-A 19530107-C-A **
21796378-T-G 19634492-T-G **
21802854-T-G 19640968-T-G **
21803025-G-A 19641139-G-A **
21836668-G-T 19674782-G-T **
21923934-A-C 19762048-A-C **
22077204-A-C 19915318-A-C **
22100808-C-A 19938922-C-A **
21488721-C-A 19326835-C-A **
22170161-G-T 20008275-G-T **
22211759-G-C 20049873-G-C **
22262060-T-C 20100174-T-C DYZ19 **
22422471-A-T 20260585-A-T DYZ19 **
22429829-C-A 20267943-C-A DYZ19 **
22694855-C-A 20532969-C-A **
22816229-G-A 20654343-G-A **
22816252-G-C 20654366-G-C **
21624600-C-A 19462714-C-A **
21459647-A-T 19297761-A-T **
10932479-T-G **
20815618-T-A 18653732-T-A P4_Gap **
20770708-A-T 18608822-A-T P4_Prx **
20770723-A-T 18608837-A-T P4_Prx **
20770740-A-T 18608854-A-T P4_Prx **
20770741-A-T 18608855-A-T P4_Prx **
20770746-G-T 18608860-G-T P4_Prx **
20770748-A-T 18608862-A-T P4_Prx **
20770758-A-T 18608872-A-T P4_Prx **
20815622-T-A 18653736-T-A P4_Gap **
21368677-T-G 19206791-T-G **
21042373-C-A 18880487-C-A **
21054434-C-A 18892548-C-A **
21072405-T-A 18910519-T-A **
21125180-G-T 18963294-G-T **
21211802-AT-A 19049916-AT-A **
21211833-C-A 19049947-C-A **
21335132-G-T 19173246-G-T **
21352679-C-A 19190793-C-A **
10933293-T-A **
10895853-T-A **
10924746-T-G **
3272726-T-C 3404685-T-C **
28802628-G-A 26656481-G-A **
22816354-G-A 20654468-G-A **
2865781-T-C 2997740-T-C **
2909172-T-G 3041131-T-G **
3131048-C-A 3263007-C-A **
3164752-G-T 3296711-G-T **
3164754-C-A 3296713-C-A **
3275438-G-T 3407397-G-T **
10968284-C-A **
3276228-C-A 3408187-C-A **
3328161-A-G 3460120-A-G **
3402350-C-A 3534309-C-A **
3407858-C-A 3539817-C-A **
3420850-C-A 3552809-C-A **
3577856-A-G 3709815-A-G **
3598959-C-A 3730918-C-A **
3657298-G-T 3789257-G-T **
8216435-C-A 8348394-C-A **
22816362-G-A 20654476-G-A **
3657449-G-T 3789408-G-T **
21238668-T-G 19076782-T-G **
10976657-T-A **
10976671-T-C **
10976674-C-T **
10889503-A-T **
21238667-G-C 19076781-G-C **
13692762-A-T 11537086-A-T **
15107527-T-C 12995614-T-C **
10767731-A-AAATCT **
10892543-C-G **
10999400-A-T FGC79034 **
10971280-C-A **
22134005-G-T 19972119-G-T **
14076842-C-A 11956136-C-A **
14532136-C-A 12420337-C-A **
6074688-A-ATG 6206647-A-ATG 22×TG*****
10988794-T-A **
10988802-T-C **
3657319-G-T 3789278-G-T **
3876117-C-A 4008076-C-A **
20943482-TG-T 18781596-TG-T P4_Dst **
5445596-G-T 5577555-G-T **
5077604-A-G 5209563-A-G **
5127098-C-A 5259057-C-A **
5170562-C-A 5302521-C-A **
5171535-T-A 5303494-T-A **
5200658-G-T 5332617-G-T **
5366463-G-T 5498422-G-T **
5412357-C-A 5544316-C-A **
5471726-C-A 5603685-C-A **
5031556-C-A 5163515-C-A **
5495394-T-G 5627353-T-G **
5506056-G-T 5638015-G-T **
5524815-C-A 5656774-C-A **
5567707-G-GA 5699666-G-GA 8×A**
5601115-C-A 5733074-C-A **
5625302-C-A 5757261-C-A **
5635214-G-T 5767173-G-T **
5635394-G-T 5767353-G-T **
5040378-C-A 5172337-C-A **
5031166-T-G 5163125-T-G **
3877094-C-G 4009053-C-G **
10921868-C-A **
3885343-G-A 4017302-G-A **
3885350-G-T 4017309-G-T **
3922926-C-A 4054885-C-A **
4063604-A-C 4195563-A-C **
4110572-G-T 4242531-G-T **
4138363-G-T 4270322-G-T **
4139002-G-T 4270961-G-T **
4174401-C-G 4306360-C-G **
4344924-G-T 4476883-G-T **
4904336-G-T 5036295-G-T **
4416867-C-G 4548826-C-G 17×A**
4438741-A-G 4570700-A-G **
4469863-C-A 4601822-C-A **
4616734-C-A 4748693-C-A **
4626782-C-A 4758741-C-A **
4626912-C-A 4758871-C-A **
4825583-C-A 4957542-C-A **
4864899-C-A 4996858-C-A **
16271159-C-A 14159279-C-A **
11675225-T-A **
5755251-C-G 5887210-C-G **
10666934-C-G **
10767748-A-T **
10889511-C-T **
10988799-A-C **
17569226-GAAA-G 15457346-GAAA-G 25×A**
10895856-C-A **
3986932-C-A 4118891-C-A **
10887928-T-C **
10989455-C-A **
7138442-C-A 7270401-C-A **
10989457-C-G **
10989467-C-A **
10989472-C-T **
10989500-ATTCCTT-A **
10989515-A-T **
10989543-C-G **
11013305-C-A **
10987526-T-C **
13695519-G-T 11539843-G-T **
10858474-T-A **
15881850-T-C 13769970-T-C **
22816289-A-G 20654403-A-G Z9742 **
22456825-C-T 20294939-C-T DYZ19 **
13720532-C-G 11564856-C-G **
4128344-A-AT 4260303-A-AT 10×T**
17071135-C-CGAAG 14959255-C-CGAAG 5×GAAG**
22816242-A-C 20654356-A-C FGC24557 **
59003761-A-AAC 56857614-A-AAC **
26089882-A-T 23943735-A-T P1_Y1 **
27872539-CT-C 25726392-CT-C P1_Y2 25×T**
10763076-C-G **
5962109-CATATAT-C 6094068-CATATAT-C 20×AT**
22262272-G-T 20100386-G-T DYZ19 **
13222666-G-A 11066990-G-A **
15450073-C-CT 13338193-C-CT 15×T**
18210273-T-A 16098393-T-A A3430 *****
14609799-C-CA 12498001-C-CA 23×A**
16055924-C-A 13944044-C-A **
19622044-C-A 17510164-C-A P5_Prx **
10987535-A-G **
10896057-T-A **
11675220-T-C **
10660817-G-A **
21409414-C-A 19247528-C-A **
10991259-C-T **
10991266-A-G **
20247749-A-AG 18085863-A-AG P5_Dst **
10971179-C-A **
18053543-C-A 15941663-C-A **
22427368-GG-C 20265482-GG-C DYZ19 **
10660826-A-C **
21283285-C-A 19121399-C-A **
10660832-T-C **
10745336-G-T **
10760740-T-G **
11022979-C-A **
14887997-C-A 12776063-C-A **
10760244-T-TCGCTC **
18703044-C-A 16591164-C-A **
10784835-C-T **
27499391-T-A 25353244-T-A P1_Y2 **
10756269-TTCCCA-T **
10896082-T-A **
10858472-C-T **
10896088-C-T **
10896092-A-T **
10896093-C-T **
10896112-A-C **
10896117-A-T **
10896125-T-C **
10896132-A-T **
11027536-C-A **
10858482-C-G **
3164709-G-T 3296668-G-T **
15109854-C-A 12997941-C-A **
10744408-CCCTTA-C **
28484320-C-A 26338173-C-A **
13935009-C-A 11814303-C-A **
10984434-A-T **
15963780-C-A 13851900-C-A **
19753388-A-T 17641508-A-T P5_Prx **
19753390-C-A 17641510-C-A P5_Prx **
5636029-C-A 5767988-C-A **
4302825-A-T 4434784-A-T **
5827176-A-G 5959135-A-G **
10653140-T-G **
9965510-G-T 10127901-G-T **
9973581-C-A 10135972-C-A **
9991197-C-A 10153588-C-A **
10050157-C-T 10212548-C-T **
10889526-C-G **
10653119-A-T **
10655811-G-A **
9931488-TTCTTC-T 10093879-TTCTTC-T **
10656234-G-T **
10662960-C-A **
10889387-C-A **
10663045-C-A **
6035291-T-C 6167250-T-C **
10670796-C-A **
9957601-C-A 10119992-C-A **
10889549-TG-T **
10670846-C-G **
9056507-C-A **
8671719-T-A 8803678-T-A **
8673875-C-A 8805834-C-A **
8735352-C-A 8867311-C-A **
8851955-G-C 8983914-G-C **
8913137-C-A 9045096-C-A **
9055186-T-A **
9057405-G-T **
9541143-T-A 9703534-T-A IR3_Prx **
9040221-TTTG-T 9202612-TTTG-T **
9144368-G-C 9306759-G-C **
10889559-T-G **
9234398-C-A 9396789-C-A **
9351140-A-T 9513531-A-T **
9474257-C-T 9636648-C-T **
10670808-T-A **
10672688-G-T **
8324999-G-T 8456958-G-T **
10827058-C-T **
10822636-C-CA **
10822640-CT-C **
10824445-T-C **
10827046-C-T **
10827051-T-G **
10827053-C-A **
10827093-C-T **
10818793-T-G **
10827106-T-C **
10840716-G-T **
10842188-C-A **
10845758-T-G **
10848626-G-T **
10849963-T-G **
10822599-A-C **
10816122-C-A **
10677079-G-T **
10760210-C-T **
10677668-C-A **
10859677-T-A **
10683235-C-A **
10744466-T-C **
10751093-C-G **
10757304-C-A **
10760750-C-G **
10798287-G-T **
10767761-C-G **
10768604-T-A **
10784843-A-C **
10785232-C-A **
10785481-T-C **
10792832-C-A **
10793568-ATTCCACTTCATT-A **
8325524-C-A 8457483-C-A **
9144367-G-A 9306758-G-A **
8216426-A-T 8348385-A-T **
7138450-C-A 7270409-C-A **
6916097-G-C 7048056-G-C **
6922756-C-A 7054715-C-A **
7015426-T-G 7147385-T-G **
7017108-C-A 7149067-C-A **
7102060-A-G 7234019-A-G **
7102350-C-A 7234309-C-A **
7166207-G-A 7298166-G-A **
6818915-A-T 6950874-A-T **
7167701-G-A 7299660-G-A **
7169970-A-C 7301929-A-C **
10918583-A-T **
7208403-A-T 7340362-A-T **
7235828-CTTGTTT-C 7367787-CTTGTTT-C **
7309839-T-G 7441798-T-G **
7340881-G-T 7472840-G-T **
6828434-C-A 6960393-C-A **
6750384-G-T 6882343-G-T **
7371278-C-A 7503237-C-A **
6387956-T-A 6519915-T-A **
6093799-C-A 6225758-C-A **
10918586-A-T **
6223663-T-G 6355622-T-G IR3_Dst **
6326214-AC-A 6458173-AC-A IR3_Dst **
6353002-C-A 6484961-C-A **
6387938-T-A 6519897-T-A **
6387939-T-A 6519898-T-A **
6387964-G-T 6519923-G-T **
6682063-A-T 6814022-A-T **
6458252-C-A 6590211-C-A **
6464052-G-T 6596011-G-T **
6491987-C-A 6623946-C-A **
6604439-G-T 6736398-G-T **
6626761-C-A 6758720-C-A **
6642764-T-A 6774723-T-A **
6648316-T-A 6780275-T-A **
7349005-C-A 7480964-C-A **
10858206-G-T **
7418572-C-A 7550531-C-A **
8216424-A-T 8348383-A-T **
8181321-G-T 8313280-G-T **
8181298-C-T 8313257-C-T **
8181282-G-A 8313241-G-A **
8181341-A-G 8313300-A-G A3725 **
10906109-C-T **
8167732-C-A 8299691-C-A **
10914542-A-T **
8181356-C-T 8313315-C-T **
8067408-A-C 8199367-A-C **
7970188-C-A 8102147-C-A **
7874114-C-A 8006073-C-A **
7862160-C-A 7994119-C-A **
7723717-G-T 7855676-G-T **
10895877-A-ATTTCT **
10918489-C-A **
7541323-C-A 7673282-C-A **
7428152-A-C 7560111-A-C **
10895863-T-A **
7471080-A-C 7603039-A-C IR1_L **
8181306-C-A 8313265-C-A **
7578778-C-A 7710737-C-A **
16775689-CA-C 14663809-CA-C 9×A***
22229148-T-C 20067262-T-C DYZ19 ***
21964914-TA-T 19803028-TA-T 8×A***
14339106-CTTTT-C,CTT 12218401-CTTTT-C,CTT 19×T***
25050945-T-C 22904798-T-C g1 ***
8776539-A-T 8908498-A-T ***
10912245-A-G ***
23654348-T-G 21492462-T-G FT87364 ***
19994163-A-G 17882283-A-G P5_Prx ***
19936595-T-C 17824715-T-C P5_Prx ***
14302108-G-A 12181402-G-A ***
22223622-G-C 20061736-G-C DYZ19 ***
24820591-G-A 22674444-G-A P3_b2 ***
19936601-T-C 17824721-T-C P5_Prx ***
24254143-GACACACACACAC-G 22107996-GACACACACACAC-G P3_b1 10×AC***
13482544-G-GC 11326868-G-GC ***
58883880-T-C 56706991-A-G ***
4305812-T-C 4437771-T-C ***
21940037-CATATATAT-C 19778151-CATATATAT-C 22×AT***
16249081-C-A 14137201-C-A ***
58873208-T-C 56717663-A-G ***
9993355-A-G 10155746-A-G ***
6091720-ATTTTTTTTTTT-A 6223679-ATTTTTTTTTTT-A 28×T***
15424825-G-T 13312945-G-T ***
13276200-C-T 11120524-C-T ***
13276204-C-T 11120528-C-T ***
10874635-C-A ***
13804063-G-C,T 11683357-G-C,T ***
58972530-G-GATTCC 56826383-G-GATTCC ***
13276206-T-C 11120530-T-C ***
21261826-T-TA 19099940-T-TA 26×A***
13859829-G-T 11739123-G-T ***
13322740-C-A 11167064-C-A ***
4521629-AG-A 4653588-AG-A ***
13447896-CGTTCAATTCCATTCCATTTA-C,CGTTCAATTCCATTCCATTCA 11292220-CGTTCAATTCCATTCCATTTA-C,CGTTCAATTCCATTCCATTCA ***
58979964-C-T 56833817-C-T ***
13456195-C-CCA 11300519-C-CCA ***
13820773-G-T 11700067-G-T ***
13471704-CTGATACTGGATG-C 11316028-CTGATACTGGATG-C ***
8344683-T-C 8476642-T-C ***
13476193-T-C,G 11320517-T-C,G ***
26120150-T-TTTCCTTCC 23974003-T-TTTCCTTCC P1_Y1 12×TTCC******
13511131-T-C 11355455-T-C ***
5587963-CT-C 5719922-CT-C ***
13454534-G-A 11298858-G-A ***
5260410-CAAA-C 5392369-CAAA-C 20×A***
13726099-T-A 11570423-T-A ***
9799134-CAAAAA-C,CAAAAAA 9961525-CAAAAA-C,CAAAAAA 24×A***
11643783-G-T ***
11657268-C-A ***
11668723-A-G ***
15380283-G-T 13268403-G-T ***
21713916-C-A 19552030-C-A ***
8649789-CAAA-C 8781748-CAAA-C 13×A***
9799132-G-T 9961523-G-T ***
10796645-T-A ***
21261853-G-A 19099967-G-A ***
14301780-G-T 12181074-G-T ***
14825125-CTTT-C,CT 12713192-CTTT-C,CT 20×T***
22973122-C-A 20811236-C-A ***
14604590-CTTTT-C,CTTT 12492792-CTTTT-C,CTTT 21×T***
8117200-G-T 8249159-G-T ***
14914663-CTT-C 12802730-CTT-C 8×T***
15342021-C-A 13230140-C-A ***
15400167-CAAA-C,CAA 13288287-CAAA-C,CAA 14×A***
7190737-C-A 7322696-C-A ***
4174889-C-A 4306848-C-A ***
7084572-A-G 7216531-A-G ***
6930612-C-A 7062571-C-A ***
16071718-A-T 13959838-A-T ***
16226361-C-A 14114481-C-A ***
6114967-C-A 6246926-C-A ***
5885123-TAA-T 6017082-TAA-T 17×A***
10648107-C-T ***
10857379-C-A ***
10820688-C-A ***
10983412-G-T ***
3256138-ATT-A 3388097-ATT-A 15×T***
3205858-CAA-C 3337817-CAA-C 15×A***
56850869-T-C ***
10842532-T-A ***
14926487-AAG-A 12814552-AAG-A ***
11009091-C-T ***
56837055-CCATTT-C,CCATTC ***
56833468-C-T ***
10880322-C-A ***
11007919-G-A ***
13476892-C-G 11321216-C-G ***
23002319-CT-C,CTT 20840433-CT-C,CTT 14×T***
56829781-C-A,G ***
22868596-CA-C 20706710-CA-C 10×A***
23185980-CTT-C 21024094-CTT-C 13×T***
10785108-C-A ***
10686622-A-ATTCCC ***
5523548-C-A 5655507-C-A ***
10682596-C-G ***
10677401-C-A ***
10663319-C-A ***
13457995-C-A 11302319-C-A ***
23577288-C-A 21415402-C-A ***
10648119-T-C FT91485 ***
56850852-A-G ***

In the table above, the meaning of the confidence field depends on whether the data comes from an FTDNA kit or an FGC kit. For FTDNA kits, + implies a "PASS" result with just one possible variant, * indicates a "PASS" but with multiple variants, ** indicates "REJECTED" with just a single variant, and *** indicates "REJECTED" with multiple possible variants. 'A*' are heterozygous variants not called by FTDNA, but still pulled from the VCF file. For FGC kits, + indicates over 99% likely genuine (95% for INDELs); * over 95% likely genuine (90% for INDELs); ** about 40% likely genuine; *** about 10% likely genuine. Manual entries read directly from a BAM file will be either + indicating positive, or * indicating that the data show a mixture of possible variants.

For the FTDNA kits, the BED data is encoded in the background color of the cells. Those cells with a white background have coverage, those with a grey background indicate no coverage in the BED file, and those with a pink background indicate the mutation is on the edge of a coverage region. These pink regions often indicate that the individual may be positive for a SNP even if there is no corresponding entry in the vcf file.

The combBED column indicates whether or not the mutation is a SNP and falls in the combBED region defined in Defining a New Rate Constant for Y-Chromosome SNPs based on Full Sequencing Data by Dmitry Adamov, Vladimir Guryanov, Sergey Karzhavin, Vladimir Tagankin, Vadim Urasin.

The McDonald BED column indicates whether or not the mutation is a SNP and falls in the BED region used by Dr. Iain McDonald in the age analysis he does for R-U106 men.

Age Analysis Information (work in progress)

AllMcDonaldYFull
Kit: B1109771079098178778327978849
Kit: B110977988080180500837915516
Kit: B1109771498015393693008309570
Used in age calculations1498015393693008309570
Counts of SNPs3733
Variant counts last updated 2020-02-15 02:52:36.



Big Tree Main Page