Tree Position

R-P312/S116 > Z290 > L21/S145 > DF13 > FGC11134 > A353 > Z16250 > A114 > CTS4466/S1136 > S1115 > A212 > 7367197-CCTT-C > A206

Unique Mutations

The mutations unique to this man are summarized in the table below. Those with a '+' or '*' confidence level are considered by FamilyTreeDNA or FullGenomesCorp to be high quality SNPs/INDELs. For completeness, all other mutations of lesser confidence are included as well. These additional mutations may be useful for distinguishing between very closely related men.

Occasionally, some of the mutations listed here will be thought to be shared with other men in which case they might appear in upstream blocks on the tree. When this happens, the 'Blocks' field will indicate what block they appear in. Such a situation might arise with BigY men if the BED data suggests another man may be positive for a SNP, even though it doesn't appear in his VCF data. It might also happen if Chromo2 testing or Sanger sequencing of other men not on the tree show the SNP to be shared.

POS-REF-ALT (hg19) POS-REF-ALT (hg38) Blocks Names Region McDonald BED combBED STRFTDNA
21418
BigY3
21418
BigY2
21418
56834237-C-T A*
56833662-C-G A*
13448099-C-T 11292423-C-T A*
13798966-T-C 11678260-T-C A*
20943477-C-CTG 18781591-C-CTG P4_Dst 12×TGA*
13450300-A-T 11294624-A-T A*
13448135-C-T 11292459-C-T A*
13450829-T-G 11295153-T-G A*
56837051-C-T A*
56837041-C-T A*
22313425-T-A 20151539-T-A DYZ19 ***A*
20624942-A-G 18463056-A-G P4_Prx A*
26272432-A-G 24126285-A-G P1_Y1 ***A*A*
56836427-C-G A*
56830770-C-T A*
56832749-C-T A*
56833039-A-T A*
20508854-A-C 18346968-A-C P5_Dst A*
22232710-G-A 20070824-G-A DYZ19 A*
22268289-C-A 20106403-C-A DYZ19 A*
22313221-G-A 20151335-G-A DYZ19 A*
28657166-T-TAC 26511019-T-TAC ***A*
13449615-C-G 11293939-C-G A*
13447934-C-T 11292258-C-T A*
17329847-T-TAC 15217967-T-TAC 11×ACA*
58983143-C-T 56836996-C-T A*
56832545-T-C A*
26406807-G-A 24260660-G-A P1_Y1 A*
56832753-C-T A*
13451321-C-T 11295645-C-T A*
20553790-C-T 18391904-C-T P5_Dst A*
19625988-G-A 17514108-G-A P5_Prx A*
5252635-T-TA 5384594-T-TA 11×AA*
13698545-A-G 11542869-A-G A*A*
58979205-T-C 56833058-T-C A*
56833067-A-T A*
13948604-C-CA 11827898-C-CA 10×AA*
59005581-T-C 56859434-T-C A*
13798988-G-GA 11678282-G-GA A*
19736631-T-C 17624751-T-C ZZ12 Y16482ZZ12_1 P5_Prx A*
4673338-C-A 4805297-C-A A*
13798939-A-G 11678233-A-G A*
21454202-T-A 19292316-T-A YYA*
24303593-G-A 22157446-G-A P3_t1 A*
2992436-A-AT 3124395-A-AT 15×TA*
23432230-G-GA 21270344-G-GA 10×AA*
58979236-T-C 56833089-T-C A*
7236915-C-T 7368874-C-T A336 Y**+*
23061336-C-A 20899450-C-A A355 YY+***
17961095-A-G 15849215-A-G A351 YY+***
16292546-A-ATT 14180666-A-ATT 48×T+
21477198-CCTT-C 19315312-CCTT-C 9×CTT+
7106982-G-GCT 7238941-G-GCT 15×CT+
26098903-G-A 23952756-G-A P1_Y1 ***+*
9162544-G-A 9324935-G-A A207 ++*
15873677-G-A 13761797-G-A A211 YY++*
19412070-G-A 17300190-G-A A213 YY++***
14372969-A-G 12252265-A-G A208 YY++*
16763254-A-C 14651374-A-C A293 YY++*
28787110-A-G 26640963-A-G A222 ++*
15814116-CCAGA-C 13702236-CCAGA-C ++*
16620069-T-C 14508189-T-C A19227 Y+**
24365177-AAGAGAT-A 22219030-AAGAGAT-A 8×AGAGAT+**
10837116-G-A FT91827 +
17538005-C-T 15426125-C-T YY+
4871119-C-T 5003078-C-T FT84560 +
3911823-A-G 4043782-A-G FT84405 +
5527702-C-T 5659661-C-T FT84667 +
16962369-A-G 14850489-A-G 6347953-G-AFGC14972 YY*
21070281-G-T 18908395-G-T 6347953-G-AFGC14980 YY*
8461434-G-A 8593393-G-A 6347953-G-AFGC14955 YY*
6773501-C-CTCTT 6905460-C-CTCTT 6×TCTT***
13535776-A-T 11380100-A-T *
13814492-G-T 11693786-G-T 6347953-G-AFGC14963 *
9085947-G-A 9248338-G-A 6347953-G-AFGC14957 Y*
28759258-A-G 26613111-A-G 6347953-G-AFGC14995 Y*
22769166-A-C 20607280-A-C 6347953-G-AFGC14988 YY*
22745552-G-A 20583666-G-A FGC14987 YY*
9894932-G-A 10057323-G-A 6347953-G-AFGC14959 YY*
22487089-A-C 20325203-A-C 6347953-G-ABY32000 DYZ19 *
4233467-T-TACAC 4365426-T-TACAC 13×AC*
23467640-G-C 21305754-G-C 6347953-G-AFGC14992 YY*
16899034-G-C 14787154-G-C FGC14971 YY*
13976903-A-G 11856197-A-G Y*
22148450-GA-G 19986564-GA-G *
10658331-ACCATTCCATT-A ***
18985438-A-G 16873558-A-G 6347953-G-AFGC14977 YY*
21979659-G-A 19817773-G-A FGC14986 YY*
13484120-C-A 11328444-C-A *
13448360-T-A 11292684-T-A *
21463528-A-C 19301642-A-C 6347953-G-AFGC14983 YY*
11000011-A-ATCCAT *
8228775-A-G 8360734-A-G 6347953-G-AFGC14954 YY*
13448608-CCACTT-C,CCACTG 11292932-CCACTT-C,CCACTG *
23623951-C-A 21462065-C-A 6347953-G-AFGC14993 YY*
23989108-G-GA 21842961-G-GA *
19105247-G-A 16993367-G-A 6347953-G-AFGC14978 YY*
22460826-G-C 20298940-G-C 6347953-G-AFGC34800 DYZ19 *
6932503-G-C 7064462-G-C 6347953-G-AFGC14952 YY*
14388311-G-A 12267607-G-A FGC14965 YY*
15407374-C-T 13295494-C-T L617FGC14936 YY*
8466862-G-A 8598821-G-A L617L617 YY*
6891098-G-A 7023057-G-A FGC14951FGC14951 YY*
17506827-C-T 15394947-C-T L617 FGC17249FGC14934 Y9056 YY*
13820775-TATGGAATGGA-T 11700069-TATGGAATGGA-T 11×ATGGA**
7316980-A-C 7448939-A-C FGC14953 YY*
21254923-T-G 19093037-T-G FGC14981 YY*
10985125-A-C **
10921506-C-A **
10947340-T-C **
10971324-G-C **
10963320-T-C **
10958514-T-C **
11013655-G-T **
11016464-A-T **
10934627-A-G **
10929727-C-T **
11019026-C-A **
11012372-C-A **
11025498-C-A **
11027386-C-A **
10950273-T-G **
10950173-G-T **
10913349-A-G **
11027871-G-T **
10913321-A-T **
11027898-G-A **
10940221-G-T **
11011255-G-T **
10985131-C-T **
10985198-C-G **
11028172-C-A **
10979487-C-A **
10985135-A-G **
10985147-TCCG-T **
10939766-A-C **
10979024-C-A **
22013658-A-G 19851772-A-G **
10939759-T-C **
10990141-C-T **
10939749-G-C **
10992704-T-A **
10939753-T-A **
10971330-A-C **
10947359-A-T **
6644827-C-A 6776786-C-A **
11004428-T-A **
11004429-C-CG **
11006276-C-A **
10939789-T-C **
10994228-T-G **
6752607-A-G 6884566-A-G **
11038077-T-C **
14269478-G-T 12148772-G-T **
14066916-C-T 11946210-C-T **
14115019-C-A 11994313-C-A Y90349 **
14123834-C-A 12003128-C-A **
14128239-C-A 12007533-C-A **
14142490-T-C 12021784-T-C **
14159557-C-A 12038851-C-A **
14181651-C-A 12060945-C-A **
14188043-C-A 12067337-C-A **
14225212-C-A 12104506-C-A **
14227560-C-A 12106854-C-A **
14253233-C-A 12132527-C-A **
14269571-C-A 12148865-C-A **
14065813-G-T 11945107-G-T **
14289391-C-T 12168685-C-T **
14289396-C-T 12168690-C-T **
14324370-T-A 12203664-T-A **
14328182-C-A 12207476-C-A **
14382125-G-T 12261421-G-T **
14462613-T-C 12341886-T-C **
14473005-C-A 12352274-C-A **
14533430-C-A 12421631-C-A FT41635 **
14533446-C-A 12421647-C-A **
14539614-C-A 12427815-C-A **
14557747-C-A 12445948-C-A **
14566638-T-C 12454838-T-C **
14065828-G-A 11945122-G-A **
14032504-C-A 11911798-C-A **
13236248-C-A 11080572-C-A **
13642994-C-A 11487318-C-A **
13253667-C-A 11097991-C-A **
13322137-C-A 11166461-C-A **
13330961-C-A 11175285-C-A **
13389710-G-C 11234034-G-C **
13460473-T-A 11304797-T-A **
13461599-T-A 11305923-T-A **
13468228-A-G 11312552-A-G **
13502502-C-A 11346826-C-A **
13525946-C-A 11370270-C-A **
13594359-C-T 11438683-C-T **
13604304-C-A 11448628-C-A **
13610983-C-A 11455307-C-A **
19547685-T-C 17435805-T-C **
14022948-C-A 11902242-C-A **
18376966-C-CAG 16265086-C-CAG P6_Prx **
11643584-G-T **
11666154-C-A **
11674463-C-A **
11675340-T-C **
13811035-A-G 11690329-A-G **
13854498-A-T 11733792-A-T **
13855763-TGTAACCAAAG-T 11735057-TGTAACCAAAG-T **
13885521-G-T 11764815-G-T **
13885545-G-T 11764839-G-T **
13947958-T-A 11827252-T-A **
13976453-C-A 11855747-C-A **
10907824-C-T **
22236190-A-C 20074304-A-C DYZ19 **
10896309-A-G **
9402550-T-G 9564941-T-G **
8736967-C-A 8868926-C-A **
8739807-T-G 8871766-T-G **
8766348-A-G 8898307-A-G **
8766373-T-G 8898332-T-G **
8848291-C-A 8980250-C-A **
8850047-G-A 8982006-G-A **
9111260-T-A **
8970637-C-A 9133028-C-A **
9079340-A-T 9241731-A-T **
9221815-A-G 9384206-A-G **
9321751-C-A 9484142-C-A **
9409782-T-C 9572173-T-C **
8691860-TA-T 8823819-TA-T **
9442255-AT-A 9604646-AT-A **
9498931-T-A 9661322-T-A **
9511884-A-T 9674275-A-T **
9513276-G-A 9675667-G-A **
9583264-C-A 9745655-C-A IR3_Prx **
9928310-C-A 10090701-C-A **
9983402-A-T 10145793-A-T **
9986087-A-C 10148478-A-C **
9996011-T-G 10158402-T-G **
10011145-G-T 10173536-G-T **
10011167-A-T 10173558-A-T **
8720360-C-A 8852319-C-A **
8166744-C-T 8298703-C-T **
10656504-G-T **
7138293-A-T 7270252-A-T **
6776352-C-A 6908311-C-A **
6789286-C-A 6921245-C-A **
6791084-T-C 6923043-T-C **
6799246-C-G 6931205-C-G **
6825438-C-A 6957397-C-A **
6826974-G-T 6958933-G-T **
6920656-T-C 7052615-T-C **
6996774-C-T 7128733-C-T **
6996779-G-A 7128738-G-A **
7021373-C-A 7153332-C-A **
7038418-C-A 7170377-C-A **
7142831-C-A 7274790-C-A **
7783179-C-A 7915138-C-A **
7183026-C-A 7314985-C-A **
7186522-C-A 7318481-C-A **
7201476-C-A 7333435-C-A **
7334113-C-A 7466072-C-A **
7360541-C-T 7492500-C-T **
7397648-G-A 7529607-G-A **
7397755-C-A 7529714-C-A **
7414013-G-A 7545972-G-A Y62025 **
7430499-C-A 7562458-C-A **
7541296-T-G 7673255-T-G **
7717882-T-C 7849841-T-C **
10654819-G-T **
10659165-C-T **
10889704-C-A **
10868130-A-C **
10840038-A-C **
10844269-A-C **
10844275-A-T **
10844285-C-T **
10847071-T-A **
10847073-C-A **
10847107-C-T **
10850845-C-A **
10852298-C-A **
6729578-T-A 6861537-T-A **
10865426-C-A **
6652426-A-C 6784385-A-C **
10814890-A-T **
10868359-CAGTCA-C **
14700801-C-A 12588867-C-A **
10870267-C-A **
10873832-A-C **
6776012-C-A 6907971-C-A **
10873834-T-C **
10873838-T-A **
10873844-T-C **
10873849-T-C **
10874370-C-A **
10874464-T-C **
10839978-A-C **
10807043-C-A **
10660343-A-C **
10767701-C-G **
10661431-G-C **
10662134-T-TTAATTCCATTCCATTCCATTTCAC **
10666633-G-T **
10746939-G-T **
10747039-A-C **
10753206-A-T **
10754889-A-C **
10757854-G-T **
10760749-A-G **
10760752-C-T **
10762745-C-A **
10768177-C-A **
10804077-C-T **
10772255-C-A **
10778656-C-A **
10778769-C-A **
10780946-A-G **
10785360-T-C **
10795716-C-A **
10795977-A-C **
6734781-T-C 6866740-T-C FGC14950 **
10796119-T-G **
10797953-T-G **
10797961-A-T **
14567038-A-T 12455238-A-T **
15290068-C-T 13178167-C-T **
14765031-C-A 12653100-C-A **
21603998-C-A 19442112-C-A **
21153358-G-T 18991472-G-T **
21154656-C-A 18992770-C-A **
21155180-T-C 18993294-T-C **
21201117-A-C 19039231-A-C **
21244131-C-A 19082245-C-A **
21391691-C-A 19229805-C-A **
21417946-T-C 19256060-T-C **
21455408-C-A 19293522-C-A **
21476294-C-G 19314408-C-G **
21551838-C-A 19389952-C-A **
21554825-T-G 19392939-T-G **
21861485-C-A 19699599-C-A **
21141386-T-A 18979500-T-A **
21996164-T-G 19834278-T-G **
22012057-G-A 19850171-G-A **
22068636-TA-T 19906750-TA-T **
22079901-C-A 19918015-C-A **
22149922-C-A 19988036-C-A **
22204258-C-T 20042372-C-T **
22209323-G-C 20047437-G-C **
56880222-C-A **
56869084-G-T **
56849662-T-A **
22503710-G-T 20341824-G-T DYZ19 **
21141420-C-G 18979534-C-G **
56886949-C-A **
56842403-G-T **
20104224-T-G 17992344-T-G P5_Dst 5×GAAA**
19438287-A-T 17326407-A-T **
19438292-G-A 17326412-G-A **
19449204-C-A 17337324-C-A **
19460423-A-G 17348543-A-G **
19843021-A-T 17731141-A-T P5_Prx **
19853715-A-T 17741835-A-T P5_Prx **
19853726-G-A 17741846-G-A P5_Prx **
19948311-C-T 17836431-C-T P5_Prx **
20020952-C-CTTT 17909072-C-CTTT P5_Prx 9×T**
3083095-TACA-T 3215054-TACA-T **
20022391-G-T 17910511-G-T P5_Prx **
20330278-T-C 18168392-T-C P5_Dst **
20785-G-C FGC77958 **
20364234-T-A 18202348-T-A P5_Dst **
20364351-T-G 18202465-T-G P5_Dst **
20478270-C-T 18316384-C-T P5_Dst **
20478276-A-T 18316390-A-T P5_Dst **
20620900-C-A 18459014-C-A P4_Prx **
20620901-T-C 18459015-T-C P4_Prx **
20620907-A-AG 18459021-A-AG P4_Prx **
18321294-T-A 16209414-T-A P6_Prx **
20692958-C-G 18531072-C-G P4_Prx **
20692966-A-AG 18531080-A-AG P4_Prx **
20707746-G-T 18545860-G-T P4_Prx **
13483172-G-T 11327496-G-T **
56847837-C-A **
22503715-T-G 20341829-T-G DYZ19 **
19370284-A-T 17258404-A-T **
27808449-A-G 25662302-A-G P1_Y2 **
24385025-T-G 22238878-T-G **
28598992-T-C 26452845-T-C **
24390012-C-A 22243865-C-A **
24875544-C-T 22729397-C-T g1 **
25733114-G-T 23586967-G-T P1_b3 **
25880112-T-C 23733965-T-C P1_Y1 **
25944966-G-A 23798819-G-A P1_Y1 **
26153996-A-T 24007849-A-T P1_Y1 **
26428135-T-TC 24281988-T-TC P1_Y1 **
26563908-C-A 24417761-C-A P1_g2 **
27570832-T-G 25424685-T-G P1_Y2 **
27908263-T-TA 25762116-T-TA P1_Y2 **
21766754-A-AG **
28478237-C-A 26332090-C-A **
28481163-A-G 26335016-A-G **
28498022-C-A 26351875-C-A **
28532723-A-T 26386576-A-T **
28532913-C-G 26386766-C-G **
28532931-T-G 26386784-T-G **
28549879-G-T 26403732-G-T **
28551147-A-G 26405000-A-G **
28560968-C-A 26414821-C-A **
28589582-T-C 26443435-T-C **
28596698-GTTTT-G 26450551-GTTTT-G 24×T**
28614790-G-A 26468643-G-A **
23875658-C-A 21713772-C-A **
22594501-C-A 20432615-C-A **
28656393-A-T 26510246-A-T **
22689918-C-A 20528032-C-A **
22776918-C-A 20615032-C-A **
22787338-G-A 20625452-G-A **
28768671-T-A 26622524-T-A **
22797555-T-C 20635669-T-C **
22949874-C-T 20787988-C-T **
22988903-C-A 20827017-C-A **
22989127-A-G 20827241-A-G **
23034368-G-A 20872482-G-A **
28721498-T-C 26575351-T-C **
23046056-A-C 20884170-A-C **
23076306-C-A 20914420-C-A **
23790366-C-A 21628480-C-A **
23091636-C-A 20929750-C-A **
23111832-C-A 20949946-C-A **
23126407-A-C 20964521-A-C **
23126492-C-T 20964606-C-T **
23203754-G-T 21041868-G-T **
23203789-G-T 21041903-G-T **
23252517-G-T 21090631-G-T **
23317708-T-G 21155822-T-G **
23401488-C-A 21239602-C-A **
23435881-T-C 21273995-T-C **
23441361-T-C 21279475-T-C **
23648197-C-A 21486311-C-A **
19370347-C-A 17258467-C-A **
19310192-C-A 17198312-C-A **
14825866-C-A 12713933-C-A **
16243119-C-A 14131239-C-A **
15866155-G-A 13754275-G-A **
15940030-G-A 13828150-G-A **
16028459-T-A 13916579-T-A **
16045696-C-A 13933816-C-A **
16090687-G-A 13978807-G-A **
16094767-A-T 13982887-A-T **
16118988-C-CT 14007108-C-CT P8_Prx **
16118992-CT-C 14007112-CT-C P8_Prx **
16176721-C-A 14064841-C-A **
16233424-C-A 14121544-C-A **
16240857-A-G 14128977-A-G **
16423674-C-A 14311794-C-A **
15790535-C-A 13678655-C-A **
16445617-C-A 14333737-C-A **
16551081-C-A 14439201-C-A **
16612670-G-T 14500790-G-T **
6593389-G-C 6725348-G-C **
16673161-C-A 14561281-C-A **
16682698-T-G 14570818-T-G **
16710088-C-T 14598208-C-T **
16860746-TTGC-T 14748866-TTGC-T **
16930639-AT-A 14818759-AT-A **
16944703-C-A 14832823-C-A **
6996787-G-T 7128746-G-T **
15803660-C-T 13691780-C-T **
15767093-C-A 13655213-C-A **
17039144-A-G 14927264-A-G **
15201455-A-G 13089541-A-G **
14845351-T-A 12733417-T-A **
14880320-C-A 12768390-C-A **
14960283-T-A 12848358-T-A **
12877311-A-AGC **
15045458-AAGTTGTT-A 12933548-AAGTTGTT-A **
15111575-C-A 12999662-C-A **
15131680-T-C 13019767-T-C **
13045946-TCAA-T **
15168307-CA-C 13056393-CA-C **
15170926-T-C 13059012-T-C **
15193529-C-A 13081615-C-A **
15218863-G-T 13106949-G-T **
15743854-C-T 13631974-C-T **
15258522-TA-T 13146606-TA-T **
28596736-A-T 26450589-A-T **
15396572-T-G 13284692-T-G **
15423777-G-T 13311897-G-T **
15423838-A-T 13311958-A-T **
15431796-C-A 13319916-C-A **
15491867-A-T 13379987-A-T **
15556797-G-A 13444917-G-A **
15696911-A-G 13585031-A-G **
15732159-C-A 13620279-C-A FT169027 **
15733548-A-C 13621668-A-C **
15733877-C-T 13621997-C-T **
16974037-A-T 14862157-A-T **
17071142-A-AGG 14959262-A-AGG **
19301516-G-T 17189636-G-T **
18793658-C-T 16681778-C-T **
18391884-C-A 16280004-C-A P6_Gap **
18447665-G-T 16335785-G-T P6_Dst **
18461727-C-T 16349847-C-T P6_Dst **
18499998-C-A 16388118-C-A P6_Dst **
18585630-C-A 16473750-C-A **
18629416-C-A 16517536-C-A **
14291353-T-C 12170647-T-C **
13483166-T-C 11327490-T-C **
9803556-G-A 9965947-G-A **
18647649-G-A 16535769-G-A **
18791205-A-G 16679325-A-G **
18859188-C-A 16747308-C-A **
18354327-G-A 16242447-G-A P6_Prx **
18864730-G-A 16752850-G-A **
18902076-T-C 16790196-T-C **
18904905-C-A 16793025-C-A **
18949793-T-C 16837913-T-C **
18985038-C-A 16873158-C-A **
9557040-G-GTTGT 9719431-G-GTTGT IR3_Prx **
19059954-C-A 16948074-C-A **
6999596-T-C 7131555-T-C **
19088444-C-A 16976564-C-A **
19172883-G-T 17061003-G-T **
19202927-TC-G 17091047-TC-G **
18365456-C-A 16253576-C-A P6_Prx **
18297941-G-T 16186061-G-T P6_Prx **
17210904-T-A 15099024-T-A **
17616831-C-A 15504951-C-A **
18057681-T-A 15945801-T-A **
17246831-A-C 15134951-A-C **
17301237-TCAA-T 15189357-TCAA-T **
17337618-T-A 15225738-T-A **
17369323-C-A 15257443-C-A **
17374557-GGA-G 15262677-GGA-G **
17380631-C-A 15268751-C-A **
17464822-A-G 15352942-A-G **
17548733-C-A 15436853-C-A **
17561873-A-T 15449993-A-T **
17575537-G-T 15463657-G-T **
17654888-C-A 15543008-C-A **
18201586-C-A 16089706-C-A **
17718433-A-AT 15606553-A-AT **
17763908-A-G 15652028-A-G **
17953930-T-A 15842050-T-A **
16997375-G-T 14885495-G-T **
16051042-CTT-C 13939162-CTT-C **
17998645-A-T 15886765-A-T P7_Gap **
18086967-C-A 15975087-C-A **
18090218-C-A 15978338-C-A **
18165714-C-A 16053834-C-A **
18185622-G-T 16073742-G-T **
16051032-T-C 13939152-T-C **
16051028-T-C 13939148-T-C **
6596032-C-A 6727991-C-A **
16277889-C-A 14166009-C-A **
6532933-G-T 6664892-G-T **
8389620-G-C 8521579-G-C **
7255055-C-A 7387014-C-A **
4003070-C-A 4135029-C-A **
11026031-T-C **
13468231-G-T 11312555-G-T **
10764551-AC-A **
10924531-C-A **
25990662-G-T 23844515-G-T P1_Y1 **
20022444-T-TC 17910564-T-TC P5_Prx **
10808573-T-C **
10840044-A-C **
13971579-G-A 11850873-G-A **
4521612-TAAAA-T 4653571-TAAAA-T 17×A**
20970354-A-AC 18808468-A-AC P4_Dst **
10797929-C-G **
18825660-T-A 16713780-T-A **
10661437-G-T **
15916391-C-A 13804511-C-A **
19286369-C-A 17174489-C-A **
26047527-G-T 23901380-G-T P1_Y1 **
10954900-G-C **
10965206-C-A **
10977058-C-G **
10977091-T-C **
27971726-C-CAA 25825579-C-CAA P1_Y2 27×A**
15866159-G-A 13754279-G-A **
11028200-C-G **
15870607-T-C 13758727-T-C **
10947345-C-T **
21118509-C-A 18956623-C-A **
10990147-A-G **
3550569-C-T 3682528-C-T **
11003877-C-A **
10776334-C-A **
8482000-A-C 8613959-A-C **
15686809-A-G 13574929-A-G **
11038070-T-C **
6996755-T-C 7128714-T-C **
6996761-C-T 7128720-C-T **
8389604-T-G 8521563-T-G **
15986617-C-CTT 13874737-C-CTT 12×T**
10868371-C-G **
21211720-C-A 19049834-C-A **
17306341-C-A 15194461-C-A **
7723527-C-A 7855486-C-A **
10982643-T-C **
18847692-C-A 16735812-C-A **
10911676-A-G **
11005342-C-A **
20292450-AGT-A 18130564-AGT-A P5_Dst 12×GT**
23514389-C-A 21352503-C-A **
15652891-C-A 13541011-C-A **
16968183-C-A 14856303-C-A **
16176707-C-A 14064827-C-A **
9735640-A-G 9898031-A-G IR3_Prx **
10952120-C-A **
16075403-C-A 13963523-C-A **
16060-G-T **
11004433-T-TGATA **
24406583-T-A 22260436-T-A **
2738763-CTTTTT-C 2870722-CTTTTT-C 17×T**
10767703-T-C **
21263521-C-A 19101635-C-A **
10939736-T-C **
7774147-C-A 7906106-C-A **
23355318-C-A 21193432-C-A **
19187414-G-C 17075534-G-C **
2665873-G-T 2797832-G-T **
13804159-C-A 11683453-C-A **
20104224-TGAAA-T 17992344-TGAAA-T P5_Dst 5×GAAA**
13871389-C-A 11750683-C-A **
19060097-C-A 16948217-C-A **
11028207-C-T **
10666944-C-A **
26366377-G-T 24220230-G-T P1_Y1 **
24013847-CTATATATATATATATATATATATA-C 21867700-CTATATATATATATATATATATATA-C 21×TA**
13743169-T-C 11587493-T-C **
7231098-C-A 7363057-C-A **
21700616-T-G 19538730-T-G **
10813092-C-T **
14609798-T-A 12498000-T-A **
22540513-C-A 20378627-C-A **
14624292-C-T 12512492-C-T PF682 S569 **
21515846-G-A 19353960-G-A **
9732926-C-A 9895317-C-A IR3_Prx **
7996396-C-A 8128355-C-A Y62955 **
10815073-T-C **
7313157-C-A 7445116-C-A **
4164327-TA-T 4296286-TA-T 11×A**
23825111-G-T 21663225-G-T **
20645883-C-T 18483997-C-T P4_Prx **
20025480-T-C 17913600-T-C P5_Prx **
2701335-A-G 2833294-A-G YSC0001335 **
17170256-C-G 15058376-C-G **
22369831-N-A 20207945-N-A DYZ19 **
23377534-T-TA 21215648-T-TA 9×A**
24607321-CT-C 22461174-CT-C P3_t2 12×T**
6074688-ATGTG-A 6206647-ATGTG-A 22×TG**
3941028-TTA-T 4072987-TTA-T 8×TA**
19927027-C-T 17815147-C-T P5_Prx **
13258578-TC-T 11102902-TC-T **
24355621-TACAC-T 22209474-TACAC-T 13×AC**
7359768-AATAT-A 7491727-AATAT-A 10×AT**
24387414-CAT-C 22241267-CAT-C **
28482797-G-A 26336650-G-A **
27808453-C-CTT 25662306-C-CTT P1_Y2 15×T**
19189467-A-T 17077587-A-T **
10757660-C-A **
24069919-C-A 21923772-C-A P3_b1 **
22602093-C-A 20440207-C-A **
10844279-G-T **
10767963-T-A **
3791001-C-A 3922960-C-A **
17098900-C-A 14987020-C-A **
19775333-TTG-T 17663453-TTG-T P5_Prx **
22811836-C-A 20649950-C-A **
3467204-C-A 3599163-C-A **
13468249-C-T 11312573-C-T **
10767913-T-G **
13585112-C-A 11429436-C-A **
10804780-T-TATTCC **
16308204-C-A 14196324-C-A **
13468239-A-G 11312563-A-G **
7414256-C-G 7546215-C-G **
6165681-G-A 6297640-G-A IR3_Dst **
10767921-C-A **
10977069-TCTCCA-T **
16905860-G-A 14793980-G-A **
10673496-G-C **
18855421-A-T 16743541-A-T **
9700709-C-A 9863100-C-A IR3_Prx **
16598965-G-A 14487085-G-A **
6529403-C-G 6661362-C-G **
10673466-C-G **
10673493-A-T **
10673502-C-A **
16933269-C-A 14821389-C-A **
10673507-G-T **
10673518-A-T **
10673507-GATTCC-G **
10673534-A-T **
10673535-T-C *****
13452845-CCTCCTTTT-C 11297169-CCTCCTTTT-C **
3804762-T-A 3936721-T-A **
4700863-C-A 4832822-C-A **
22164547-CAAAAA-C 20002661-CAAAAA-C 19×A**
18855423-G-T 16743543-G-T **
3889763-C-A 4021722-C-A **
3697081-G-T 3829040-G-T **
3712232-C-A 3844191-C-A **
3732156-A-C 3864115-A-C **
3804766-T-A 3936725-T-A **
3804769-T-A 3936728-T-A **
3815236-C-A 3947195-C-A **
3923378-T-C 4055337-T-C **
3638950-T-C 3770909-T-C **
3925354-AT-A 4057313-AT-A **
4012491-C-A 4144450-C-A **
4049642-A-T 4181601-A-T **
4063213-C-A 4195172-C-A **
4082639-C-A 4214598-C-A **
4138406-C-T 4270365-C-T **
4226025-G-T 4357984-G-T **
3657650-G-T 3789609-G-T **
3625865-A-C 3757824-A-C **
4268961-T-A 4400920-T-A **
2665883-C-T 2797842-C-T **
6460977-C-A 6592936-C-A **
7385294-C-A 7517253-C-A **
28520551-C-A 26374404-C-A **
4586063-C-A 4718022-C-A **
13483184-G-C 11327508-G-C **
19356368-G-T 17244488-G-T **
16471522-C-A 14359642-C-A **
2665889-T-C 2797848-T-C **
3544608-T-C 3676567-T-C **
2708631-T-A 2840590-T-A **
2855538-G-A 2987497-G-A **
2935178-C-A 3067137-C-A **
3153828-C-A 3285787-C-A **
3267320-A-T 3399279-A-T **
3389593-C-A 3521552-C-A **
3538787-A-T 3670746-A-T **
4240424-C-A 4372383-C-A **
4282558-C-A 4414517-C-A **
22689926-C-T 20528040-C-T **
5990830-C-A 6122789-C-A **
5635369-A-G 5767328-A-G **
5720037-C-A 5851996-C-A **
5857565-T-C 5989524-T-C **
5863859-C-A 5995818-C-A **
5864690-A-G 5996649-A-G **
5957372-A-G 6089331-A-G **
6048955-C-A 6180914-C-A **
5511961-C-A 5643920-C-A **
6093221-A-T 6225180-A-T **
6128663-C-A 6260622-C-A **
6369897-T-A 6501856-T-A **
6392567-C-A 6524526-C-A **
6424894-C-A 6556853-C-A **
6491371-T-C 6623330-T-C **
6510503-C-A 6642462-C-A **
5603981-C-A 5735940-C-A **
5503975-T-C 5635934-T-C **
4286882-C-A 4418841-C-A **
4831090-C-A 4963049-C-A **
4293539-T-G 4425498-T-G **
4374263-T-C 4506222-T-C **
4386073-C-A 4518032-C-A **
4426080-G-A 4558039-G-A **
4444784-A-C 4576743-A-C **
4534096-C-A 4666055-C-A **
4623030-A-T 4754989-A-T **
4887696-G-T 5019655-G-T **
5435797-A-G 5567756-A-G **
5107453-C-A 5239412-C-A **
5155143-C-A 5287102-C-A **
5171541-T-G 5303500-T-G **
5187146-C-A 5319105-C-A **
5204536-T-C 5336495-T-C **
5263516-C-A 5395475-C-A **
5359072-G-T 5491031-G-T **
10899890-G-T **
16952767-C-A 14840887-C-A **
4073513-G-T 4205472-G-T **
13859706-G-T 11739000-G-T **
10873828-G-A **
18422678-A-G 16310798-A-G P6_Gap **
16035771-C-A 13923891-C-A **
8911961-A-C 9043920-A-C **
6868952-C-A 7000911-C-A **
7229083-C-A 7361042-C-A **
18825652-G-T 16713772-G-T **
14009558-C-A 11888852-C-A **
18297912-C-T 16186032-C-T P6_Prx **
20840841-C-A 18678955-C-A P4_Gap **
14785524-T-A 12673594-T-A **
7724519-GA-G 7856478-GA-G 9×A**
28498124-C-A 26351977-C-A Y113093 **
7305542-C-CT 7437501-C-CT 10×T**
11038060-A-C **
6474669-C-A 6606628-C-A **
16786199-A-C 14674319-A-C **
18297921-A-C 16186041-A-C P6_Prx **
9979096-C-A 10141487-C-A **
14033933-C-A 11913227-C-A **
28614811-G-A 26468664-G-A **
10679171-A-C **
23317707-G-T 21155821-G-T **
10939732-T-C **
21141348-C-A 18979462-C-A **
21141381-G-A 18979495-G-A **
7423862-C-A 7555821-C-A **
24435580-C-A 22289433-C-A **
21323707-G-T 19161821-G-T **
11026033-C-A **
18855431-G-T 16743551-G-T **
10977112-C-A **
28803991-T-A 26657844-T-A **
16705481-C-A 14593601-C-A **
10764550-C-A **
15790405-C-A 13678525-C-A **
6996778-T-C 7128737-T-C **
21023251-T-TC 18861365-T-TC P4_Dst **
28804007-T-A 26657860-T-A **
10985186-TTCTAC-T **
28804024-G-C 26657877-G-C **
28791282-G-A 26645135-G-A **
11028164-C-G **
56847958-C-A **
11038059-A-C **
10754717-CTCCAT-C **
22231646-G-C 20069760-G-C DYZ19 ***
13866934-A-G 11746228-A-G ***
19389717-TAA-T,TA 17277837-TAA-T,TA 17×A***
58819437-T-C 56771434-A-G ***
3039839-C-CT 3171798-C-CT 22×T***
22270017-G-A 20108131-G-A DYZ19 ***
13446607-T-C 11290931-T-C ***
22231655-C-T 20069769-C-T BY3412 DYZ19 ***
13868884-C-T 11748178-C-T BY156381 ***
22435760-A-T 20273874-A-T DYZ19 ***
13457786-G-C 11302110-G-C 4×ATTCC***
13869226-A-G 11748520-A-G ***
22454823-A-C 20292937-A-C DYZ19 ***
56846959-C-A ***
58819383-C-G 56771488-G-C ***
58980637-T-C 56834490-T-C ***
13869227-A-T 11748521-A-T ***
56828324-C-G ***
13456151-C-T 11300475-C-T ***
13485821-G-C 11330145-G-C ***
13865814-G-C 11745108-G-C ***
13693913-C-G 11538237-C-G ***
13693906-T-C 11538230-T-C ***
13485747-G-C 11330071-G-C ***
13694387-G-T 11538711-G-T ***
18959298-TAA-T,TA 16847418-TAA-T,TA 23×A***
22454459-G-C 20292573-G-C DYZ19 ***
10767675-C-G ***
58819413-T-C 56771458-A-G ***
22241568-C-A 20079682-C-A DYZ19 ***
58819403-C-G 56771468-G-C ***
13739929-A-G 11584253-A-G ***
23742213-A-AT 21580327-A-AT ***
13693933-G-C 11538257-G-C ***
13478863-G-C 11323187-G-C ***
13676755-C-G 11521079-C-G ***
13820775-TATGGAATGGA-T,TATCGAATGGA 11700069-TATGGAATGGA-T,TATCGAATGGA 11×ATGGA***
58980228-G-C 56834081-G-C ***
23377937-C-T 21216051-C-T 6347953-G-AFGC14991 ***
13833547-T-G 11712841-T-G ***
13649003-GGAATT-G 11493327-GGAATT-G ***
13865759-A-C 11745053-A-C ***
13866699-A-G 11745993-A-G ***
13464359-T-G 11308683-T-G ***
13483226-T-A 11327550-T-A ***
13652031-A-T 11496355-A-T ***
13735009-A-T 11579333-A-T ***
13870087-T-A 11749381-T-A ***
13477148-C-T 11321472-C-T ***
28787306-A-G 26641159-A-G ***
13801470-A-C 11680764-A-C ***
22335999-T-G 20174113-T-G DYZ19 ***
58819451-C-T 56771420-G-A ***
22336000-T-G 20174114-T-G DYZ19 ***
13472602-G-C 11316926-G-C ***
58819387-C-T 56771484-G-A ***
13459333-T-C 11303657-T-C ***
22276338-C-T 20114452-C-T DYZ19 ***
13652096-T-A 11496420-T-A ***
13851771-G-C 11731065-G-C ***
28481093-A-G 26334946-A-G ***
13699230-C-A 11543554-C-A FGC1377 ***
13693685-CCTAGA-C 11538009-CCTAGA-C ***
13798973-G-A 11678267-G-A ***
13865812-A-G 11745106-A-G ***
13865813-T-G 11745107-T-G ***
13138255-A-C 10627741-A-C ***
13713707-A-G 11558031-A-G ***
22502673-G-C 20340787-G-C DYZ19 ***
28809440-G-T 26663293-G-T BY28214 ***
13479678-A-AACCC 11324002-A-AACCC ***
13652052-G-A 11496376-G-A ***
13652075-A-T 11496399-A-T ***
13652107-A-T 11496431-A-T ***
5493864-GTT-G 5625823-GTT-G 22×T***
13808764-G-C 11688058-G-C ***
15492003-T-C 13380123-T-C ***
16318902-C-T 14207022-C-T ***
16095302-T-C 13983422-T-C ***
13851306-G-A 11730600-G-A ***
13664816-A-G 11509140-A-G ***
13833430-T-A,G 11712724-T-A,G ***
15971741-GTTT-G 13859861-GTTT-G ***
15644472-A-G 13532592-A-G ***
14397698-T-C 12276994-T-C ***
16652965-A-T 14541085-A-T ***
13805359-A-T 11684653-A-T ***
13832575-G-A 11711869-G-A ***
13832645-C-A 11711939-C-A ***
13839845-G-T 11719139-G-T ***
9410308-C-T 9572699-C-T ***
7709390-C-CA 7841349-C-CA ***
7360210-C-T 7492169-C-T ***
16545414-CAAAAA-C,CAA 14433534-CAAAAA-C,CAA 24×A***
9981684-A-C 10144075-A-C ***
6590570-A-G 6722529-A-G ***
28787571-T-A 26641424-T-A ***
13664818-G-T 11509142-G-T ***
13801281-C-A 11680575-C-A ***
22241572-G-A 20079686-G-A DYZ19 ***
28787563-G-T 26641416-G-T ***
21639011-A-T 19477125-A-T ***
28787565-G-A 26641418-G-A ***
28787570-G-A 26641423-G-A ***
19439611-C-A 17327731-C-A ***
17455266-CA-C 15343386-CA-C ***
19439609-G-A 17327729-G-A ***
19113723-TAA-T,TA 17001843-TAA-T,TA 28×A***
18879757-A-G 16767877-A-G ***
58858962-T-C 56731909-A-G ***
13846215-T-G 11725509-T-G ***
13704269-T-G 11548593-T-G ***
17640961-A-G 15529081-A-G ***
19096748-GCA-G 16984868-GCA-G 13×CA***
13859917-A-G 11739211-A-G ***
6590564-C-T 6722523-C-T ***
13689209-TCAAAA-T 11533533-TCAAAA-T ***
13477279-C-A 11321603-C-A ***
13477154-C-G 11321478-C-G ***
13700313-A-C 11544637-A-C ***
6612904-G-A 6744863-G-A ***
13817920-C-A 11697214-C-A ***
28786778-C-G 26640631-C-G ***
13477287-G-T 11321611-G-T ***
13477282-G-T 11321606-G-T ***
13477247-C-G 11321571-C-G ***
13477153-T-A 11321477-T-A ***
13477217-G-T 11321541-G-T ***
28796289-A-G 26650142-A-G ***
18222936-CAA-C 16111056-CAA-C 11×A***
13485846-G-T 11330170-G-T ***
13686828-G-C 11531152-G-C ***
10759994-C-CTGGT ***
19439612-C-T 17327732-C-T ***
13850401-G-A 11729695-G-A ***
16095597-A-T 13983717-A-T ***
5563451-CTT-C 5695410-CTT-C 11×T***
28522376-CTT-C,CT 26376229-CTT-C,CT 18×T***
13869225-G-A 11748519-G-A ***
5036637-T-C 5168596-T-C ***
28785967-G-A 26639820-G-A ***
28800154-A-G 26654007-A-G ***
3764929-T-C 3896888-T-C ***
3501955-CAAAAA-C 3633914-CAAAAA-C 22×A***
58827209-CCATTCCATTTGATGT-C,CCATTCCATTTGATGC 56763632-GCATCAAATGGAATGA-G,GCATCAAATGGAATGG ***
10032097-G-A 10194488-G-A ***
23676894-CA-C 21515008-CA-C 11×A***
21698309-TAAAAAA-T 19536423-TAAAAAA-T 24×A***
4618500-CAA-C 4750459-CAA-C 13×A***
13868257-A-T 11747551-A-T ***
58975021-G-C 56828874-G-C ***
5169178-A-C 5301137-A-C ***
5169170-G-A 5301129-G-A ***
28785682-GAATTT-G 26639535-GAATTT-G ***
19979864-CTT-C 17867984-CTT-C P5_Prx 28×T***
13833621-G-C 11712915-G-C ***
13450146-C-T 11294470-C-T ***
13446784-C-T 11291108-C-T ***
13484618-T-C 11328942-T-C ***
4960634-A-T 5092593-A-T ***
8124920-TAAA-T 8256879-TAAA-T 15×A***
21092210-G-T 18930324-G-T ***
17082977-CCTTTCTTT-C,CCTTT 14971097-CCTTTCTTT-C,CCTTT 15×CTTT***
13474545-C-T 11318869-C-T ***
56834779-G-GCGTTCCATTC 4×CATTC***
8326493-A-G 8458452-A-G ***
7255171-GT-G 7387130-GT-G ***
21446259-G-T 19284373-G-T ***
13484619-A-G 11328943-A-G ***
10759984-C-G ***
16717389-T-C 14605509-T-C ***
13855522-GATGGAATGGAATGGA-G 11734816-GATGGAATGGAATGGA-G 11×ATGGA***
16707151-G-T 14595271-G-T ***
13512585-C-A 11356909-C-A ***
13236545-G-A 11080869-G-A ***
3403730-G-GA 3535689-G-GA 10×A***
16520863-G-T 14408983-G-T ***
13484166-C-A 11328490-C-A ***
16290757-CTA-C 14178877-CTA-C ***
9952221-C-A 10114612-C-A ***
6983589-C-CTG 7115548-C-CTG 20×TG***
18586724-A-G 16474844-A-G FGC14976 ***
21134925-ATTTTT-A 18973039-ATTTTT-A 22×T***
13484160-G-C 11328484-G-C ***
13484162-T-A 11328486-T-A ***
9823410-C-CGT 9985801-C-CGT 16×GT***
15392826-T-A 13280946-T-A ***
5231041-C-A 5363000-C-A ***
22502830-GTGCAGAGTTTCT-G,GTCCAGAGTTTCT 20340944-GTGCAGAGTTTCT-G,GTCCAGAGTTTCT DYZ19 ***
24472465-G-T 22326318-G-T ***
13458648-T-C 11302972-T-C ***
6024572-ATG-A 6156531-ATG-A ***
17804388-G-T 15692508-G-T ***
7289440-C-A 7421399-C-A ***
10937347-G-T ***
14656154-CAAAAA-C 12544219-CAAAAA-C 24×A***
6788962-C-T 6920921-C-T 6347953-G-AFGC14933 ***
13808742-A-AAGCAG 11688036-A-AAGCAG ***
19439625-G-A 17327745-G-A ***
17946635-CT-C,CTT 15834755-CT-C,CTT 20×T***
14786149-C-A 12674219-C-A ***
10760399-C-T ***
25995033-A-ATC 23848886-A-ATC P1_Y1 ***
16562782-TAAA-T 14450902-TAAA-T 18×A***
17313399-C-A 15201519-C-A Y71426 ***
14761057-C-A 12649126-C-A ***
3012654-C-A 3144613-C-A ***
10691196-C-A ***
14656148-T-C 12544213-T-C ***
14586026-G-T 12474226-G-T ***
15498665-C-A 13386785-C-A ***
13808714-G-GGTTTC 11688008-G-GGTTTC ***
13808727-A-C 11688021-A-C ***
13865969-CGAATGGAATGGAATGGAATGGAATG-C 11745263-CGAATGGAATGGAATGGAATGGAATG-C 12×GAATG***
8386194-C-A 8518153-C-A ***
3128140-C-A 3260099-C-A ***
8907720-A-T 9039679-A-T ***
9908264-G-T 10070655-G-T ***
56833683-C-A ***
11671620-G-A ***
13808751-A-ACACGG 11688045-A-ACACGG ***
7270301-TG-T,TT 7402260-TG-T,TT ***
15927185-T-C 13815305-T-C FGC14968 ***
10788101-C-A ***
10763159-T-A ***
10887874-G-T ***
15279083-C-A 13167182-C-A ***
15500756-C-A 13388876-C-A ***
7613830-T-A 7745789-T-A ***
15557469-TA-T 13445589-TA-T 10×A***
10678865-G-A ***
15396716-C-A 13284836-C-A ***
10678881-G-C ***
13483280-A-C 11327604-A-C ***
7723814-G-A 7855773-G-A YFS233475 ***
6091118-C-T 6223077-C-T ***
9310573-T-C 9472964-T-C ***
13479701-G-T 11324025-G-T ***
13446863-T-C 11291187-T-C ***
10767676-C-A ***
13457785-T-TGATTCCATTC 11302109-T-TGATTCCATTC ***
13461026-G-A 11305350-G-A ***
13461141-C-T 11305465-C-T ***
13473705-G-C 11318029-G-C F18179 ***
13479706-C-A 11324030-C-A ***
13140575-T-C 10630061-T-C ***
13676765-C-G 11521089-C-G ***
21554366-C-T 19392480-C-T ***
13693922-GGAATGCTATC-G 11538246-GGAATGCTATC-G ***
13801511-A-G 11680805-A-G ***
13805396-TGAATG-C 11684690-TGAATG-C 11×GAATG***
13808684-A-C 11687978-A-C ***
13808685-C-A 11687979-C-A 10×AATGG***
13446779-C-T 11291103-C-T ***
13138253-G-T 10627739-G-T ***
13817935-C-A 11697229-C-A ***
13823135-C-A 11702429-C-A ***
13699231-G-A 11543555-G-A BY88985 ***
13856392-G-A 11735686-G-A ***
22893304-CCTTT-C,CCTTTCTTT 20731418-CCTTT-C,CCTTTCTTT 17×CTTT***
58983020-A-ACATTCCATTCCACTCCATTC,C 56836873-A-ACATTCCATTCCACTCCATTC,C ***
9191076-AAC-A 9353467-AAC-A 20×AC***
13138803-T-C 10628289-T-C ***
13700358-C-G 11544682-C-G BY89018 ***
22454453-C-G 20292567-C-G DYZ19 ***
13138230-G-A 10627716-G-A BY209736 ***
13866697-T-A 11745991-T-A ***
13138163-C-T 10627649-C-T ***
13138168-C-T 10627654-C-T ***
22430109-A-T 20268223-A-T DYZ19 ***
22425534-A-G 20263648-A-G DYZ19 ***
13138183-C-T 10627669-C-T ***
13138209-CCCATT-C,TCCAAT 10627695-CCCATT-C,TCCAAT ***
13817847-AGAATC-G 11697141-AGAATC-G ***
13821241-A-G 11700535-A-G ***
3912233-CT-C 4044192-CT-C 14×T***
7190738-C-A 7322697-C-A ***
58819414-A-T 56771457-T-A ***
58819449-T-A 56771422-A-T ***
58821406-G-C 56769465-C-G ***
13451191-T-C,TCCATTCTATTCCACTCCATTCCACTCCATTC 11295515-T-C,TCCATTCTATTCCACTCCATTCCACTCCATTC ***
18147554-C-T 16035674-C-T ***
13254894-C-T 11099218-C-T ***
7199199-C-T 7331158-C-T ***
13484622-A-C 11328946-A-C ***
28800254-G-A 26654107-G-A ***
9003706-AT-A 9166097-AT-A 10×T***
2888231-A-AT 3020190-A-AT 12×T***
7165327-C-T 7297286-C-T ***
13478257-G-C 11322581-G-C ***
56826832-GATTCCATTCCATTCGATTCCATTCCATTCA-G,GATTCCATTCCATTCGATTCCATTCCATTCG ***
13140220-CTATTG-C,CCATTC 10629706-CTATTG-C,CCATTC ***
16598980-TCAA-T 14487100-TCAA-T ***
6674465-ATTT-A,ATT 6806424-ATTT-A,ATT 16×T***
28785968-G-A 26639821-G-A ***
13823122-C-G 11702416-C-G ***
22305818-G-T 20143932-G-T DYZ19 ***
13832647-C-G 11711941-C-G ***
13845643-C-A 11724937-C-A ***
13859779-C-G 11739073-C-G ***
13865840-C-T 11745134-C-T ***
13868296-G-GAATGGAATGA 11747590-G-GAATGGAATGA ***
21477223-CTTA-C,CTTC 19315337-CTTA-C,CTTC ***
22218383-T-G 20056497-T-G FGC24729 DYZ19 ***
22306281-C-T 20144395-C-T DYZ19 ***
26928181-T-A 24782034-T-A FGC82726 P1_r3 9×A***
22436124-C-G 20274238-C-G DYZ19 ***
22446463-A-T 20284577-A-T DYZ19 ***
22498760-A-G 20336874-A-G DYZ19 ***
22498768-C-G 20336882-C-G DYZ19 ***
23713748-ATG-A 21551862-ATG-A 19×TG***
24333195-CT-C 22187048-CT-C P3_t1 ***
26282942-T-C 24136795-T-C P1_Y1 ***
58819412-C-T 56771459-G-A ***

In the table above, the meaning of the confidence field depends on whether the data comes from an FTDNA kit or an FGC kit. For FTDNA kits, + implies a "PASS" result with just one possible variant, * indicates a "PASS" but with multiple variants, ** indicates "REJECTED" with just a single variant, and *** indicates "REJECTED" with multiple possible variants. 'A*' are heterozygous variants not called by FTDNA, but still pulled from the VCF file. For FGC kits, + indicates over 99% likely genuine (95% for INDELs); * over 95% likely genuine (90% for INDELs); ** about 40% likely genuine; *** about 10% likely genuine. Manual entries read directly from a BAM file will be either + indicating positive, or * indicating that the data show a mixture of possible variants.

For the FTDNA kits, the BED data is encoded in the background color of the cells. Those cells with a white background have coverage, those with a grey background indicate no coverage in the BED file, and those with a pink background indicate the mutation is on the edge of a coverage region. These pink regions often indicate that the individual may be positive for a SNP even if there is no corresponding entry in the vcf file.

The combBED column indicates whether or not the mutation is a SNP and falls in the combBED region defined in Defining a New Rate Constant for Y-Chromosome SNPs based on Full Sequencing Data by Dmitry Adamov, Vladimir Guryanov, Sergey Karzhavin, Vladimir Tagankin, Vadim Urasin.

The McDonald BED column indicates whether or not the mutation is a SNP and falls in the BED region used by Dr. Iain McDonald in the age analysis he does for R-U106 men.

Age Analysis Information (work in progress)

AllMcDonaldYFull
Kit: 214181072542777673377844916
Kit: 21418975009779151807800407
Kit: 214181493114493503458283103
Used in age calculations1493114493503458283103
Counts of SNPs3332
Variant counts last updated 2019-10-28 04:27:50.



Big Tree Main Page