Tree Position

R-P312/S116 > Z290 > L21/S145 > S552 > DF13 > DF21/S192 > FGC3213 > ZZ1 > S3058 > S424 > S426 > S190 > FGC3215 > Z36747 > Y16487 > Y16486

Unique Mutations

The mutations unique to this man are summarized in the table below. Those with a '+' or '*' confidence level are considered by FamilyTreeDNA or FullGenomesCorp to be high quality SNPs/INDELs. For completeness, all other mutations of lesser confidence are included as well. These additional mutations may be useful for distinguishing between very closely related men.

Occasionally, some of the mutations listed here will be thought to be shared with other men in which case they might appear in upstream blocks on the tree. When this happens, the 'Blocks' field will indicate what block they appear in. Such a situation might arise with BigY men if the BED data suggests another man may be positive for a SNP, even though it doesn't appear in his VCF data. It might also happen if Chromo2 testing or Sanger sequencing of other men not on the tree show the SNP to be shared.

POS-REF-ALT (hg19) POS-REF-ALT (hg38) Blocks Names Region McDonald BED combBED STRFB38
82962-A
BigY3
82962
FTDNA
82962
BigY2
82962
Manual
Edits
16146479-A-AAAAGAAAG 14034599-A-AAAAGAAAG P8_Dst 12×AAAGA*
20951237-C-T 18789351-C-T P4_Dst A*
20692958-C-T 18531072-C-T P4_Prx A*
16146466-T-A 14034586-T-A P8_Dst A*
19753426-A-T 17641546-A-T P5_Prx A*
20958989-A-T 18797103-A-T P4_Dst A*
20795930-G-T 18634044-G-T P4_Prx 8×AA*
20951215-A-T 18789329-A-T P4_Dst A*
20379787-G-T 18217901-G-T P5_Dst A*
20883163-A-T 18721277-A-T P4_Dst A*
19749297-A-T 17637417-A-T P5_Prx A*
20640924-G-T 18479038-G-T P4_Prx A*
20741872-C-T 18579986-C-T P4_Prx A*
18286013-C-A 16174133-C-A P6_Prx A*
20771712-C-A 18609826-C-A P4_Prx A*
19963686-G-A 17851806-G-A P5_Prx A*
14363207-G-T 12242502-G-T YYA*
16104868-C-A 13992988-C-A P8_Prx A*
16136055-C-T 14024175-C-T P8_Dst A*
16146050-G-A 14034170-G-A P8_Dst A*
18369789-C-G 16257909-C-G P6_Prx A*
18369798-G-C 16257918-G-C P6_Prx A*
18472000-T-C 16360120-T-C P6_Dst A*
18526790-G-A 16414910-G-A P6_Dst A*
19589874-C-A 17477994-C-A P5_Prx YA*
19593755-G-T 17481875-G-T P5_Prx YA*
19600885-C-A 17489005-C-A P5_Prx YA*
19636148-G-T 17524268-G-T P5_Prx A*
19671958-C-A 17560078-C-A P5_Prx A*
19745516-G-T 17633636-G-T P5_Prx A*
19771728-C-A 17659848-C-A P5_Prx A*
19792481-A-T 17680601-A-T P5_Prx A*
19846588-A-T 17734708-A-T P5_Prx A*
19894243-A-G 17782363-A-G P5_Prx A*
19928610-C-A 17816730-C-A P5_Prx A*
19929224-C-A 17817344-C-A P5_Prx A*
19963364-C-A 17851484-C-A P5_Prx A*
19972511-C-A 17860631-C-A P5_Prx A*
19978624-T-A 17866744-T-A P5_Prx A*
20082833-C-A 17970953-C-A P5_Dst A*
20221516-C-T 18059630-C-T P5_Dst A*
20247095-G-T 18085209-G-T P5_Dst A*
20326107-C-T 18164221-C-T P5_Dst A*
20363267-C-A 18201381-C-A P5_Dst A*
20472075-A-T 18310189-A-T P5_Dst A*
20501075-C-G 18339189-C-G P5_Dst A*
20763753-C-A 18601867-C-A P4_Prx A*
20793616-G-T 18631730-G-T P4_Prx A*
20795903-C-T 18634017-C-T P4_Prx A*
20844328-G-T 18682442-G-T P4_Dst A*
20863679-G-T 18701793-G-T P4_Dst A*
20882034-G-T 18720148-G-T P4_Dst A*
20887025-A-G 18725139-A-G P4_Dst A*
20908595-G-T 18746709-G-T P4_Dst A*
20951293-T-G 18789407-T-G P4_Dst A*
20970347-G-A 18808461-G-A P4_Dst A*
20984579-T-C 18822693-T-C P4_Dst A*
21027795-C-A 18865909-C-A P4_Dst YA*
13449900-C-T 11294224-C-T A*
56833501-T-G A*
13816627-GGGAATGGAAT-G 11695921-GGGAATGGAAT-G 8×GGAAT+*****
10060163-C-A 10222554-C-A Y89564 +++**
17255843-T-A 15143963-T-A Y98606 YY++++
18903536-C-A 16791656-C-A Y102993 YY++++
22465017-G-C 20303131-G-C BY221447 DYZ19 +**++
22597265-T-C 20435379-T-C Y109228 YY++++
7730475-CATACATACATAC-G 7862434-CATACATACATAC-G +
25339574-T-A 23193427-T-A A5322A5329 P2_r1 *
59016450-TG-CA 56870303-TG-CA *
7730471-GATACATACATAC-G 7862430-GATACATACATAC-G 10×ATAC*
56838338-C-A **
13271204-TA-T,TAA 11115528-TA-T,TAA 12×A*
5486757-T-C 5618716-T-C *
13447111-CCATTCCATTCCATTCCATTC-A 11291435-CCATTCCATTCCATTCCATTC-A *
13263115-CGAG-TGAA 11107439-CGAG-TGAA *
13450319-AA-CA,CC 11294643-AA-CA,CC *
13450998-TTCCACTT-CTCCACTC,CTCCACTT 11295322-TTCCACTT-CTCCACTC,CTCCACTT *
13451163-TATTCCA-CACTCCT 11295487-TATTCCA-CACTCCT *
13452369-TTCCATTCCATTCCATTCCATTCCATTCAAATACACTCCT-GTCAAATCCACTCCA 11296693-TTCCATTCCATTCCATTCCATTCCATTCAAATACACTCCT-GTCAAATCCACTCCA *
13471806-ACCTTG-GCCTTT 11316130-ACCTTG-GCCTTT *
13488933-TTG-GTG,TTT 11333257-TTG-GTG,TTT *
13688835-GG-TT 11533159-GG-TT *
56824027-AAA-A,T *
56832401-CA-CG,TG *
56834247-CCGTTC-CCATTCCGTTC,T *
56861817-AAAAAAAAAAAAAAAAAAAAAACCTG-AAAAAAAAAAAACCTA,CAAACAAACAAACAAACAAAAAAAACCTA *
56881159-CAAAACAAAACA-CAAAACA,GCAAAACAAAACAAAACAAAAC *
9211271-CACAC-A,CACACAC 9373662-CACAC-A,CACACAC *
9636618-TTG-T,TTGTG 9799009-TTG-T,TTGTG IR3_Prx 13×TG*
22358237-TAAGG-AAAGG,TAAGA 20196351-TAAGG-AAAGG,TAAGA DYZ19 *
22454661-T-A 20292775-T-A DYZ19 *
22502083-CCAGT-CCAGA,TCAGA 20340197-CCAGT-CCAGA,TCAGA DYZ19 *
22236450-G-T 20074564-G-T DYZ19 **
25524693-CT-C 23378546-CT-C P1_gr1 33×T**
22241388-G-T 20079502-G-T DYZ19 **
22342626-A-T 20180740-A-T DYZ19 **
18534159-TAC-T 16422279-TAC-T P6_Dst **
22479601-A-G 20317715-A-G BY25220 DYZ19 **
22479595-G-T 20317709-G-T BY25218 DYZ19 **
27400007-T-C 25253860-T-C P1_g3 **
13724179-TG-AC 11568503-TG-AC **
22367118-GA-TG 20205232-GA-TG DYZ19 **
22085598-C-A 19923712-C-A Z3644 **
9535155-ATT-A 9697546-ATT-A IR3_Prx 17×T**
22234331-TCTATCAGT-CCACCGTA 20072445-TCTATCAGT-CCACCGTA DYZ19 **
24490845-G-T 22344698-G-T **
22346809-A-T 20184923-A-T DYZ19 **
58992457-A-C 56846310-A-C **
58992459-T-C 56846312-T-C **
13734091-A-G 11578415-A-G 8×GAATG**
13447807-G-T 11292131-G-T **
27341881-G-T 25195734-G-T P1_g3 **
18928141-C-G 16816261-C-G **
20991160-ATT-A 18829274-ATT-A P4_Dst 18×T**
21003856-G-GC 18841970-G-GC P4_Dst **
13485860-G-T 11330184-G-T **
18609432-C-A 16497552-C-A **
8481937-C-A 8613896-C-A **
3010317-C-A 3142276-C-A **
3251304-C-A 3383263-C-A **
3491664-C-A 3623623-C-A **
4027212-C-A 4159171-C-A **
4217682-T-C 4349641-T-C **
4258641-C-A 4390600-C-A **
4321061-G-T 4453020-G-T **
4369081-G-T 4501040-G-T **
5537505-C-A 5669464-C-A **
5666846-C-A 5798805-C-A **
5738710-C-A 5870669-C-A **
6183295-T-C 6315254-T-C IR3_Dst **
6350701-C-A 6482660-C-A **
6533742-G-T 6665701-G-T **
6663213-T-A 6795172-T-A **
6751610-C-A 6883569-C-A **
7080587-C-A 7212546-C-A **
7258563-C-A 7390522-C-A **
7754389-G-A 7886348-G-A **
7958407-C-A 8090366-C-A **
8262773-C-A 8394732-C-A **
8672977-G-T 8804936-G-T **
8816493-C-A 8948452-C-A **
8822641-G-T 8954600-G-T **
9381898-C-A 9544289-C-A **
9991949-C-A 10154340-C-A **
10042275-G-T 10204666-G-T **
10648054-C-T **
10648063-A-C **
10657275-C-A **
10658306-C-A **
10658398-C-A **
10658467-C-A **
10659544-T-A **
10669309-A-G **
10676984-C-T **
10749720-GCCATT-G **
10776603-A-C **
10779035-C-A **
10795056-C-CCATTT **
10795067-C-CAATCT **
10795074-T-C **
10797516-G-T **
10800754-G-T **
10817483-C-A **
10822868-C-A **
10822988-C-A **
10825285-C-CGGTTA **
10825309-C-T **
10829099-G-T **
10842554-C-A **
10878245-A-G **
10901324-CCGTTA-C **
10901340-CT-C **
10901343-T-TG **
10901364-C-A **
10901376-A-C **
10901379-T-G **
10901388-C-G **
10923706-C-T **
10923719-C-A **
10923736-C-T **
10923743-C-T **
10934893-A-T **
10934934-A-T **
10945645-C-A **
10955991-A-G **
10992916-C-A **
11014897-G-T **
11028209-C-A **
11030533-A-T **
13254468-C-A 11098792-C-A FT265125 **
13725994-T-C 11570318-T-C **
11660006-G-T **
13903087-G-T 11782381-G-T **
13903095-G-T 11782389-G-T **
14228682-G-T 12107976-G-T **
14303027-G-T 12182321-G-T Y90998 **
14413704-C-A 12293001-C-A **
14508486-G-T 12396691-G-T **
14554285-C-A 12442486-C-A **
14716626-C-A 12604694-C-A **
15475023-C-A 13363143-C-A **
15485503-C-A 13373623-C-A Y93900 **
15740514-A-G 13628634-A-G **
16036350-C-A 13924470-C-A **
16317112-G-T 14205232-G-T **
16376578-C-A 14264698-C-A **
16432557-C-A 14320677-C-A **
16540015-C-A 14428135-C-A **
16550948-C-A 14439068-C-A **
16663760-A-T 14551880-A-T **
17046638-C-A 14934758-C-A **
17327200-A-G 15215320-A-G **
17929516-A-C 15817636-A-C **
18190857-A-T 16078977-A-T **
18743437-C-A 16631557-C-A FT452166 **
20695483-CAAACA-C 18533597-CAAACA-C P4_Prx **
21202354-C-A 19040468-C-A **
22076254-G-T 19914368-G-T **
22855046-G-T 20693160-G-T **
24278099-C-A 22131952-C-A P3_b1 **
25898604-C-A 23752457-C-A P1_Y1 **
26100854-G-T 23954707-G-T P1_Y1 **
28076509-T-C 25930362-T-C P1_Y2 **
28765373-G-T 26619226-G-T **
28808596-C-T 26662449-C-T **
56827472-G-T **
56834615-C-A **
56834618-C-T **
56848858-C-A **
56852727-C-A **
56881929-G-T **
19612058-A-AG 17500178-A-AG P5_Prx **
16990223-CAAA-C 14878343-CAAA-C 24×A**
6944943-CAAAA-C 7076902-CAAAA-C 28×A**
13705496-G-C 11549820-G-C **
18534201-TACAC-T 16422321-TACAC-T P6_Dst 8×AC**
20216467-G-T 18054581-G-T P5_Dst **
28397239-C-CAAA 26251092-C-CAAA P1_gr2 20×A**
13734017-G-T 11578341-G-T **
13734042-C-T 11578366-C-T **
13734010-T-C 11578334-T-C **
6089764-G-T 6221723-G-T 31×T**
22352594-TTAAT-CTAAA 20190708-TTAAT-CTAAA DYZ19 **
5949060-A-AC 6081019-A-AC ****
56854484-C-A *****
13734177-GAATGGA-TG 11578501-GAATGGA-TG **
22577948-CTTG-ATTT 20416062-CTTG-ATTT **
28456967-A-G 26310820-A-G P1_gr2 **
20932612-GA-G 18770726-GA-G P4_Dst 17×A**
6126924-CC-AA 6258883-CC-AA **
8125051-AGAAGAGAAGAG-GAGAAGAGAGAGA 8257010-AGAAGAGAAGAG-GAGAAGAGAGAGA **
8824887-T-A 8956846-T-A **
10615535-C-A **
13723716-TAA-GG 11568040-TAA-GG **
13724185-A-T 11568509-A-T **
13724243-CCATTG-GTATGA 11568567-CCATTG-GTATGA **
13726318-ATGT-CTGA 11570642-ATGT-CTGA **
13728010-GAAATA-TAAAAG 11572334-GAAATA-TAAAAG **
16250624-G-TTT 14138744-G-TTT 28×T**
22962008-G-TT 20800122-G-TT 27×T**
23471052-AAAA-G 21309166-AAAA-G **
16118279-CAAA-C 14006399-CAAA-C P8_Prx 27×A**
16146477-AGA-GAAAAGAAAG 14034597-AGA-GAAAAGAAAG P8_Dst **
18487792-G-T 16375912-G-T P6_Dst **
18487794-G-T 16375914-G-T P6_Dst **
20309353-CAA-C 18147467-CAA-C P5_Dst **
20431070-AGGT-TGGC 18269184-AGGT-TGGC P5_Dst **
20510958-AGGAT-TGGA 18349072-AGGAT-TGGA P5_Dst **
20529756-C-T 18367870-C-T P5_Dst **
20872434-AT-A 18710548-AT-A P4_Dst 25×T**
20892789-C-T 18730903-C-T P4_Dst **
20945546-A-G 18783660-A-G P4_Dst **
21018697-G-C 18856811-G-C P4_Dst **
22194474-T-C 20032588-T-C **
22342645-G-T 20180759-G-T DYZ19 **
22342657-G-T 20180771-G-T DYZ19 **
22342697-G-T 20180811-G-T DYZ19 **
22342727-G-C 20180841-G-C DYZ19 **
25685995-C-A 23539848-C-A P1_b3 **
26105246-TG-T 23959099-TG-T P1_Y1 **
26994230-A-G 24848083-A-G P1_r4 **
27286455-A-G 25140308-A-G P1_g3 **
27382533-A-G 25236386-A-G P1_g3 **
27638148-C-CAA 25492001-C-CAA P1_Y2 20×A**
27645015-T-C 25498868-T-C P1_Y2 **
27645026-C-A 25498879-C-A P1_Y2 **
27648082-A-T 25501935-A-T P1_Y2 **
27692973-CT-C 25546826-CT-C P1_Y2 15×T**
27938402-A-T 25792255-A-T P1_Y2 **
27956808-T-C 25810661-T-C P1_Y2 **
28025465-A-G 25879318-A-G P1_Y2 **
28144962-A-C 25998815-A-C P1_b4 **
28238538-CT-C 26092391-CT-C P1_b4 **
28393369-G-T 26247222-G-T P1_gr2 **
28398613-C-T 26252466-C-T P1_gr2 **
28445214-G-A 26299067-G-A P1_gr2 **
28445227-TGGTG-CGGTA 26299080-TGGTG-CGGTA P1_gr2 **
28446476-C-T 26300329-C-T P1_gr2 **
6989106-T-A 7121065-T-A ***
22426353-G-C 20264467-G-C DYZ19 ***
22490951-T-G 20329065-T-G DYZ19 ***
22282793-C-G 20120907-C-G DYZ19 ***
27237174-G-T 25091027-G-T P1_g3 ***
28359912-T-C 26213765-T-C P1_gr2 ***
13809134-G-C 11688428-G-C ***
10039839-G-A,T 10202230-G-A,T ***
25370964-A-G 23224817-A-G FGC78375 P2_r2 ***
25072260-A-AT 22926113-A-AT g1 16×T***
28360032-G-C 26213885-G-C P1_gr2 ***
22359935-G-C 20198049-G-C DYZ19 ***
17441175-AATATATATAT-A 15329295-AATATATATAT-A 20×AT***
28444019-A-G 26297872-A-G P1_gr2 ***
22503119-T-C 20341233-T-C DYZ19 ***
6674498-C-T 6806457-C-T ***
6953238-GAC-G 7085197-GAC-G ***
15196747-G-T 13084833-G-T ***
27484483-C-G 25338336-C-G P1_Y2 ***
22479589-C-G 20317703-C-G Z25184 DYZ19 ***
22358969-G-T 20197083-G-T DYZ19 ***
26283209-C-CA 24137062-C-CA P1_Y1 21×A***
9730344-C-CAT 9892735-C-CAT IR3_Prx ***
21912180-C-A 19750294-C-A ***
7196046-CTTTTT-C 7328005-CTTTTT-C 16×T***
22360838-CTTAA-TTTAC 20198952-CTTAA-TTTAC DYZ19 ***
22236364-TTG-CTA 20074478-TTG-CTA DYZ19 ***
22352549-A-C 20190663-A-C DYZ19 ***
22435283-T-A 20273397-T-A DYZ19 ***
22295937-C-T 20134051-C-T DYZ19 ***
19892868-G-TT 17780988-G-TT P5_Prx 31×T***
19605428-T-A 17493548-T-A P5_Prx ***
19605435-C-A 17493555-C-A P5_Prx ***
13463768-G-GA 11308092-G-GA ***
22510013-G-C 20348127-G-C DYZ19 ***
22508949-G-T 20347063-G-T DYZ19 ***
19605363-G-A 17493483-G-A P5_Prx ***
19605393-A-G 17493513-A-G P5_Prx ***
22259988-G-T 20098102-G-T DYZ19 ***
23134094-C-A 20972208-C-A BY143244 ***
19605324-G-A 17493444-G-A P5_Prx ***
19605329-T-C 17493449-T-C P5_Prx ***
9964625-A-G 10127016-A-G ***
22259460-C-T 20097574-C-T DYZ19 ***
13463707-G-T 11308031-G-T ***
16119959-TTTTCTTTCTTTC-T,TTTTCTTTCTTTCTTTCTTTC 14008079-TTTTCTTTCTTTC-T,TTTTCTTTCTTTCTTTCTTTC P8_Prx 12×TTTC***
22489902-T-C 20328016-T-C DYZ19 ***
22439130-T-C 20277244-T-C DYZ19 ***
10807232-C-A ***
15928399-C-T 13816519-C-T ***
7374587-C-A 7506546-C-A ***
2746646-C-A 2878605-C-A ***
2810390-GA-A,GG 2942349-GA-A,GG ***
2869072-G-T 3001031-G-T ***
5577196-C-A 5709155-C-A ***
6355615-TC-T 6487574-TC-T ***
6434738-C-A 6566697-C-A ***
6689854-C-A 6821813-C-A ***
6697303-A-T 6829262-A-T ***
6792627-TC-T 6924586-TC-T ***
6825252-G-T 6957211-G-T ***
6840812-G-T 6972771-G-T ***
6840837-C-A 6972796-C-A ***
6840866-C-A 6972825-C-A ***
6910462-C-T 7042421-C-T ***
7098886-T-A 7230845-T-A ***
7142514-C-T 7274473-C-T ***
7188557-C-A 7320516-C-A ***
7316677-G-T 7448636-G-T ***
7363613-C-A 7495572-C-A ***
7407066-C-A 7539025-C-A ***
7534467-C-A 7666426-C-A ***
7646441-G-T 7778400-G-T ***
7669231-C-A 7801190-C-A ***
7801127-C-A 7933086-C-A ***
7870466-T-C 8002425-T-C ***
7927959-G-T 8059918-G-T ***
8076627-C-A 8208586-C-A ***
8078462-A-G 8210421-A-G ***
8209410-C-A 8341369-C-A ***
8244031-C-A 8375990-C-A ***
8439428-T-A 8571387-T-A ***
8501254-C-A 8633213-C-A ***
8566864-C-A 8698823-C-A ***
8636054-G-T 8768013-G-T ***
8735794-A-G 8867753-A-G ***
8766255-G-T 8898214-G-T ***
8832628-C-A 8964587-C-A ***
9020498-G-T 9182889-G-T ***
9068895-G-T 9231286-G-T ***
9462044-G-T 9624435-G-T ***
9647644-G-T 9810035-G-T BY156090 IR3_Prx ***
9647657-G-T 9810048-G-T IR3_Prx ***
9771079-G-T 9933470-G-T ***
9771083-C-T 9933474-C-T FT67504 ***
9875134-C-A 10037525-C-A ***
9886572-C-A 10048963-C-A ***
9979359-C-G 10141750-C-G ***
10657411-A-T ***
10657414-C-A ***
10817600-G-T ***
10835556-G-A ***
10990868-G-T ***
10992370-C-A ***
13459479-C-A 11303803-C-A ***
13479112-C-A 11323436-C-A ***
13483862-C-A 11328186-C-A ***
13486385-C-A 11330709-C-A ***
13642863-A-G 11487187-A-G ***
13681384-C-A 11525708-C-A ***
13825161-C-A 11704455-C-A ***
13825165-C-A 11704459-C-A ***
13841460-G-T 11720754-G-T FT209446 ***
14065797-C-A 11945091-C-A ***
14103369-C-A 11982663-C-A ***
14253357-G-A 12132651-G-A ***
14384535-G-T 12263831-G-T ***
14639279-C-T 12527348-C-T ***
14900690-G-T 12788757-G-T ***
14900848-T-C 12788915-T-C ***
15074488-TTTGAA-T 12962578-TTTGAA-T ***
15260728-G-T 13148812-G-T ***
15340399-TTTG-T 13228518-TTTG-T ***
15451624-C-A 13339744-C-A ***
15593255-C-A 13481375-C-A ***
15664090-C-A 13552210-C-A ***
15858507-A-G 13746627-A-G ***
15947203-C-A 13835323-C-A ***
16047273-C-A 13935393-C-A Y95395 ***
16441135-C-A 14329255-C-A ***
16707171-C-A 14595291-C-A ***
16729481-G-A 14617601-G-A ***
17050116-C-T 14938236-C-T ***
17050126-C-A 14938246-C-A ***
17121428-G-T 15009548-G-T ***
17332731-G-A 15220851-G-A ***
17693587-C-A 15581707-C-A ***
18052589-C-T 15940709-C-T ***
18190910-G-T 16079030-G-T ***
18288648-G-T 16176768-G-T P6_Prx ***
18793569-G-T 16681689-G-T ***
19007619-CAT-C,CATAT 16895739-CAT-C,CATAT 10×AT***
19126242-C-A 17014362-C-A ***
19213264-C-A 17101384-C-A ***
19226422-C-A 17114542-C-A ***
20459023-C-A 18297137-C-A P5_Dst ***
21054212-T-C 18892326-T-C ***
21189658-G-A 19027772-G-A ***
21262471-C-A 19100585-C-A A15565 ***
21295226-A-G 19133340-A-G ***
21300198-G-T 19138312-G-T ***
21409218-C-A 19247332-C-A ***
21425383-T-C 19263497-T-C ***
21565997-A-G 19404111-A-G ***
21766533-AATATATAT-A 19604647-AATATATAT-A 19×AT***
21891062-C-A 19729176-C-A ***
21971652-C-A 19809766-C-A ***
22023708-A-G 19861822-A-G ***
22200384-C-A 20038498-C-A ***
22209102-T-C 20047216-T-C ***
22961922-C-A 20800036-C-A ***
23315747-G-T 21153861-G-T ***
28463022-C-A 26316875-C-A ***
28521259-C-A 26375112-C-A ***
28760352-C-A 26614205-C-A ***
58883633-G-C 56707238-C-G ***
56724863-G-A ***
56826258-C-T ***
56831894-ATTCCT-A,ATTCCA ***
56835873-C-T ***
22315954-T-C 20154068-T-C DYZ19 ***
23772621-AT-A 21610735-AT-A 8×T***
28747705-ATTTTT-A 26601558-ATTTTT-A 27×T***
27889296-A-AAT 25743149-A-AAT P1_Y2 ***
21464536-CAA-C,CA 19302650-CAA-C,CA 19×A***
24782318-ATT-A 22636171-ATT-A P3_b2 16×T***
15479942-CTTT-C,CTT 13368062-CTTT-C,CTT 21×T***
13708518-A-C 11552842-A-C ***
13698613-G-A 11542937-G-A ***
28360063-G-A 26213916-G-A P1_gr2 ***
21363090-CA-C,CAA 19201204-CA-C,CAA 16×A***
27365809-G-A 25219662-G-A P1_g3 ***
22301062-G-A 20139176-G-A DYZ19 ***
22454537-A-G 20292651-A-G DYZ19 ***
22502024-T-A 20340138-T-A DYZ19 ***
22502861-A-T 20340975-A-T DYZ19 ***
24849943-T-C 22703796-T-C IR1_R ***
27778405-T-G 25632258-T-G P1_Y2 ***
19709709-CAA-C 17597829-CAA-C P5_Prx 29×A***
23435682-CT-C,CTT 21273796-CT-C,CTT 21×T***
3270922-TA-T 3402881-TA-T ***
4427295-G-C 4559254-G-C ***
6126238-T-G 6258197-T-G ***
8062772-A-G 8194731-A-G ******
13448640-ATTCCATTCCATTCCATTCCATTC-A,ATCCATTCCATTC 11292964-ATTCCATTCCATTCCATTCCATTC-A,ATCCATTCCATTC ***
15480292-T-C 13368412-T-C ******
15480298-T-C 13368418-T-C ******
13488675-CGCGCCA-TGCGACG 11332999-CGCGCCA-TGCGACG ***
10691348-ATTCCATTCCATTCCATTCCATTCCATTCCA-T ***
10673970-TTG-ATA ***
27363696-A-T 25217549-A-T P1_g3 ***
28315828-CTG-C 26169681-CTG-C P1_b4 21×TG***
22443512-T-G 20281626-T-G DYZ19 ***
24323664-TA-T 22177517-TA-T P3_t1 14×A***
28395566-AT-A 26249419-AT-A P1_gr2 12×T***
28408660-T-C 26262513-T-C P1_gr2 ***
13530026-AGCT-GGCC 11374350-AGCT-GGCC ***
22457038-T-A 20295152-T-A DYZ19 ***
27541802-A-G 25395655-A-G P1_Y2 ***
28380631-T-TC 26234484-T-TC P1_gr2 ***
2752413-GTTA-GTT,TTTAA 2884372-GTTA-GTT,TTTAA ***
3446607-CAAA-C,CAA 3578566-CAAA-C,CAA 25×A***
3587251-C-A 3719210-C-A ***
5784062-CAA-C,CAAA 5916021-CAA-C,CAAA 21×A***
6020688-GT-G,TT 6152647-GT-G,TT 23×T***
13487751-CCACA-ACACC 11332075-CCACA-ACACC ***
13488621-AGCTTTT-GGCTTC 11332945-AGCTTTT-GGCTTC ***
13489298-GGA-AGG 11333622-GGA-AGG ***
13490161-TAA-CAC 11334485-TAA-CAC ***
13531753-CAAA-C,CA 11376077-CAAA-C,CA 23×A***
13722195-CCTC-ACTG 11566519-CCTC-ACTG ***
13723928-AAA-CAA,CAG 11568252-AAA-CAA,CAG ***
13727851-CAT-GAA,GAT 11572175-CAT-GAA,GAT ***
14071348-ACCCGACTTTT-TCCTGAC,TCCTGACTT 11950642-ACCCGACTTTT-TCCTGAC,TCCTGACTT ***
17332750-C-CA,CAAA 15220870-C-CA,CAAA 22×A***
23505517-AAC-AAAAA,C 21343631-AAC-AAAAA,C ***
27566468-T-C 25420321-T-C P1_Y2 ***
27566507-T-A 25420360-T-A P1_Y2 ***
20382351-A-G 18220465-A-G P5_Dst ***
25678123-T-C 23531976-T-C P1_b3 ***
27486148-G-A 25340001-G-A P1_Y2 ***
28448917-T-A 26302770-T-A P1_gr2 ***
8002685-A-G 8134644-A-G ***
9552398-G-C 9714789-G-C IR3_Prx ***
9564059-C-A 9726450-C-A IR3_Prx ***
9592576-T-C 9754967-T-C IR3_Prx ***
9593914-T-A 9756305-T-A IR3_Prx ***
9705038-T-C 9867429-T-C IR3_Prx ***
16146214-G-A 14034334-G-A P8_Dst ***
16158097-G-C 14046217-G-C P8_Dst ***
16158102-G-A 14046222-G-A P8_Dst ***
16158143-C-G 14046263-C-G P8_Dst ***
18009925-A-G 15898045-A-G P7_Dst ***
18316529-CAAAAA-C,CAA 16204649-CAAAAA-C,CAA P6_Prx 27×A***
18401199-CAA-C,CA 16289319-CAA-C,CA P6_Gap 30×A***
18466167-T-C 16354287-T-C P6_Dst ***
18508068-A-G 16396188-A-G P6_Dst ***
20093079-A-T 17981199-A-T P5_Dst ***
20111296-A-T 17999416-A-T P5_Dst ***
20138430-A-G 18026550-A-G P5_Dst ***
20208796-C-T 18046910-C-T P5_Dst ***
20216089-TGC-T 18054203-TGC-T P5_Dst ***
20224579-C-T 18062693-C-T P5_Dst ***
20224981-G-A 18063095-G-A P5_Dst ***
20225453-C-T 18063567-C-T P5_Dst ***
20413787-T-TAA 18251901-T-TAA P5_Dst 12×A***
20468472-C-A 18306586-C-A P5_Dst ***
20578168-A-G 18416282-A-G P5_Dst ***
20578214-C-T 18416328-C-T P5_Dst ***
20851099-A-T 18689213-A-T P4_Dst ***
20867007-G-A 18705121-G-A P4_Dst ***
20887129-G-A 18725243-G-A P4_Dst ***
20916162-G-A 18754276-G-A P4_Dst ***
20926090-G-A 18764204-G-A P4_Dst ***
20995546-TCTTTC-T,TCTTT 18833660-TCTTTC-T,TCTTT P4_Dst 11×CTTTC***
22229447-AGTG-GGTA,TGTG 20067561-AGTG-GGTA,TGTG DYZ19 ***
22236219-CAAG-AAAG,AGAT 20074333-CAAG-AAAG,AGAT DYZ19 ***
22259341-C-A 20097455-C-A DYZ19 ***
22344075-G-A 20182189-G-A DYZ19 ***
22352578-G-C 20190692-G-C DYZ19 ***
22357424-G-A 20195538-G-A DYZ19 ***
22358203-G-A 20196317-G-A DYZ19 ***
22358411-GT-TC 20196525-GT-TC DYZ19 ***
22363262-G-C 20201376-G-C DYZ19 ***
22440903-C-A 20279017-C-A DYZ19 ***
22489632-TG-GT 20327746-TG-GT DYZ19 ***
22491140-G-A 20329254-G-A DYZ19 ***
22502691-CG-CT,TT 20340805-CG-CT,TT DYZ19 ***
22502826-T-A 20340940-T-A DYZ19 ***
22503143-C-G 20341257-C-G DYZ19 ***
21782361-T-C ***
24027955-A-C 21881808-A-C ***
24034886-G-A 21888739-G-A ***
24596337-G-C 22450190-G-C P3_t2 ***
24599143-A-C 22452996-A-C P3_t2 ***
24599150-C-T 22453003-C-T P3_t2 ***
24599161-C-T 22453014-C-T P3_t2 ***
24619536-G-A 22473389-G-A P3_t2 ***
24624860-C-T 22478713-C-T P3_t2 ***
24626880-C-G 22480733-C-G P3_t2 ***
24638020-CA-C 22491873-CA-C P3_t2 10×A***
24649454-ATTTTG-TATTTTC 22503307-ATTTTG-TATTTTC P3_b2 ***
24649464-TA-T 22503317-TA-T P3_b2 ***
24747905-A-C 22601758-A-C P3_b2 ***
25430866-T-C 23284719-T-C P2_r2 ***
25473384-G-C 23327237-G-C P2_r2 ***
25658889-A-G 23512742-A-G P1_b3 ***
25663795-TG-T 23517648-TG-T P1_b3 ***
25678088-G-T 23531941-G-T P1_b3 ***
25841781-CAA-C,CA 23695634-CAA-C,CA P1_b3 19×A***
26631899-AT-A 24485752-AT-A P1_g2 20×T***
27080259-A-AT 24934112-A-AT P1_r4 11×T***
27116921-T-TTC 24970774-T-TTC P1_r4 ***
27172512-C-T 25026365-C-T P1_g3 ***
27177200-G-T 25031053-G-T P1_g3 ***
27335467-G-A 25189320-G-A P1_g3 ***
27364971-G-A 25218824-G-A P1_g3 ***
27428259-C-T 25282112-C-T P1_g3 ***
27454760-CTTT-C,CT 25308613-CTTT-C,CT P1_Y2 23×T***
27464629-A-G 25318482-A-G P1_Y2 ***
27505337-G-T 25359190-G-T P1_Y2 ***
27505415-T-C 25359268-T-C P1_Y2 ***
27505442-G-A 25359295-G-A P1_Y2 ***
27556826-G-A 25410679-G-A P1_Y2 ***
27615765-TGATCA-CAATCT 25469618-TGATCA-CAATCT P1_Y2 ***
27645063-A-C 25498916-A-C P1_Y2 ***
27684715-CAA-C 25538568-CAA-C P1_Y2 28×A***
27741302-G-T 25595155-G-T P1_Y2 ***
27757780-TAA-T,TA 25611633-TAA-T,TA P1_Y2 24×A***
27828722-A-G 25682575-A-G P1_Y2 ***
27852684-T-C 25706537-T-C P1_Y2 ***
27936583-G-A 25790436-G-A P1_Y2 ***
27949311-G-A 25803164-G-A P1_Y2 ***
27984457-G-T 25838310-G-T P1_Y2 ***
28023062-G-A 25876915-G-A P1_Y2 ***
28035513-T-C 25889366-T-C P1_Y2 ***
28039965-A-T 25893818-A-T P1_Y2 ***
28046033-T-A 25899886-T-A P1_Y2 ***
28065873-T-C 25919726-T-C P1_Y2 ***
28082011-T-C 25935864-T-C P1_Y2 ***
28343112-A-G 26196965-A-G P1_gr2 ***
28343119-A-G 26196972-A-G P1_gr2 ***
28352030-C-T 26205883-C-T P1_gr2 ***
28361303-G-T 26215156-G-T P1_gr2 ***
28366910-A-T 26220763-A-T P1_gr2 ***
28367002-T-C 26220855-T-C P1_gr2 ***
28388226-A-G 26242079-A-G P1_gr2 ***
28396221-GTA-G 26250074-GTA-G P1_gr2 ***
28408507-T-A 26262360-T-A P1_gr2 ***
28412422-C-CATA 26266275-C-CATA P1_gr2 ***
28413841-T-G 26267694-T-G P1_gr2 ***
28425786-G-GA 26279639-G-GA P1_gr2 10×A***
28446590-A-C 26300443-A-C P1_gr2 ***
28448272-C-CA 26302125-C-CA P1_gr2 13×A***
28448682-T-C 26302535-T-C P1_gr2 ***

In the table above, the meaning of the confidence field depends on whether the data comes from an FTDNA kit or an FGC kit. For FTDNA kits, + implies a "PASS" result with just one possible variant, * indicates a "PASS" but with multiple variants, ** indicates "REJECTED" with just a single variant, and *** indicates "REJECTED" with multiple possible variants. 'A*' are heterozygous variants not called by FTDNA, but still pulled from the VCF file. For FGC kits, + indicates over 99% likely genuine (95% for INDELs); * over 95% likely genuine (90% for INDELs); ** about 40% likely genuine; *** about 10% likely genuine. Manual entries read directly from a BAM file will be either + indicating positive, or * indicating that the data show a mixture of possible variants.

For the FTDNA kits, the BED data is encoded in the background color of the cells. Those cells with a white background have coverage, those with a grey background indicate no coverage in the BED file, and those with a pink background indicate the mutation is on the edge of a coverage region. These pink regions often indicate that the individual may be positive for a SNP even if there is no corresponding entry in the vcf file.

The combBED column indicates whether or not the mutation is a SNP and falls in the combBED region defined in Defining a New Rate Constant for Y-Chromosome SNPs based on Full Sequencing Data by Dmitry Adamov, Vladimir Guryanov, Sergey Karzhavin, Vladimir Tagankin, Vadim Urasin.

The McDonald BED column indicates whether or not the mutation is a SNP and falls in the BED region used by Dr. Iain McDonald in the age analysis he does for R-U106 men.

Mutation Notes:

Kit POSITION-REF-ALT (hg19) POSITION-REF-ALT (hg38) Note
Manual8379144-CTTCT-C8511103-CTTCT-C4 good reads, all positive.