Tree Position

R-P312/S116 > Z290 > L21/S145 > DF13 > DF21/S192 > FGC3213 > ZZ1 > S3058 > S424 > S426 > S190 > FGC3215 > Z36747 > Y16487 > Y16486

Unique Mutations

The mutations unique to this man are summarized in the table below. Those with a '+' or '*' confidence level are considered by FamilyTreeDNA or FullGenomesCorp to be high quality SNPs/INDELs. For completeness, all other mutations of lesser confidence are included as well. These additional mutations may be useful for distinguishing between very closely related men.

Occasionally, some of the mutations listed here will be thought to be shared with other men in which case they might appear in upstream blocks on the tree. When this happens, the 'Blocks' field will indicate what block they appear in. Such a situation might arise with BigY men if the BED data suggests another man may be positive for a SNP, even though it doesn't appear in his VCF data. It might also happen if Chromo2 testing or Sanger sequencing of other men not on the tree show the SNP to be shared.

POS-REF-ALT (hg19) POS-REF-ALT (hg38) Blocks Names Region McDonald BED combBED STRFB38
82962-A
BigY3
82962
FTDNA
82962
BigY2
82962
Manual
Edits
20771714-G-A 18609828-G-A P4_Prx 25×AA*
20763753-C-A 18601867-C-A P4_Prx A*
19928610-C-A 17816730-C-A P5_Prx A*
19929224-C-A 17817344-C-A P5_Prx A*
19963364-C-A 17851484-C-A P5_Prx A*
19972511-C-A 17860631-C-A P5_Prx A*
19978624-T-A 17866744-T-A P5_Prx A*
20082833-C-A 17970953-C-A P5_Dst A*
20221516-C-T 18059630-C-T P5_Dst A*
20247095-G-T 18085209-G-T P5_Dst A*
20326107-C-T 18164221-C-T P5_Dst A*
20363267-C-A 18201381-C-A P5_Dst A*
20472075-A-T 18310189-A-T P5_Dst A*
20501075-C-G 18339189-C-G P5_Dst A*
20793616-G-T 18631730-G-T P4_Prx A*
19846588-A-T 17734708-A-T P5_Prx A*
20795903-C-T 18634017-C-T P4_Prx A*
20844328-G-T 18682442-G-T P4_Dst A*
20863679-G-T 18701793-G-T P4_Dst A*
20887025-A-G 18725139-A-G P4_Dst A*
20908595-G-T 18746709-G-T P4_Dst A*
20951293-T-G 18789407-T-G P4_Dst A*
20970347-G-A 18808461-G-A P4_Dst A*
20984579-T-C 18822693-T-C P4_Dst A*
21027795-C-A 18865909-C-A P4_Dst YA*
13449900-C-T 11294224-C-T A*
56833501-T-G A*
16146466-T-A 14034586-T-A P8_Dst A*
19894243-A-G 17782363-A-G P5_Prx A*
19792481-A-T 17680601-A-T P5_Prx A*
19835481-C-CT 17723601-C-CT P5_Prx 9×TA*
10625095-G-T ***A*
19753426-A-T 17641546-A-T P5_Prx A*
20958989-A-T 18797103-A-T P4_Dst A*
20795930-G-T 18634044-G-T P4_Prx 8×AA*
20951215-A-T 18789329-A-T P4_Dst A*
20379787-G-T 18217901-G-T P5_Dst A*
20883163-A-T 18721277-A-T P4_Dst A*
19749297-A-T 17637417-A-T P5_Prx A*
20640924-G-T 18479038-G-T P4_Prx A*
20741872-C-T 18579986-C-T P4_Prx A*
18286013-C-A 16174133-C-A P6_Prx A*
20771712-C-A 18609826-C-A P4_Prx A*
19963686-G-A 17851806-G-A P5_Prx A*
14363207-G-T 12242502-G-T YYA*
19771728-C-A 17659848-C-A P5_Prx A*
16104868-C-A 13992988-C-A P8_Prx A*
16136055-C-T 14024175-C-T P8_Dst A*
16146050-G-A 14034170-G-A P8_Dst A*
18369789-C-G 16257909-C-G P6_Prx A*
18369798-G-C 16257918-G-C P6_Prx A*
18472000-T-C 16360120-T-C P6_Dst A*
18526790-G-A 16414910-G-A P6_Dst A*
19589874-C-A 17477994-C-A P5_Prx YA*
19593755-G-T 17481875-G-T P5_Prx YA*
19600885-C-A 17489005-C-A P5_Prx YA*
19636148-G-T 17524268-G-T P5_Prx A*
19671958-C-A 17560078-C-A P5_Prx A*
19745516-G-T 17633636-G-T P5_Prx A*
20692958-C-T 18531072-C-T P4_Prx A*
20882034-G-T 18720148-G-T P4_Dst A*
16146479-A-AAAAGAAAG 14034599-A-AAAAGAAAG P8_Dst 12×AAAGA*
20129006-C-CA 18017126-C-CA P5_Dst 11×AA*
20951237-C-T 18789351-C-T P4_Dst A*
18903536-C-A 16791656-C-A Y102993 YY++++
22465017-G-C 20303131-G-C BY221447 DYZ19 +**++
10060163-C-A 10222554-C-A Y89564 +++**
22597265-T-C 20435379-T-C Y109228 YY++++
13816627-GGGAATGGAAT-G 11695921-GGGAATGGAAT-G 8×GGAAT+*****
7730475-CATACATACATAC-G 7862434-CATACATACATAC-G +
17255843-T-A 15143963-T-A Y98606 YY++++
56861817-AAAAAAAAAAAAAAAAAAAAAACCTG-AAAAAAAAAAAACCTA,CAAACAAACAAACAAACAAAAAAAACCTA *
5486757-T-C 5618716-T-C *
56824027-AAA-A,T *
56832401-CA-CG,TG *
56834247-CCGTTC-CCATTCCGTTC,T *
13271204-TA-T,TAA 11115528-TA-T,TAA 12×A*
56881159-CAAAACAAAACA-CAAAACA,GCAAAACAAAACAAAACAAAAC *
9636618-TTG-T,TTGTG 9799009-TTG-T,TTGTG IR3_Prx 13×TG*
13266221-G-T 11110545-G-T *
13262504-CTG-C 11106828-CTG-C *
25339574-T-A 23193427-T-A A5329 P2_r1 *
22358237-TAAGG-AAAGG,TAAGA 20196351-TAAGG-AAAGG,TAAGA DYZ19 *
22454661-T-A 20292775-T-A DYZ19 *
22502083-CCAGT-CCAGA,TCAGA 20340197-CCAGT-CCAGA,TCAGA DYZ19 *
7730471-GATACATACATAC-G 7862430-GATACATACATAC-G 10×ATAC*
56838338-C-A **
13533430-G-A 11377754-G-A *
9211271-CACAC-A,CACACAC 9373662-CACAC-A,CACACAC *
13488933-TTG-GTG,TTT 11333257-TTG-GTG,TTT *
13450998-TTCCACTT-CTCCACTC,CTCCACTT 11295322-TTCCACTT-CTCCACTC,CTCCACTT *
13447111-CCATTCCATTCCATTCCATTC-A 11291435-CCATTCCATTCCATTCCATTC-A *
13263115-CGAG-TGAA 11107439-CGAG-TGAA *
13452369-TTCCATTCCATTCCATTCCATTCCATTCAAATACACTCCT-GTCAAATCCACTCCA 11296693-TTCCATTCCATTCCATTCCATTCCATTCAAATACACTCCT-GTCAAATCCACTCCA *
59016450-TG-CA 56870303-TG-CA *
13471806-ACCTTG-GCCTTT 11316130-ACCTTG-GCCTTT *
13688835-GG-TT 11533159-GG-TT *
13451163-TATTCCA-CACTCCT 11295487-TATTCCA-CACTCCT *
13450319-AA-CA,CC 11294643-AA-CA,CC *
28808596-C-T 26662449-C-T **
28765373-G-T 26619226-G-T **
14228682-G-T 12107976-G-T **
28076509-T-C 25930362-T-C P1_Y2 **
56827472-G-T **
26100854-G-T 23954707-G-T P1_Y1 **
25898604-C-A 23752457-C-A P1_Y1 **
24278099-C-A 22131952-C-A P3_b1 **
56742692-G-C **
56848858-C-A **
56834618-C-T **
22076254-G-T 19914368-G-T **
56852727-C-A **
56881929-G-T **
19612058-A-AG 17500178-A-AG P5_Prx **
28446476-C-T 26300329-C-T P1_gr2 **
16990223-CAAA-C 14878343-CAAA-C 24×A**
10992916-C-A **
28445227-TGGTG-CGGTA 26299080-TGGTG-CGGTA P1_gr2 **
28445214-G-A 26299067-G-A P1_gr2 **
10955991-A-G **
6944943-CAAAA-C 7076902-CAAAA-C 28×A**
28398613-C-T 26252466-C-T P1_gr2 **
28393369-G-T 26247222-G-T P1_gr2 **
10945645-C-A **
22855046-G-T 20693160-G-T **
18190857-A-T 16078977-A-T **
21202354-C-A 19040468-C-A **
11030533-A-T **
13903095-G-T 11782389-G-T **
13903087-G-T 11782381-G-T **
14413704-C-A 12293001-C-A **
14508486-G-T 12396691-G-T **
14554285-C-A 12442486-C-A **
14716626-C-A 12604694-C-A **
15475023-C-A 13363143-C-A **
15485503-C-A 13373623-C-A Y93900 **
15740514-A-G 13628634-A-G **
16036350-C-A 13924470-C-A **
11660006-G-T **
13725994-T-C 11570318-T-C **
13254468-C-A 11098792-C-A **
11028209-C-A **
20695483-CAAACA-C 18533597-CAAACA-C P4_Prx **
16317112-G-T 14205232-G-T **
28238538-CT-C 26092391-CT-C P1_b4 **
11014897-G-T **
16376578-C-A 14264698-C-A **
16432557-C-A 14320677-C-A **
16540015-C-A 14428135-C-A **
16550948-C-A 14439068-C-A **
16663760-A-T 14551880-A-T **
17046638-C-A 14934758-C-A **
17327200-A-G 15215320-A-G **
17929516-A-C 15817636-A-C **
14303027-G-T 12182321-G-T Y90998 **
18743437-C-A 16631557-C-A **
13726318-ATGT-CTGA 11570642-ATGT-CTGA **
27382533-A-G 25236386-A-G P1_g3 **
13705496-G-C 11549820-G-C **
22962008-G-TT 20800122-G-TT 27×T**
18487794-G-T 16375914-G-T P6_Dst **
18487792-G-T 16375912-G-T P6_Dst **
16146477-AGA-GAAAAGAAAG 14034597-AGA-GAAAAGAAAG P8_Dst **
16118279-CAAA-C 14006399-CAAA-C P8_Prx 27×A**
10934893-A-T **
23471052-AAAA-G 21309166-AAAA-G **
13734017-G-T 11578341-G-T **
13734042-C-T 11578366-C-T **
13734010-T-C 11578334-T-C **
6089764-G-T 6221723-G-T 31×T**
22352594-TTAAT-CTAAA 20190708-TTAAT-CTAAA DYZ19 **
5949060-A-AC 6081019-A-AC ****
56854484-C-A *****
20431070-AGGT-TGGC 18269184-AGGT-TGGC P5_Dst **
13734177-GAATGGA-TG 11578501-GAATGGA-TG **
22577948-CTTG-ATTT 20416062-CTTG-ATTT **
28456967-A-G 26310820-A-G P1_gr2 **
20932612-GA-G 18770726-GA-G P4_Dst 17×A**
6126924-CC-AA 6258883-CC-AA **
8125051-AGAAGAGAAGAG-GAGAAGAGAGAGA 8257010-AGAAGAGAAGAG-GAGAAGAGAGAGA **
16250624-G-TTT 14138744-G-TTT 28×T**
8824887-T-A 8956846-T-A **
10615535-C-A **
13728010-GAAATA-TAAAAG 11572334-GAAATA-TAAAAG **
13723716-TAA-GG 11568040-TAA-GG **
13724185-A-T 11568509-A-T **
20309353-CAA-C 18147467-CAA-C P5_Dst **
20510958-AGGAT-TGGA 18349072-AGGAT-TGGA P5_Dst **
18534201-TACAC-T 16422321-TACAC-T P6_Dst 8×AC**
13724243-CCATTG-GTATGA 11568567-CCATTG-GTATGA **
28144962-A-C 25998815-A-C P1_b4 **
20216467-G-T 18054581-G-T P5_Dst **
28025465-A-G 25879318-A-G P1_Y2 **
27956808-T-C 25810661-T-C P1_Y2 **
27938402-A-T 25792255-A-T P1_Y2 **
28397239-C-CAAA 26251092-C-CAAA P1_gr2 20×A**
27692973-CT-C 25546826-CT-C P1_Y2 15×T**
16096815-A-C 13984935-A-C **
27648082-A-T 25501935-A-T P1_Y2 **
27645026-C-A 25498879-C-A P1_Y2 **
27645015-T-C 25498868-T-C P1_Y2 **
27638148-C-CAA 25492001-C-CAA P1_Y2 20×A**
27286455-A-G 25140308-A-G P1_g3 **
20529756-C-T 18367870-C-T P5_Dst **
26994230-A-G 24848083-A-G P1_r4 **
26105246-TG-T 23959099-TG-T P1_Y1 **
25685995-C-A 23539848-C-A P1_b3 **
22342727-G-C 20180841-G-C DYZ19 **
22342697-G-T 20180811-G-T DYZ19 **
22342657-G-T 20180771-G-T DYZ19 **
22342645-G-T 20180759-G-T DYZ19 **
22194474-T-C 20032588-T-C **
21018697-G-C 18856811-G-C P4_Dst **
20945546-A-G 18783660-A-G P4_Dst **
20892789-C-T 18730903-C-T P4_Dst **
20872434-AT-A 18710548-AT-A P4_Dst 25×T**
10934934-A-T **
56834615-C-A **
10923743-C-T **
7258563-C-A 7390522-C-A **
4258641-C-A 4390600-C-A **
4321061-G-T 4453020-G-T **
4369081-G-T 4501040-G-T **
5537505-C-A 5669464-C-A **
5666846-C-A 5798805-C-A **
5738710-C-A 5870669-C-A **
6183295-T-C 6315254-T-C IR3_Dst **
6350701-C-A 6482660-C-A **
6533742-G-T 6665701-G-T **
6663213-T-A 6795172-T-A **
6751610-C-A 6883569-C-A **
7080587-C-A 7212546-C-A **
7754389-G-A 7886348-G-A **
4027212-C-A 4159171-C-A **
7958407-C-A 8090366-C-A **
8262773-C-A 8394732-C-A **
8672977-G-T 8804936-G-T **
8816493-C-A 8948452-C-A **
8822641-G-T 8954600-G-T **
9381898-C-A 9544289-C-A **
9991949-C-A 10154340-C-A **
10042275-G-T 10204666-G-T **
10648054-C-T **
10648063-A-C **
10657275-C-A **
10658306-C-A **
10658398-C-A **
4217682-T-C 4349641-T-C **
3491664-C-A 3623623-C-A **
10659544-T-A **
22234331-TCTATCAGT-CCACCGTA 20072445-TCTATCAGT-CCACCGTA DYZ19 **
22236450-G-T 20074564-G-T DYZ19 **
18490252-CT-C 16378372-CT-C P6_Dst 11×T**
25524693-CT-C 23378546-CT-C P1_gr1 33×T**
22241388-G-T 20079502-G-T DYZ19 **
22342626-A-T 20180740-A-T DYZ19 **
18534159-TAC-T 16422279-TAC-T P6_Dst **
22479601-A-G 20317715-A-G BY25220 DYZ19 **
22479595-G-T 20317709-G-T BY25218 DYZ19 **
27400007-T-C 25253860-T-C P1_g3 **
13724179-TG-AC 11568503-TG-AC **
22367118-GA-TG 20205232-GA-TG DYZ19 **
22085598-C-A 19923712-C-A Z3644 **
9535155-ATT-A 9697546-ATT-A IR3_Prx 17×T**
24490845-G-T 22344698-G-T **
3251304-C-A 3383263-C-A **
22346809-A-T 20184923-A-T DYZ19 **
58992457-A-C 56846310-A-C **
58992459-T-C 56846312-T-C **
13734091-A-G 11578415-A-G 8×GAATG**
13447807-G-T 11292131-G-T **
27341881-G-T 25195734-G-T P1_g3 **
10923736-C-T **
20991160-ATT-A 18829274-ATT-A P4_Dst 18×T**
21003856-G-GC 18841970-G-GC P4_Dst **
13485860-G-T 11330184-G-T **
18609432-C-A 16497552-C-A **
8481937-C-A 8613896-C-A **
3010317-C-A 3142276-C-A **
10658467-C-A **
18928141-C-G 16816261-C-G **
10800754-G-T **
10776603-A-C **
10825285-C-CGGTTA **
10825309-C-T **
10676984-C-T **
10901376-A-C **
10923719-C-A **
10749720-GCCATT-G **
10923706-C-T **
10779035-C-A **
10822868-C-A **
10901364-C-A **
10795074-T-C **
10842554-C-A **
10901388-C-G **
10901343-T-TG **
10795067-C-CAATCT **
10901340-CT-C **
10822988-C-A **
10829099-G-T **
10901379-T-G **
10797516-G-T **
10901324-CCGTTA-C **
10669309-A-G **
10817483-C-A **
10878245-A-G **
10795056-C-CCATTT **
20916162-G-A 18754276-G-A P4_Dst ***
22344075-G-A 20182189-G-A DYZ19 ***
20216089-TGC-T 18054203-TGC-T P5_Dst ***
20224579-C-T 18062693-C-T P5_Dst ***
10992370-C-A ***
22357424-G-A 20195538-G-A DYZ19 ***
20224981-G-A 18063095-G-A P5_Dst ***
20225453-C-T 18063567-C-T P5_Dst ***
22352578-G-C 20190692-G-C DYZ19 ***
20413787-T-TAA 18251901-T-TAA P5_Dst 12×A***
20995546-TCTTTC-T,TCTTT 18833660-TCTTTC-T,TCTTT P4_Dst 11×CTTTC***
22229447-AGTG-GGTA,TGTG 20067561-AGTG-GGTA,TGTG DYZ19 ***
26283209-C-CA 24137062-C-CA P1_Y1 21×A***
20468472-C-A 18306586-C-A P5_Dst ***
22358969-G-T 20197083-G-T DYZ19 ***
27484483-C-G 25338336-C-G P1_Y2 ***
22479589-C-G 20317703-C-G Z25184 DYZ19 ***
20578168-A-G 18416282-A-G P5_Dst ***
20578214-C-T 18416328-C-T P5_Dst ***
20926090-G-A 18764204-G-A P4_Dst ***
20851099-A-T 18689213-A-T P4_Dst ***
6674498-C-T 6806457-C-T ***
6953238-GAC-G 7085197-GAC-G ***
20867007-G-A 18705121-G-A P4_Dst ***
15196747-G-T 13084833-G-T ***
22288731-C-A 20126845-C-A DYZ19 ***
22259341-C-A 20097455-C-A DYZ19 ***
22236219-CAAG-AAAG,AGAT 20074333-CAAG-AAAG,AGAT DYZ19 ***
20887129-G-A 18725243-G-A P4_Dst ***
20208796-C-T 18046910-C-T P5_Dst ***
22503119-T-C 20341233-T-C DYZ19 ***
17050126-C-A 14938246-C-A ***
20138430-A-G 18026550-A-G P5_Dst ***
22303306-T-C 20141420-T-C DYZ19 ***
20382351-A-G 18220465-A-G P5_Dst ***
13479112-C-A 11323436-C-A ***
13483862-C-A 11328186-C-A ***
22360838-CTTAA-TTTAC 20198952-CTTAA-TTTAC DYZ19 ***
22236364-TTG-CTA 20074478-TTG-CTA DYZ19 ***
22352549-A-C 20190663-A-C DYZ19 ***
27566507-T-A 25420360-T-A P1_Y2 ***
27566468-T-C 25420321-T-C P1_Y2 ***
23505517-AAC-AAAAA,C 21343631-AAC-AAAAA,C ***
22435283-T-A 20273397-T-A DYZ19 ***
27486148-G-A 25340001-G-A P1_Y2 ***
17332750-C-CA,CAAA 15220870-C-CA,CAAA 22×A***
22295937-C-T 20134051-C-T DYZ19 ***
14071348-ACCCGACTTTT-TCCTGAC,TCCTGACTT 11950642-ACCCGACTTTT-TCCTGAC,TCCTGACTT ***
19892868-G-TT 17780988-G-TT P5_Prx 31×T***
13727851-CAT-GAA,GAT 11572175-CAT-GAA,GAT ***
13486385-C-A 11330709-C-A ***
13642863-A-G 11487187-A-G ***
13681384-C-A 11525708-C-A ***
13723928-AAA-CAA,CAG 11568252-AAA-CAA,CAG ***
25678123-T-C 23531976-T-C P1_b3 ***
28448917-T-A 26302770-T-A P1_gr2 ***
20111296-A-T 17999416-A-T P5_Dst ***
16158097-G-C 14046217-G-C P8_Dst ***
20093079-A-T 17981199-A-T P5_Dst ***
18508068-A-G 16396188-A-G P6_Dst ***
22358203-G-A 20196317-G-A DYZ19 ***
18466167-T-C 16354287-T-C P6_Dst ***
18401199-CAA-C,CA 16289319-CAA-C,CA P6_Gap 30×A***
18316529-CAAAAA-C,CAA 16204649-CAAAAA-C,CAA P6_Prx 27×A***
18009925-A-G 15898045-A-G P7_Dst ***
16158143-C-G 14046263-C-G P8_Dst ***
16158102-G-A 14046222-G-A P8_Dst ***
13268286-C-G 11112610-C-G ***
8002685-A-G 8134644-A-G ***
16146214-G-A 14034334-G-A P8_Dst ***
21912180-C-A 19750294-C-A ***
9705038-T-C 9867429-T-C IR3_Prx ***
13459479-C-A 11303803-C-A ***
9593914-T-A 9756305-T-A IR3_Prx ***
9592576-T-C 9754967-T-C IR3_Prx ***
9564059-C-A 9726450-C-A IR3_Prx ***
9552398-G-C 9714789-G-C IR3_Prx ***
7196046-CTTTTT-C 7328005-CTTTTT-C 16×T***
9730344-C-CAT 9892735-C-CAT IR3_Prx ***
22491140-G-A 20329254-G-A DYZ19 ***
6503051-A-G 6635010-A-G ***
27828722-A-G 25682575-A-G P1_Y2 ***
28039965-A-T 25893818-A-T P1_Y2 ***
28035513-T-C 25889366-T-C P1_Y2 ***
13809134-G-C 11688428-G-C ***
28023062-G-A 25876915-G-A P1_Y2 ***
27984457-G-T 25838310-G-T P1_Y2 ***
27949311-G-A 25803164-G-A P1_Y2 ***
27936583-G-A 25790436-G-A P1_Y2 ***
27852684-T-C 25706537-T-C P1_Y2 ***
27757780-TAA-T,TA 25611633-TAA-T,TA P1_Y2 24×A***
28065873-T-C 25919726-T-C P1_Y2 ***
27741302-G-T 25595155-G-T P1_Y2 ***
10039839-G-A,T 10202230-G-A,T ***
27684715-CAA-C 25538568-CAA-C P1_Y2 28×A***
25370964-A-G 23224817-A-G FGC78375 P2_r2 ***
27645063-A-C 25498916-A-C P1_Y2 ***
25072260-A-AT 22926113-A-AT g1 16×T***
28360032-G-C 26213885-G-C P1_gr2 ***
27615765-TGATCA-CAATCT 25469618-TGATCA-CAATCT P1_Y2 ***
27556826-G-A 25410679-G-A P1_Y2 ***
28046033-T-A 25899886-T-A P1_Y2 ***
28082011-T-C 25935864-T-C P1_Y2 ***
27505415-T-C 25359268-T-C P1_Y2 ***
19887301-TAC-T 17775421-TAC-T P5_Prx 12×AC***
28448272-C-CA 26302125-C-CA P1_gr2 13×A***
28446590-A-C 26300443-A-C P1_gr2 ***
22426353-G-C 20264467-G-C DYZ19 ***
22490951-T-G 20329065-T-G DYZ19 ***
22282793-C-G 20120907-C-G DYZ19 ***
28425786-G-GA 26279639-G-GA P1_gr2 10×A***
28413841-T-G 26267694-T-G P1_gr2 ***
28412422-C-CATA 26266275-C-CATA P1_gr2 ***
28408507-T-A 26262360-T-A P1_gr2 ***
28396221-GTA-G 26250074-GTA-G P1_gr2 ***
13451105-A-C,T 11295429-A-C,T ***
27237174-G-T 25091027-G-T P1_g3 ***
28388226-A-G 26242079-A-G P1_gr2 ***
28367002-T-C 26220855-T-C P1_gr2 ***
28366910-A-T 26220763-A-T P1_gr2 ***
28361303-G-T 26215156-G-T P1_gr2 ***
28352030-C-T 26205883-C-T P1_gr2 ***
28343119-A-G 26196972-A-G P1_gr2 ***
28343112-A-G 26196965-A-G P1_gr2 ***
28359912-T-C 26213765-T-C P1_gr2 ***
27505442-G-A 25359295-G-A P1_Y2 ***
27505337-G-T 25359190-G-T P1_Y2 ***
22358411-GT-TC 20196525-GT-TC DYZ19 ***
24034886-G-A 21888739-G-A ***
24638020-CA-C 22491873-CA-C P3_t2 10×A***
24626880-C-G 22480733-C-G P3_t2 ***
24624860-C-T 22478713-C-T P3_t2 ***
24619536-G-A 22473389-G-A P3_t2 ***
24599161-C-T 22453014-C-T P3_t2 ***
24599150-C-T 22453003-C-T P3_t2 ***
24599143-A-C 22452996-A-C P3_t2 ***
24596337-G-C 22450190-G-C P3_t2 ***
24027955-A-C 21881808-A-C ***
24649464-TA-T 22503317-TA-T P3_b2 ***
21782361-T-C ***
22503143-C-G 20341257-C-G DYZ19 ***
22502826-T-A 20340940-T-A DYZ19 ***
22502691-CG-CT,TT 20340805-CG-CT,TT DYZ19 ***
28444019-A-G 26297872-A-G P1_gr2 ***
22489632-TG-GT 20327746-TG-GT DYZ19 ***
13530010-G-A 11374334-G-A ***
22440903-C-A 20279017-C-A DYZ19 ***
22363262-G-C 20201376-G-C DYZ19 ***
24649454-ATTTTG-TATTTTC 22503307-ATTTTG-TATTTTC P3_b2 ***
24747905-A-C 22601758-A-C P3_b2 ***
27484817-T-C 25338670-T-C P1_Y2 ***
27116921-T-TTC 24970774-T-TTC P1_r4 ***
27464629-A-G 25318482-A-G P1_Y2 ***
27454760-CTTT-C,CT 25308613-CTTT-C,CT P1_Y2 23×T***
27428259-C-T 25282112-C-T P1_g3 ***
13556376-G-C 11400700-G-C FGC81671 ***
27364971-G-A 25218824-G-A P1_g3 ***
27335467-G-A 25189320-G-A P1_g3 ***
22359935-G-C 20198049-G-C DYZ19 ***
27177200-G-T 25031053-G-T P1_g3 ***
27172512-C-T 25026365-C-T P1_g3 ***
27080259-A-AT 24934112-A-AT P1_r4 11×T***
25430866-T-C 23284719-T-C P2_r2 ***
17441175-AATATATATAT-A 15329295-AATATATATAT-A 20×AT***
26631899-AT-A 24485752-AT-A P1_g2 20×T***
10980677-T-A ***
25841781-CAA-C,CA 23695634-CAA-C,CA P1_b3 19×A***
10990868-G-T ***
25678088-G-T 23531941-G-T P1_b3 ***
25663795-TG-T 23517648-TG-T P1_b3 ***
25658889-A-G 23512742-A-G P1_b3 ***
25473384-G-C 23327237-G-C P2_r2 ***
13722195-CCTC-ACTG 11566519-CCTC-ACTG ***
22508949-G-T 20347063-G-T DYZ19 ***
13531753-CAAA-C,CA 11376077-CAAA-C,CA 23×A***
8766255-G-T 8898214-G-T ***
8566864-C-A 8698823-C-A ***
15479942-CTTT-C,CTT 13368062-CTTT-C,CTT 21×T***
8636054-G-T 8768013-G-T ***
8735794-A-G 8867753-A-G ***
24782318-ATT-A 22636171-ATT-A P3_b2 16×T***
21464536-CAA-C,CA 19302650-CAA-C,CA 19×A***
27889296-A-AAT 25743149-A-AAT P1_Y2 ***
28747705-ATTTTT-A 26601558-ATTTTT-A 27×T***
16047273-C-A 13935393-C-A Y95395 ***
8439428-T-A 8571387-T-A ***
8832628-C-A 8964587-C-A ***
23772621-AT-A 21610735-AT-A 8×T***
9020498-G-T 9182889-G-T ***
9068895-G-T 9231286-G-T ***
22315954-T-C 20154068-T-C DYZ19 ***
9462044-G-T 9624435-G-T ***
9647644-G-T 9810035-G-T BY156090 IR3_Prx ***
56835873-C-T ***
9647657-G-T 9810048-G-T IR3_Prx ***
8501254-C-A 8633213-C-A ***
13708518-A-C 11552842-A-C ***
56831894-ATTCCT-A,ATTCCA ***
7801127-C-A 7933086-C-A ***
7188557-C-A 7320516-C-A ***
15664090-C-A 13552210-C-A ***
7316677-G-T 7448636-G-T ***
7363613-C-A 7495572-C-A ***
7407066-C-A 7539025-C-A ***
7534467-C-A 7666426-C-A ***
7646441-G-T 7778400-G-T ***
7669231-C-A 7801190-C-A ***
7870466-T-C 8002425-T-C ***
15947203-C-A 13835323-C-A ***
7927959-G-T 8059918-G-T ***
28360063-G-A 26213916-G-A P1_gr2 ***
15858507-A-G 13746627-A-G ***
13709085-G-T 11553409-G-T ***
8076627-C-A 8208586-C-A ***
8078462-A-G 8210421-A-G ***
8209410-C-A 8341369-C-A ***
8244031-C-A 8375990-C-A ***
13698613-G-A 11542937-G-A ***
6989106-T-A 7121065-T-A ***
9771079-G-T 9933470-G-T ***
7098886-T-A 7230845-T-A ***
19126242-C-A 17014362-C-A ***
21262471-C-A 19100585-C-A A15565 ***
10657411-A-T ***
21189658-G-A 19027772-G-A ***
21054212-T-C 18892326-T-C ***
10657414-C-A ***
20459023-C-A 18297137-C-A P5_Dst ***
19226422-C-A 17114542-C-A ***
19213264-C-A 17101384-C-A ***
19007619-CAT-C,CATAT 16895739-CAT-C,CATAT 10×AT***
21300198-G-T 19138312-G-T ***
18793569-G-T 16681689-G-T ***
16707171-C-A 14595291-C-A ***
18288648-G-T 16176768-G-T P6_Prx ***
18190910-G-T 16079030-G-T ***
16729481-G-A 14617601-G-A ***
18052589-C-T 15940709-C-T ***
17693587-C-A 15581707-C-A ***
17332731-G-A 15220851-G-A ***
17050116-C-T 14938236-C-T ***
21295226-A-G 19133340-A-G ***
21409218-C-A 19247332-C-A ***
56826258-C-T ***
9979359-C-G 10141750-C-G ***
9771083-C-T 9933474-C-T FT67504 ***
56724863-G-A ***
58883633-G-C 56707238-C-G ***
9875134-C-A 10037525-C-A ***
9886572-C-A 10048963-C-A ***
28760352-C-A 26614205-C-A ***
28521259-C-A 26375112-C-A ***
28463022-C-A 26316875-C-A ***
16441135-C-A 14329255-C-A ***
21425383-T-C 19263497-T-C ***
23315747-G-T 21153861-G-T ***
22961922-C-A 20800036-C-A ***
22209102-T-C 20047216-T-C ***
22200384-C-A 20038498-C-A ***
22023708-A-G 19861822-A-G ***
21971652-C-A 19809766-C-A ***
21891062-C-A 19729176-C-A ***
21766533-AATATATAT-A 19604647-AATATATAT-A 19×AT***
21565997-A-G 19404111-A-G ***
7142514-C-T 7274473-C-T ***
15593255-C-A 13481375-C-A ***
13490161-TAA-CAC 11334485-TAA-CAC ***
27363696-A-T 25217549-A-T P1_g3 ***
22457038-T-A 20295152-T-A DYZ19 ***
13530026-AGCT-GGCC 11374350-AGCT-GGCC ***
28408660-T-C 26262513-T-C P1_gr2 ***
28395566-AT-A 26249419-AT-A P1_gr2 12×T***
24323664-TA-T 22177517-TA-T P3_t1 14×A***
22443512-T-G 20281626-T-G DYZ19 ***
9964625-A-G 10127016-A-G ***
28315828-CTG-C 26169681-CTG-C P1_b4 21×TG***
10673970-TTG-ATA ***
28380631-T-TC 26234484-T-TC P1_gr2 ***
22259460-C-T 20097574-C-T DYZ19 ***
13463707-G-T 11308031-G-T ***
16119959-TTTTCTTTCTTTC-T,TTTTCTTTCTTTCTTTCTTTC 14008079-TTTTCTTTCTTTC-T,TTTTCTTTCTTTCTTTCTTTC P8_Prx 12×TTTC***
10691348-ATTCCATTCCATTCCATTCCATTCCATTCCA-T ***
13488675-CGCGCCA-TGCGACG 11332999-CGCGCCA-TGCGACG ***
13841460-G-T 11720754-G-T ***
15480298-T-C 13368418-T-C ******
15480292-T-C 13368412-T-C ******
22489902-T-C 20328016-T-C DYZ19 ***
27541802-A-G 25395655-A-G P1_Y2 ***
19605329-T-C 17493449-T-C P5_Prx ***
8062772-A-G 8194731-A-G ******
19605363-G-A 17493483-G-A P5_Prx ***
13489298-GGA-AGG 11333622-GGA-AGG ***
19605428-T-A 17493548-T-A P5_Prx ***
13488621-AGCTTTT-GGCTTC 11332945-AGCTTTT-GGCTTC ***
13487751-CCACA-ACACC 11332075-CCACA-ACACC ***
19605435-C-A 17493555-C-A P5_Prx ***
13463768-G-GA 11308092-G-GA ***
22510013-G-C 20348127-G-C DYZ19 ***
17121428-G-T 15009548-G-T ***
19605393-A-G 17493513-A-G P5_Prx ***
2752413-GTTA-GTT,TTTAA 2884372-GTTA-GTT,TTTAA ***
22259988-G-T 20098102-G-T DYZ19 ***
23134094-C-A 20972208-C-A BY143244 ***
13825161-C-A 11704455-C-A ***
13825165-C-A 11704459-C-A ***
19605324-G-A 17493444-G-A P5_Prx ***
6020688-GT-G,TT 6152647-GT-G,TT 23×T***
5784062-CAA-C,CAAA 5916021-CAA-C,CAAA 21×A***
3587251-C-A 3719210-C-A ***
3446607-CAAA-C,CAA 3578566-CAAA-C,CAA 25×A***
13448640-ATTCCATTCCATTCCATTCCATTC-A,ATCCATTCCATTC 11292964-ATTCCATTCCATTCCATTCCATTC-A,ATCCATTCCATTC ***
6126238-T-G 6258197-T-G ***
6910462-C-T 7042421-C-T ***
15340399-TTTG-T 13228518-TTTG-T ***
14384535-G-T 12263831-G-T ***
14639279-C-T 12527348-C-T ***
10817600-G-T ***
14900690-G-T 12788757-G-T ***
5577196-C-A 5709155-C-A ***
14900848-T-C 12788915-T-C ***
15074488-TTTGAA-T 12962578-TTTGAA-T ***
15260728-G-T 13148812-G-T ***
6355615-TC-T 6487574-TC-T ***
2869072-G-T 3001031-G-T ***
6434738-C-A 6566697-C-A ***
15451624-C-A 13339744-C-A ***
6689854-C-A 6821813-C-A ***
6697303-A-T 6829262-A-T ***
6792627-TC-T 6924586-TC-T ***
6825252-G-T 6957211-G-T ***
6840812-G-T 6972771-G-T ***
6840837-C-A 6972796-C-A ***
6840866-C-A 6972825-C-A ***
14253357-G-A 12132651-G-A ***
2810390-GA-A,GG 2942349-GA-A,GG ***
22439130-T-C 20277244-T-C DYZ19 ***
14065797-C-A 11945091-C-A ***
10835556-G-A ***
4427295-G-C 4559254-G-C ***
3270922-TA-T 3402881-TA-T ***
23435682-CT-C,CTT 21273796-CT-C,CTT 21×T***
19709709-CAA-C 17597829-CAA-C P5_Prx 29×A***
10807232-C-A ***
27778405-T-G 25632258-T-G P1_Y2 ***
24849943-T-C 22703796-T-C IR1_R ***
28524480-G-GA 26378333-G-GA 10×A***
22502861-A-T 20340975-A-T DYZ19 ***
2746646-C-A 2878605-C-A ***
22502024-T-A 20340138-T-A DYZ19 ***
22454537-A-G 20292651-A-G DYZ19 ***
22301062-G-A 20139176-G-A DYZ19 ***
14103369-C-A 11982663-C-A ***
27365809-G-A 25219662-G-A P1_g3 ***
56829509-C-A ***
15928399-C-T 13816519-C-T ***
21363090-CA-C,CAA 19201204-CA-C,CAA 16×A***
7374587-C-A 7506546-C-A ***
28448682-T-C 26302535-T-C P1_gr2 ***

In the table above, the meaning of the confidence field depends on whether the data comes from an FTDNA kit or an FGC kit. For FTDNA kits, + implies a "PASS" result with just one possible variant, * indicates a "PASS" but with multiple variants, ** indicates "REJECTED" with just a single variant, and *** indicates "REJECTED" with multiple possible variants. 'A*' are heterozygous variants not called by FTDNA, but still pulled from the VCF file. For FGC kits, + indicates over 99% likely genuine (95% for INDELs); * over 95% likely genuine (90% for INDELs); ** about 40% likely genuine; *** about 10% likely genuine. Manual entries read directly from a BAM file will be either + indicating positive, or * indicating that the data show a mixture of possible variants.

For the FTDNA kits, the BED data is encoded in the background color of the cells. Those cells with a white background have coverage, those with a grey background indicate no coverage in the BED file, and those with a pink background indicate the mutation is on the edge of a coverage region. These pink regions often indicate that the individual may be positive for a SNP even if there is no corresponding entry in the vcf file.

The combBED column indicates whether or not the mutation is a SNP and falls in the combBED region defined in Defining a New Rate Constant for Y-Chromosome SNPs based on Full Sequencing Data by Dmitry Adamov, Vladimir Guryanov, Sergey Karzhavin, Vladimir Tagankin, Vadim Urasin.

The McDonald BED column indicates whether or not the mutation is a SNP and falls in the BED region used by Dr. Iain McDonald in the age analysis he does for R-U106 men.

Mutation Notes:

Kit POSITION-REF-ALT (hg19) POSITION-REF-ALT (hg38) Note
Manual8379144-CTTCT-C8511103-CTTCT-C4 good reads, all positive.

Haplotype Progression

The data below reveals the progression of changes in the haplotype. The bottom row is the haplotype for this man and above him are the inferred ancestral haplotypes for various upstream blocks. These inferred haplotypes are very much a work in progress, and any suggested modifications are appreciated. I think we can use our vast collection of haplotype data to refine these haplotypes. Mutations made from each upstream block are shown in sequence. The cell color is determined by the block in which the mutation took place.

DYS393
DYS390
DYS19
DYS391
DYS385
DYS426
DYS388
DYS439
DYS389i
DYS392
DYS389ii
DYS458
DYS459
DYS455
DYS454
DYS447
DYS437
DYS448
DYS449
DYS464
DYS460
Y-GATA-H4
YCAII
DYS456
DYS607
DYS576
DYS570
CDY
DYS442
DYS438
DYS531
DYS578
DYF395S1
DYS590
DYS537
DYS641
DYS472
DYF406S1
DYS511
DYS425
DYS413
DYS557
DYS594
DYS436
DYS490
DYS534
DYS450
DYS444
DYS481
DYS520
DYS446
DYS617
DYS568
DYS487
DYS572
DYS640
DYS492
DYS565
DYS710
DYS485
DYS632
DYS495
DYS540
DYS714
DYS716
DYS717
DYS505
DYS556
DYS549
DYS589
DYS522
DYS494
DYS533
DYS636
DYS575
DYS638
DYS462
DYS452
DYS445
Y-GATA-A10
DYS463
DYS441
Y-GGAAT-1B07
DYS525
DYS712
DYS593
DYS650
DYS532
DYS715
DYS504
DYS513
DYS561
DYS552
DYS726
DYS635
DYS587
DYS643
DYS497
DYS510
DYS434
DYS461
DYS435
P312/S1161324141111-14121212131329179-1011112515192915-15-17-17111119-231615181736-38121211915-1681010810101223-231610121215812222013121113111112123315916122626191211131210912121011113012132413101020151913241712152412231810141791211
L21/S1451324141111-14121212131329179-1011112515192915-15-17-17111119-231615181736-38121211915-1681010810101223-231610121215812222013121113111112123515916122526191211131211912121011113012132413101020151913241712152412231810141791211
DF21/S1921324141111-14121212131329179-1011112515192915-15-17-17111119-231615181836-38121211915-1681010810101223-231610121215812222013121113111112123515916122526191211131211912121011113012132413101020151913241712152412231810141791211
S30581324141011-14121212131329179-1011112515192915-15-17-17111119-231615181836-38121211915-1681010810101223-231610121215812222013121113111112123515916122526191211121211912121011113012132413101020151913241712152412231810141791211
S4261324141011-14121212131329179-1011112515193015-15-17-17111019-231615181838-38121211915-1691010810101222-231610121215811222014121113111112123115915122526191311121211912121011113012132413101020151913231712152412231810141791211
S1901324141011-14121212131329179-1011112515193013-15-17-17111019-231615181838-38121211915-1691010810101222-231610121215811222014121113111112123115915122526201311121211912121011113012132413101020151913231712152412231810141791211
FGC32151324141011-14121212131329189-1011112515193013-15-17-17111019-231615181838-38121211915-1691010810101222-231610121215811222014121113111112123115915122526201311121211912121011113012132413101020151913231712152412231810141791211
Akins1324141011-14121312131329199-1011112615192913-15-17-18111019-231615191837-39121211915-1691010810101222-23161012121581122161412111311111212

Age Analysis Information (work in progress)

AllMcDonaldYFull
Kit: 829621024439873423367405136
Kit: 82962907163174200987352783
Kit: 829621509787694586918358393
Kit: 82962-A*16000000100000008300000
Used in age calculations1509787694586918358393
Counts of SNPs84
Variant counts last updated 2020-02-01 03:07:59.

* BED data not available. Using default values.


Big Tree Main Page