Tree Position

R-P312/S116 > Z290 > L21/S145 > DF13 > DF21/S192 > Z30233 > FGC3903/S5201 > S5199 > Z246 > DF25 > DF5 > ZZ32 > L1403 > L1402 > A818 > A459 > FGC45390

Unique Mutations

The mutations unique to this man are summarized in the table below. Those with a '+' or '*' confidence level are considered by FamilyTreeDNA or FullGenomesCorp to be high quality SNPs/INDELs. For completeness, all other mutations of lesser confidence are included as well. These additional mutations may be useful for distinguishing between very closely related men.

Occasionally, some of the mutations listed here will be thought to be shared with other men in which case they might appear in upstream blocks on the tree. When this happens, the 'Blocks' field will indicate what block they appear in. Such a situation might arise with BigY men if the BED data suggests another man may be positive for a SNP, even though it doesn't appear in his VCF data. It might also happen if Chromo2 testing or Sanger sequencing of other men not on the tree show the SNP to be shared.

POS-REF-ALT (hg19) POS-REF-ALT (hg38) Blocks Names Region McDonald BED combBED STRFTDNA
518391
BigY2
518391
FGC
7WQZW
22224430-G-T 20062544-G-T DYZ19 ***A*
19673638-C-T 17561758-C-T P5_Prx ***A*
15486857-C-T 13374977-C-T FGC58671 YY+++
18558092-A-G 16446212-A-G FGC58674 YY**+
18331-A-G +
5340643-A-G 5472602-A-G FGC58669 +
13812980-A-G 11692274-A-G FGC58918 ++***
17816828-G-A 15704948-G-A FGC58673 YY+++
19468045-G-T 17356165-G-T FGC58675 YY+++
16678310-A-G 14566430-A-G FGC58672 Y*
22335098-C-G 20173212-C-G DYZ19 ****
10803431-C-T **
10803389-T-C **
10802390-C-T **
19436764-G-GAAAGAA 17324884-G-GAAAGAA 12×AGAA*****
10808640-C-A **
10792784-A-T **
10788519-T-C **
10785381-C-A **
10774062-T-C **
10771658-A-C **
10771109-T-C **
10804512-C-A **
10833552-A-T **
10813609-C-A **
10825155-C-A **
10833533-C-T **
10833540-G-C **
10765730-A-C **
10838408-C-A **
10839797-C-T **
10846366-C-A **
10848778-A-T **
10892055-A-C **
10899206-T-C **
10927895-A-T **
10937917-C-A **
10765820-A-C **
10663637-C-A **
10764292-C-A **
9942180-C-A 10104571-C-A **
9444882-C-G 9607273-C-G **
9444883-T-G 9607274-T-G **
9444893-A-G 9607284-A-G **
9444895-C-T 9607286-C-T **
9444909-C-CA 9607300-C-CA **
9470218-T-C 9632609-T-C **
9577049-A-C 9739440-A-C IR3_Prx **
9618360-G-T 9780751-G-T IR3_Prx **
9885080-C-A 10047471-C-A **
9926695-C-A 10089086-C-A **
9935888-G-T 10098279-G-T **
9958902-T-A 10121293-T-A **
10687727-C-A **
9980468-A-T 10142859-A-T **
10016110-T-G 10178501-T-G **
10023201-T-A 10185592-T-A **
10026337-G-C 10188728-G-C **
10059573-A-G 10221964-A-G **
10655066-CTCCATTCCAT-C **
10655177-T-C **
10661418-C-A **
10957969-CT-C **
10671926-T-G **
10672098-C-A **
10677481-C-A **
10955554-T-A **
10969522-CCATTGCA-C **
10960066-G-T **
14068429-G-A 11947723-G-A **
13887499-C-T 11766793-C-T **
13926355-C-A 11805649-C-A **
13934894-A-G 11814188-A-G **
13935533-A-C 11814827-A-C **
13940960-A-G 11820254-A-G **
13942968-A-G 11822262-A-G **
13942970-A-G 11822264-A-G **
13946771-C-A 11826065-C-A **
13998337-A-G 11877631-A-G Y24197 **
14011330-G-T 11890624-G-T **
14025967-G-A 11905261-G-A **
14035913-C-A 11915207-C-A **
14038260-C-A 11917554-C-A **
14142557-C-A 12021851-C-A **
11676359-A-T **
14142562-C-A 12021856-C-A **
14218794-T-C 12098088-T-C **
14267848-T-A 12147142-T-A **
14286951-A-G 12166245-A-G **
14297195-C-A 12176489-C-A **
14297246-T-C 12176540-T-C **
14298670-C-A 12177964-C-A **
14347995-C-A 12227290-C-A **
14373802-C-T 12253098-C-T **
14380019-A-G 12259315-A-G **
14380338-C-A 12259634-C-A **
14387599-C-A 12266895-C-A **
14389837-A-C 12269133-A-C **
13874186-T-C 11753480-T-C **
11669549-C-A **
9110103-G-T **
11021810-C-T **
10981274-A-C **
10982148-C-A **
10982294-G-C **
10988393-T-A **
11007332-C-A **
11009132-A-T **
11009136-T-C **
11009418-G-T **
11011835-C-A **
11014225-A-C **
11016634-C-A **
11016716-C-A **
11017496-T-G **
11024353-C-T **
11645756-C-A **
13197148-C-A 11041472-C-A **
13217400-C-A 11061724-C-A **
13225663-C-A 11069987-C-A **
13255822-T-G 11100146-T-G **
13255840-C-T 11100164-C-T **
13298071-C-A 11142395-C-A **
13308742-C-A 11153066-C-A **
13311034-C-A 11155358-C-A **
13486726-C-A 11331050-C-A **
13486731-C-G 11331055-C-G **
13505126-T-A 11349450-T-A **
13523593-A-G 11367917-A-G **
13565989-A-G 11410313-A-G **
13712225-T-G 11556549-T-G **
9077032-G-T 9239423-G-T **
8902123-AG-A 9034082-AG-A **
8902160-A-AT 9034119-A-AT **
3790905-T-TAC 3922864-T-TAC **
2937794-C-G 3069753-C-G **
2950497-A-G 3082456-A-G **
3011652-C-A 3143611-C-A **
3075125-A-C 3207084-A-C **
3082536-A-C 3214495-A-C **
3331019-A-C 3462978-A-C **
3367071-C-A 3499030-C-A **
3377279-C-A 3509238-C-A **
3534276-C-A 3666235-C-A **
3546027-T-C 3677986-T-C **
3547000-G-T 3678959-G-T **
3559975-A-T 3691934-A-T **
3626333-T-G 3758292-T-G **
3847144-C-T 3979103-C-T **
2928152-C-A 3060111-C-A **
4101111-A-C 4233070-A-C **
4123922-G-T 4255881-G-T **
4147308-C-A 4279267-C-A **
4241389-G-A 4373348-G-A **
4387907-A-G 4519866-A-G **
4549170-G-T 4681129-G-T **
4567226-C-A 4699185-C-A **
4671587-T-C 4803546-T-C **
4692245-G-T 4824204-G-T **
4696735-G-A 4828694-G-A **
4696766-A-C 4828725-A-C **
4875278-C-T 5007237-C-T **
4899220-G-T 5031179-G-T **
4900114-A-C 5032073-A-C **
2929065-C-A 3061024-C-A **
2860508-A-T 2992467-A-T **
4992492-C-A 5124451-C-A **
7029593-C-A 7161552-C-A **
14589534-C-A 12477734-C-A **
56847599-G-T **
6772331-A-C 6904290-A-C **
11026131-G-A **
11026142-T-G **
11026152-G-A **
11026177-G-C **
11026194-C-T **
3820829-C-A 3952788-C-A **
10654967-A-C **
13898854-C-T 11778148-C-T **
14397772-C-A 12277068-C-A **
18098993-C-A 15987113-C-A **
10905016-T-A **
2856613-C-A 2988572-C-A **
22091416-C-A 19929530-C-A **
7383850-T-C 7515809-T-C **
10661356-G-T **
2810388-TTG-T 2942347-TTG-T **
17714908-C-A 15603028-C-A **
2665863-A-T 2797822-A-T **
2688790-T-C 2820749-T-C **
2688807-G-A 2820766-G-A **
7075240-C-A 7207199-C-A 17×A**
2817082-G-T 2949041-G-T **
2853287-C-T 2985246-C-T **
2855497-A-T 2987456-A-T **
2855506-A-G 2987465-A-G **
2856599-C-A 2988558-C-A **
4930912-C-A 5062871-C-A **
4992520-C-A 5124479-C-A **
14421863-C-A 12301138-C-A **
7646497-T-A 7778456-T-A **
7201611-A-G 7333570-A-G **
7222217-A-G 7354176-A-G **
7281801-T-G 7413760-T-G **
7294427-C-A 7426386-C-A **
7306681-C-A 7438640-C-A **
7306788-A-G 7438747-A-G **
7348476-T-C 7480435-T-C **
7382465-T-C 7514424-T-C **
7383851-CAAAA-C 7515810-CAAAA-C 24×A**
7402153-C-A 7534112-C-A **
7577168-T-G 7709127-T-G **
7643238-C-A 7775197-C-A **
7645111-G-T 7777070-G-T **
7670713-A-G 7802672-A-G **
7156220-G-T 7288179-G-T **
7783360-T-C 7915319-T-C **
7970951-C-A 8102910-C-A **
7974195-T-C 8106154-T-C **
7996148-G-T 8128107-G-T **
8112648-A-G 8244607-A-G **
8112654-A-G 8244613-A-G **
8112656-G-A 8244615-G-A **
8159696-C-A 8291655-C-A **
8172687-CTTTTTTT-C 8304646-CTTTTTTT-C 22×T**
8276181-C-A 8408140-C-A **
8409253-C-A 8541212-C-A **
8776541-T-C 8908500-T-C Y30379 **
8817100-C-A 8949059-C-A **
8848198-A-T 8980157-A-T **
7156263-A-C 7288222-A-C **
7154710-T-C 7286669-T-C **
5011347-T-C 5143306-T-C **
6765971-A-G 6897930-A-G **
5122775-G-T 5254734-G-T **
5180158-C-T 5312117-C-T **
5426337-T-C 5558296-T-C **
5577282-A-T 5709241-A-T **
5601052-C-A 5733011-C-A **
5645136-T-C 5777095-T-C **
6368806-G-T 6500765-G-T **
6434970-C-A 6566929-C-A **
6480084-A-G 6612043-A-G **
6480145-A-G 6612104-A-G **
6579532-C-A 6711491-C-A **
6634191-A-C 6766150-A-C **
6647045-C-T 6779004-C-T **
6748050-A-T 6880009-A-T **
6775444-A-T 6907403-A-T **
7102040-C-A 7233999-C-A **
6809197-C-A 6941156-C-A **
6874521-C-A 7006480-C-A **
6900986-A-G 7032945-A-G **
6922493-C-A 7054452-C-A **
7009244-C-A 7141203-C-A **
7043580-G-T 7175539-G-T **
7052390-C-A 7184349-C-A **
7054353-C-A 7186312-C-A **
7078419-G-T 7210378-G-T **
7083121-C-A 7215080-C-A **
7085155-C-A 7217114-C-A **
7100463-A-T 7232422-A-T **
7100535-C-A 7232494-C-A **
7100631-A-G 7232590-A-G **
14397834-C-A 12277130-C-A **
14499438-G-T 12387643-G-T **
14422319-C-G 12301594-C-G **
22123024-C-A 19961138-C-A **
21177269-C-G 19015383-C-G **
21201848-C-T 19039962-C-T **
21201935-T-C 19040049-T-C **
21208927-C-A 19047041-C-A **
21253992-C-A 19092106-C-A **
21436618-C-A 19274732-C-A **
21476887-C-A 19315001-C-A **
21500283-C-A 19338397-C-A **
21658609-C-G 19496723-C-G **
21670239-C-A 19508353-C-A **
22055414-C-A 19893528-C-A **
22067657-C-A 19905771-C-A **
22076000-C-A 19914114-C-A **
22164373-A-G 20002487-A-G **
21151710-A-G 18989824-A-G **
22164382-A-C 20002496-A-C **
22164376-CAAAAAAAAAAAA-C 20002490-CAAAAAAAAAAAA-C 22×A**
22183017-C-A 20021131-C-A **
22229281-G-T 20067395-G-T DYZ19 **
22244723-G-A 20082837-G-A DYZ19 **
22258174-A-C 20096288-A-C DYZ19 **
22311253-G-C 20149367-G-C DYZ19 **
22483985-C-A 20322099-C-A DYZ19 **
22520748-C-A 20358862-C-A **
22561424-T-G 20399538-T-G **
22579415-T-C 20417529-T-C **
22611397-G-T 20449511-G-T Y131245 **
22767331-C-A 20605445-C-A **
21153388-C-T 18991502-C-T **
21140155-G-T 18978269-G-T **
22810042-C-A 20648156-C-A **
19510023-A-C 17398143-A-C **
18925611-C-A 16813731-C-A **
18930019-C-A 16818139-C-A **
18951354-G-T 16839474-G-T **
18959025-G-A 16847145-G-A **
18989698-T-A 16877818-T-A **
19087935-C-A 16976055-C-A **
19122139-C-A 17010259-C-A **
19122176-C-A 17010296-C-A **
19143191-C-A 17031311-C-A **
19294934-A-T 17183054-A-T **
19351460-G-T 17239580-G-T **
19479788-G-T 17367908-G-T **
19509942-C-T 17398062-C-T **
19510327-C-A 17398447-C-A **
20888635-C-A 18726749-C-A P4_Dst **
19813019-A-G 17701139-A-G P5_Prx **
19948132-T-TC 17836252-T-TC P5_Prx **
19948142-C-CT 17836262-C-CT P5_Prx **
19948153-C-T 17836273-C-T P5_Prx **
20243788-T-G 18081902-T-G P5_Dst **
20326063-A-G 18164177-A-G P5_Dst **
20404468-AAAAAAAG-A 18242582-AAAAAAAG-A P5_Dst **
20637707-T-G 18475821-T-G P4_Prx **
20641690-G-T 18479804-G-T P4_Prx **
20677941-T-TG 18516055-T-TG P4_Prx **
20712419-A-T 18550533-A-T P4_Prx **
20793458-A-AT 18631572-A-AT P4_Prx **
20825661-C-A 18663775-C-A P4_Gap **
22792555-C-A 20630669-C-A **
22902085-G-A 20740199-G-A **
18924900-T-G 16813020-T-G **
28648720-T-G 26502573-T-G **
27620769-AC-A 25474622-AC-A P1_Y2 **
27714398-T-C 25568251-T-C P1_Y2 **
27822397-C-A 25676250-C-A P1_Y2 **
27823632-A-C 25677485-A-C P1_Y2 **
27847899-C-T 25701752-C-T P1_Y2 **
27847910-C-A 25701763-C-A P1_Y2 **
28062622-C-G 25916475-C-G P1_Y2 **
28480170-C-A 26334023-C-A **
28606085-C-A 26459938-C-A **
28621995-A-G 26475848-A-G **
28622018-A-G 26475871-A-G **
28648632-A-T 26502485-A-T **
28648710-T-G 26502563-T-G **
28648726-A-T 26502579-A-T **
26276102-G-T 24129955-G-T P1_Y1 **
28728395-C-A 26582248-C-A **
28734286-T-A 26588139-T-A **
28802612-T-G 26656465-T-G **
28802614-G-T 26656467-G-T **
28808613-T-G 26662466-T-G **
56836137-A-G **
56840620-C-A **
56844670-A-G **
56847883-G-T **
56849005-A-C **
56850601-G-T **
56876022-C-A **
56877071-CT-C **
27021869-T-G 24875722-T-G P1_r4 **
26248059-G-T 24101912-G-T P1_Y1 **
22951355-C-T 20789469-C-T **
23808279-C-A 21646393-C-A **
22965223-C-A 20803337-C-A **
22965248-T-C 20803362-T-C **
22995493-C-A 20833607-C-A **
22997894-C-A 20836008-C-A **
23098810-C-A 20936924-C-A **
23145917-C-A 20984031-C-A **
23272240-CCA-C 21110354-CCA-C **
23272290-T-C 21110404-T-C **
23306067-A-G 21144181-A-G **
23397137-T-C 21235251-T-C **
23438826-C-A 21276940-C-A **
23564787-A-T 21402901-A-T **
23577143-C-A 21415257-C-A **
24241285-A-AG 22095138-A-AG P3_b1 **
26199601-ATATAT-A 24053454-ATATAT-A P1_Y1 **
24342338-C-A 22196191-C-A P3_t1 **
24409203-T-C 22263056-T-C **
24416946-C-A 22270799-C-A **
24466034-C-G 22319887-C-G **
24466036-C-T 22319889-C-T **
24910828-C-T 22764681-C-T g1 **
24910836-G-T 22764689-G-T g1 **
24929739-T-C 22783592-T-C g1 **
25096540-C-A 22950393-C-A g1 **
25995577-G-A 23849430-G-A P1_Y1 **
26095663-G-T 23949516-G-T P1_Y1 **
26101509-A-G 23955362-A-G P1_Y1 **
26133118-G-T 23986971-G-T P1_Y1 **
18925026-CT-C 16813146-CT-C **
18873655-A-T 16761775-A-T **
14468165-C-A 12347434-C-A **
15617930-C-A 13506050-C-A **
15175859-T-C 13063945-T-C **
15201603-G-A 13089689-G-A **
15221979-A-T 13110065-A-T **
15274617-TA-T 13162706-TA-T **
15280813-A-T 13168912-A-T **
15325091-A-C 13213209-A-C **
15398385-T-C 13286505-T-C **
15400541-G-T 13288661-G-T **
15442276-G-A 13330396-G-A **
15468518-A-G 13356638-A-G **
15478808-C-A 13366928-C-A **
15532959-T-C 13421079-T-C **
15532963-T-C 13421083-T-C **
15670343-T-A 13558463-T-A **
15084682-A-C 12972772-A-C **
15732896-T-A 13621016-T-A **
15734163-C-T 13622283-C-T **
15777125-G-A 13665245-G-A **
15777466-C-A 13665586-C-A **
15791175-A-C 13679295-A-C **
15832125-C-A 13720245-C-A **
15839790-C-A 13727910-C-A **
15862519-C-A 13750639-C-A **
15871574-C-T 13759694-C-T **
15871770-ATTT-A 13759890-ATTT-A 8×T**
15901297-A-C 13789417-A-C **
15912184-T-G 13800304-T-G **
15916208-C-A 13804328-C-A **
15109638-G-T 12997725-G-T **
15076239-C-T 12964329-C-T **
15927962-C-A 13816082-C-A **
14561812-C-A 12450013-C-A **
14482255-C-A 12361524-C-A **
14488302-G-C 12367571-G-C **
14488303-A-G 12367572-A-G **
14492706-A-T 12380903-A-T **
20094661-GT-G 17982781-GT-G P5_Dst **
14502071-C-A 12390276-C-A **
14511409-C-A 12399614-C-A **
14518520-T-C 12406721-T-C **
14518596-T-C 12406797-T-C **
14521582-C-A 12409783-C-A **
14521655-C-A 12409856-C-A **
14544148-T-C 12432349-T-C **
14553217-C-A 12441418-C-A **
14620295-T-C 12508493-T-C **
15076216-G-A 12964306-G-A **
14622088-C-A 12510286-C-A **
14639053-T-G 12527122-T-G **
14657579-G-A 12545644-G-A **
14688806-A-G 12576872-A-G FGC49118 **
14698535-C-A 12586601-C-A **
14769165-G-T 12657234-G-T **
14776993-C-A 12665062-C-A **
14798459-T-A 12686530-T-A **
14934353-G-A 12822418-G-A **
14977363-A-G 12865438-A-G **
14977376-G-C 12865451-G-C **
14977392-C-G 12865467-C-G **
14981752-T-C 12869828-T-C **
15921927-T-C 13810047-T-C **
15952764-C-A 13840884-C-A **
18867364-G-TT 16755484-G-TT **
17434017-C-A 15322137-C-A **
17206466-C-A 15094586-C-A **
17254687-C-A 15142807-C-A **
17277328-C-A 15165448-C-A **
17297251-T-C 15185371-T-C **
17323640-G-T 15211760-G-T **
17327374-C-A 15215494-C-A **
17330235-C-A 15218355-C-A **
17387475-T-A 15275595-T-A **
17389897-T-C 15278017-T-C **
17426295-C-A 15314415-C-A **
17428101-G-A 15316221-G-A **
17428111-G-T 15316231-G-T **
17428116-TTG-T 15316236-TTG-T **
17550794-C-A 15438914-C-A **
17183508-C-A 15071628-C-A **
17650241-C-A 15538361-C-A **
17672152-T-C 15560272-T-C **
17721036-A-C 15609156-A-C **
17807351-A-G 15695471-A-G **
17923472-G-C 15811592-G-C **
18151939-A-T 16040059-A-T **
18195167-T-A 16083287-T-A **
18195859-T-C 16083979-T-C **
18212619-C-A 16100739-C-A **
18480045-A-AG 16368165-A-AG P6_Dst **
18738240-A-G 16626360-A-G **
18763648-C-A 16651768-C-A **
18848433-A-C 16736553-A-C **
17201752-C-T 15089872-C-T **
17158560-C-A 15046680-C-A **
15967501-TC-T 13855621-TC-T **
16412896-C-A 14301016-C-A **
15969763-A-G 13857883-A-G **
15988127-T-A 13876247-T-A **
16007853-A-C 13895973-A-C **
16018321-A-G 13906441-A-G **
16028321-T-C 13916441-T-C **
16032416-C-A 13920536-C-A **
16044959-C-T 13933079-C-T **
16192741-C-A 14080861-C-A **
16214253-G-T 14102373-G-T **
16240822-T-C 14128942-T-C **
16275971-A-C 14164091-A-C **
16275995-C-A 14164115-C-A **
16402622-C-A 14290742-C-A **
16462849-A-G 14350969-A-G **
17146428-T-C 15034548-T-C **
16475377-C-A 14363497-C-A **
16514508-T-A 14402628-T-A **
16515809-C-A 14403929-C-A **
16667257-C-A 14555377-C-A **
16707478-C-G 14595598-C-G **
16842050-A-T 14730170-A-T **
16877005-A-G 14765125-A-G **
16908388-G-A 14796508-G-A **
16913275-C-A 14801395-C-A **
17048171-C-A 14936291-C-A **
17088909-T-A 14977029-T-A **
17095269-A-G 14983389-A-G **
17117357-AC-A 15005477-AC-A **
7534500-A-T 7666459-A-T **
2688808-T-C 2820767-T-C **
9577053-G-C 9739444-G-C IR3_Prx **
21132677-C-T 18970791-C-T **
15882071-TC-T 13770191-TC-T **
19337669-G-T 17225789-G-T **
13461015-G-A 11305339-G-A **
11026151-C-G **
21984045-C-A 19822159-C-A **
18963988-A-T 16852108-A-T **
17030992-C-A 14919112-C-A 19×A**
15684222-A-C 13572342-A-C **
13871973-C-A 11751267-C-A **
22022896-C-A 19861010-C-A **
10792708-A-C **
22536977-C-A 20375091-C-A **
24671171-T-A 22525024-T-A P3_b2 **
22536967-C-A 20375081-C-A **
10987213-A-T **
7197362-C-A 7329321-C-A **
11026205-C-T **
10691344-C-CTCCAT **
18925259-C-A 16813379-C-A **
10069962-T-C 10232353-T-C **
10069923-C-T 10232314-C-T **
10969281-C-A **
14884692-C-T 12772758-C-T **
2860458-GTT-G 2992417-GTT-G 18×T**
4533729-C-A 4665688-C-A **
14449762-C-A 12329035-C-A **
9968355-G-TT 10130746-G-TT **
14986616-T-TTC 12874684-T-TTC 17×TC**
13316152-C-A 11160476-C-A **
19111468-C-A 16999588-C-A **
23059618-C-A 20897732-C-A **
20440393-T-TTGC 18278507-T-TTGC P5_Dst **
10763332-TTTCC-T **
10763323-C-T **
14384309-G-T 12263605-G-T **
10792782-C-T **
13488828-T-G 11333152-T-G **
20404488-T-A 18242602-T-A P5_Dst **
28622005-A-T 26475858-A-T **
22963362-C-A 20801476-C-A **
10969291-C-A **
7078408-G-T 7210367-G-T **
16896539-CAAAAA-C 14784659-CAAAAA-C 17×A**
10954533-A-C **
23831294-T-A 21669408-T-A **
15364051-C-A 13252171-C-A **
3440215-C-A 3572174-C-A **
10769631-A-G **
10769603-C-T **
10769594-C-T **
10769591-T-A **
10769589-A-C **
10769583-T-C **
18511563-G-T 16399683-G-T P6_Dst **
18611803-C-A 16499923-C-A **
19042986-C-T 16931106-C-T FGC53149 **
6807201-C-A 6939160-C-A **
56836148-T-G **
17201756-A-T 15089876-A-T **
20326073-G-T 18164187-G-T P5_Dst **
13486729-C-G 11331053-C-G **
25995492-G-GTA 23849345-G-GTA P1_Y1 24×TA**
21132669-C-T 18970783-C-T **
59027384-A-C 56881237-A-C **
59017346-A-G 56871199-A-G **
59014251-A-G 56868104-A-G **
59014226-C-T 56868079-C-T **
59014206-A-C 56868059-A-C **
59004185-G-A 56858038-G-A **
14041053-C-A 11920347-C-A Z25309 **
13488781-T-A 11333105-T-A **
13500181-G-A 11344505-G-A **
7717604-C-CCTTTT 7849563-C-CCTTTT **
13500074-C-A 11344398-C-A **
13460422-T-C 11304746-T-C **
13282302-C-T 11126626-C-T **
13257283-ATATATAT-A 11101607-ATATATAT-A **
6054884-T-C 6186843-T-C **
15912178-A-G 13800298-A-G **
21118158-T-TAC 18956272-T-TAC FGC5438 22×AC**
17999209-C-T 15887329-C-T FGC55706 P7_Gap **
17999180-A-G 15887300-A-G P7_Gap **
7394143-A-G 7526102-A-G **
13270745-A-G 11115069-A-G **
58848804-A-C 56742067-T-G **
17225835-C-A 15113955-C-A **
22164362-A-C 20002476-A-C FGC23293 **
7643541-A-AGGAAG 7775500-A-AGGAAG 16×GGAAG**
15142261-A-T 13030348-A-T **
5094042-CTTTTTT-C 5226001-CTTTTTT-C 27×T**
3559956-AAT-A 3691915-AAT-A **
3306217-GTATA-G 3438176-GTATA-G 10×TA**
23513065-G-A 21351179-G-A **
23318905-A-G 21157019-A-G **
23086660-T-C 20924774-T-C **
22990547-G-A 20828661-G-A **
20354836-T-C 18192950-T-C P5_Dst **
19433959-T-C 17322079-T-C **
17999245-G-A 15887365-G-A P7_Gap **
16653153-C-A 14541273-C-A **
15842747-T-C 13730867-T-C **
13385840-G-A 11230164-G-A **
58974430-C-T 56828283-C-T **
13354799-C-T 11199123-C-T **
8236323-C-A 8368282-C-A **
8236291-G-A 8368250-G-A **
6625107-G-T 6757066-G-T **
6496150-A-G 6628109-A-G **
4911566-G-A 5043525-G-A FGC40858 **
4735527-T-C 4867486-T-C **
4728421-A-G 4860380-A-G **
3460606-T-C 3592565-T-C **
6359640-TAAAAAA-T 6491599-TAAAAAA-T 22×A**
58974444-T-G 56828297-T-G **
58974431-A-G 56828284-A-G **
15556724-C-A 13444844-C-A **
30058-G-T **
13910007-C-A 11789301-C-A **
14977395-A-G 12865470-A-G **
10788381-G-T **
11024797-G-A **
9181025-C-A 9343416-C-A **
20404489-T-A 18242603-T-A P5_Dst **
19107459-C-A 16995579-C-A **
11672506-C-A **
11009133-G-C **
56849575-G-T **
14823722-C-A 12711789-C-A **
5274364-C-A 5406323-C-A **
14977396-T-C 12865471-T-C **
18708073-T-C 16596193-T-C **
7436131-T-G 7568090-T-G **
17616898-C-A 15505018-C-A **
18708056-T-C 16596176-T-C **
19498091-C-A 17386211-C-A **
18924941-C-A 16813061-C-A **
14021435-C-A 11900729-C-A **
27862667-C-G 25716520-C-G P1_Y2 **
7169990-C-A 7301949-C-A **
13856230-C-A 11735524-C-A **
8093452-C-A 8225411-C-A **
13887495-C-G 11766789-C-G **
10032835-C-A 10195226-C-A **
9440291-C-A 9602682-C-A **
23098804-G-T 20936918-G-T **
23045941-C-A 20884055-C-A **
9398018-C-A 9560409-C-A **
21201086-C-A 19039200-C-A **
23310731-C-A 21148845-C-A **
9444879-C-G 9607270-C-G **
19107366-C-A 16995486-C-A **
11020180-G-T **
17545547-G-T 15433667-G-T **
11026121-TC-T **
8153883-A-G 8285842-A-G **
11026202-T-C **
11026113-C-T **
10662291-C-A **
14384311-G-T 12263607-G-T **
15677716-G-T 13565836-G-T **
11026145-C-G **
10750953-C-A **
9960004-C-A 10122395-C-A **
3606329-C-A 3738288-C-A **
24875559-C-A 22729412-C-A g1 **
22207294-C-A 20045408-C-A **
18188850-C-A 16076970-C-A **
22993557-A-G 20831671-A-G **
13974693-C-T 11853987-C-T 17×T**
10663363-T-C **
10865676-C-A **
28622001-A-G 26475854-A-G **
14560778-C-A 12448979-C-A **
7363157-T-A 7495116-T-A 18×A**
10892413-C-A **
14711861-C-A 12599928-C-A **
16551073-C-A 14439193-C-A **
11018992-C-A **
11025307-C-T **
10987200-T-TCCTCTCAAAA **
11025304-T-A **
11025292-C-G **
18819732-TTTTTTC-T 16707852-TTTTTTC-T **
4241391-C-A 4373350-C-A **
9590560-T-TC 9752951-T-TC IR3_Prx **
8379254-C-A 8511213-C-A **
20212999-G-T 18051113-G-T P5_Dst **
16471581-C-A 14359701-C-A **
4873753-C-A 5005712-C-A **
9444861-A-C 9607252-A-C **
15131564-C-A 13019651-C-A **
17158539-C-A 15046659-C-A **
10983264-A-T **
16551010-C-A 14439130-C-A **
21153397-G-A 18991511-G-A **
11025311-T-TCTTCC **
13460417-C-A 11304741-C-A **
27699979-G-T 25553832-G-T P1_Y2 **
10983463-G-A **
56828263-CCATGT-C **
24910851-T-A 22764704-T-A g1 **
11026222-T-C **
10983472-A-T **
10983468-C-T **
7670761-T-G 7802720-T-G **
10839553-TTTCCA-T **
15650430-C-A 13538550-C-A **
5861239-C-A 5993198-C-A **
10983458-C-T **
56828936-TTCCATTCCATTCCA-T,TTCCGGAATATTCCATTCCAT ***
58986753-G-A 56840606-G-A ***
2706828-G-A 2838787-G-A ***
58874810-G-A 56716061-C-T ***
58868288-A-C 56722583-T-G ***
58874799-C-G 56716072-G-C ***
4818264-T-C 4950223-T-C A3673 ***
5588594-T-TA 5720553-T-TA 15×A***
13802762-C-A 11682056-C-A ***
6541475-CAGAG-C 6673434-CAGAG-C 17×AG***
13455734-C-G 11300058-C-G ***
3378628-A-G 3510587-A-G FGC47300 ***
13455788-CCATTCTATT-C 11300112-CCATTCTATT-C ***
13347932-TACAC-T 11192256-TACAC-T 21×AC***
58991999-CG-TC 56845852-CG-TC ***
5253170-CT-C 5385129-CT-C 23×T***
22264270-CCTC-GCTG 20102384-CCTC-GCTG DYZ19 ***
58986774-G-C 56840627-G-C ***
19395220-C-A 17283340-C-A ***
58986807-G-T 56840660-G-T ***
6648613-CTTT-C 6780572-CTTT-C 27×T***
19309460-TAC-T 17197580-TAC-T 11×AC***
22241587-GTAAG-CCTAA 20079701-GTAAG-CCTAA DYZ19 ***
19562703-C-A 17450823-C-A ***
13704797-G-C 11549121-G-C ***
19404102-C-A 17292222-C-A ***
15290982-CT-C 13179081-CT-C 17×T***
7282159-CT-C 7414118-CT-C 22×T***
58986769-T-G 56840622-T-G ***
19029927-T-G 16918047-T-G ***
19055369-G-T 16943489-G-T ***
19052414-CA-C 16940534-CA-C 24×A***
13461130-ATAGGT-GTAGGC 11305454-ATAGGT-GTAGGC ***
14390965-T-G 12270261-T-G YFS287751 ***
18628003-C-A 16516123-C-A ***
13704812-G-C 11549136-G-C ***
2931740-A-T 3063699-A-T ***
3144424-C-G 3276383-C-G ***
56849503-C-A ***
3630782-T-C 3762741-T-C ***
58890362-A-G 56700509-T-C ***
3641075-C-A 3773034-C-A ***
4057294-T-A 4189253-T-A ***
4571258-A-C 4703217-A-C ***
19422989-CCCT-C 17311109-CCCT-C 5×CCT***
4913735-T-G 5045694-T-G ***
4502297-A-G 4634256-A-G ***
5007865-A-G 5139824-A-G ***
5570494-C-G 5702453-C-G ***
5571128-C-A 5703087-C-A ***
16926951-C-A 14815071-C-A ***
5575352-T-C 5707311-T-C ***
5639307-A-G 5771266-A-G ***
5729977-T-A 5861936-T-A ***
22502237-T-A 20340351-T-A DYZ19 ***
5809393-C-G 5941352-C-G ***
2665651-C-G 2797610-C-G ***
13453376-T-C 11297700-T-C ***
18563077-GA-G 16451197-GA-G 9×A***
6131029-G-GGT 6262988-G-GGT ***
58883337-C-T 56707534-G-A ***
13728467-ATGT-CTGA 11572791-ATGT-CTGA ***
13345821-G-T 11190145-G-T ***
13345820-CG-TT 11190144-CG-TT ***
13931739-C-CT 11811033-C-CT 22×T***
18039514-G-A 15927634-G-A ***
17997461-T-A 15885581-T-A P7_Gap ***
13380527-T-TC 11224851-T-TC ***
5945467-CT-C 6077426-CT-C 25×T***
6131030-A-C 6262989-A-C ***
4502332-C-T 4634291-C-T ***
22429477-C-G 20267591-C-G DYZ19 ***
24128688-T-G 21982541-T-G P3_b1 ***
5007689-CAA-C 5139648-CAA-C 22×A***
24971909-A-G 22825762-A-G g1 ***
13270281-T-G 11114605-T-G ***
13468398-GGAG-AGAC 11312722-GGAG-AGAC ***
26808226-C-T 24662079-C-T P1_g2 ***
59021207-TTG-GTA 56875060-TTG-GTA ***
15015255-CTTTTTTT-C 12903343-CTTTTTTTT-C 24×T***
7803353-G-GA 7935312-G-GA 10×A***
22293128-CA-AG 20131242-CA-AG DYZ19 ***
7130197-T-TA 7262156-T-TA 10×A***
22341454-G-C 20179568-G-C A15170 DYZ19 ***
23578769-C-T 21416883-C-T ***
16908477-G-A 14796597-G-A ***
18527791-T-C 16415911-T-C P6_Dst ***
21827597-C-A 19665711-C-A Y57255 ***
22876964-TA-T 20715078-TA-T 20×A***
59003855-G-A 56857708-G-A ***
59027420-C-G 56881273-C-G ***
9974235-ATA-CTC 10136626-ATA-CTC ***
9336652-AC-CT 9499043-AC-CT ***
13476865-GA-G 11321189-GA-G ***
23059012-CT-C 20897126-CT-C ***
22264255-AG-CA 20102369-AG-CA DYZ19 ***
58853454-A-C 56737417-T-G ***
28635248-TATGCT-T,TATGCG 26489101-TATGCT-T,TATGCG ***
15492683-G-GA 13380803-G-GA 10×A***
13143784-GCACTGCACAT-CCACTCCACTC,G 10633270-GCACTGCACAT-CCACTCCACTC,G ***
10023769-GTC-G 10186160-GTC-G ***
22940686-G-GT 20778800-G-GT 10×T***
14642451-G-T 12530520-G-T ***
13345820-C-T 11190144-C-T ***
13446371-T-G 11290695-T-G ***
5179515-GAT-G 5311474-GAT-G 13×AT***
22491395-C-G 20329509-C-G DYZ19 ***
14959560-A-C 12847635-A-C ***
5344509-T-A 5476468-T-A ***
22237029-C-G 20075143-C-G DYZ19 ***
22237032-T-A 20075146-T-A DYZ19 ***
22237038-C-A 20075152-C-A DYZ19 ***
28814976-AAGGAATGGG-GTGTAATTGA 26668829-AAGGAATGGG-GTGTAATTGA ***
13451839-TTTTTA-CTGTAG 11296163-TTTTTA-CTGTAG ***
3271624-A-T 3403583-A-T ***
13476862-C-G 11321186-C-G ***
4503350-T-C 4635309-T-C ***
4503383-A-G 4635342-A-G ***
15179010-CA-C 13067096-CA-C 25×A***
23331119-GAA-G 21169233-GAA-G 11×A***
4207957-CA-C 4339916-CA-C 22×A***
8221244-TG-T 8353203-TG-T ***
9407722-A-G 9570113-A-G M649 PF6169 ***
56836652-A-G ***
13270296-T-G 11114620-T-G ***
13259941-T-G 11104265-T-G ***
22804213-G-A 20642327-G-A Y43963 ***
14610908-C-CATAG 12499114-C-CATAG ***
13272929-C-T 11117253-C-T ***
13472029-T-C 11316353-T-C ***
22480584-GTTTGAA-G 20318698-GTTTGAA-G DYZ19 ***
21472211-C-T 19310325-C-T ***
21443889-C-A 19282003-C-A ***
58825004-T-C 56765867-A-G ***
13270201-C-T 11114525-C-T ***
22287093-A-G 20125207-A-G DYZ19 ***
13478281-ATCCG-CTCCT 11322605-ATCCG-CTCCT ***
4503310-GTATTAT-G 4635269-GTATTAT-G 16×TAT***
22236846-AGT-TGG 20074960-AGT-TGG DYZ19 ***
58984994-TACC-CACT 56838847-TACC-CACT ***
13445674-AAA-T 11289998-AAA-T ***
58853574-A-T 56737297-T-A ***
58865840-T-A 56725031-A-T ***
6493953-CA-C 6625912-CA-C 19×A***
4818228-G-T 4950187-G-T A3672 ***
28776944-T-A 26630797-T-A ***
58868369-T-G 56722502-A-C ***
58868407-C-G 56722464-G-C ***
21532701-T-C 19370815-T-C ***
15255769-G-GGT 13143855-G-GGTGT 24×GT***
16340186-C-A 14228306-C-A ***
14266354-C-A 12145648-C-A ***
22161642-C-T 19999756-C-T ***
19010482-CAA-C,CA 16898602-CAA-C,CA 14×A***
59008043-G-T 56861896-G-T ***
59010417-A-G 56864270-A-G ***
22537853-A-G 20375967-A-G ***
22426953-C-A 20265067-C-A DYZ19 ***
6012204-T-G 6144163-T-G ***
22295025-AGC-GGT 20133139-AGC-GGT DYZ19 ***
13489309-G-T 11333633-G-T ***
21921834-C-A 19759948-C-A ***
22293092-GGTT-AGTG 20131206-GGTT-AGTG DYZ19 ***
22502228-T-A 20340342-T-A DYZ19 ***
22502286-G-T 20340400-G-T DYZ19 ***
58862833-T-G 56728038-A-C ***
15718171-C-A 13606291-C-A ***
22262586-T-G 20100700-T-G DYZ19 ***
21994068-T-C 19832182-T-C ***
21985061-A-T 19823175-A-T ***
21960380-C-A 19798494-C-A ***
5913889-A-C 6045848-A-C ***
13344888-C-T 11189212-C-T ***
16638974-C-A 14527094-C-A ***
5493431-C-CT 5625390-C-CT 24×T***
58895755-T-C 56695116-A-G ***
58903936-C-T 56686935-G-A ***
4424377-GT-G 4556336-GT-G 18×T***
13227420-C-A 11071744-C-A ***
13225976-C-A 11070300-C-A ***
7149622-C-CT 7281581-C-CT 19×T***
3525466-GT-G 3657425-GT-G 11×T***
3961155-C-A 4093114-C-A ***
4503344-TATTATT-C 4635303-TATTATT-C ***
5905890-CAAA-C 6037849-CAAA-C 27×A***
58892449-C-T 56698422-G-A ***
6091720-ATTT-A 6223679-ATTT-A 28×T***
7015324-C-CT 7147283-C-CT 23×T***
8218125-T-TTCTG 8350084-T-TTCTG ***
9429665-TACAA-T 9592056-TACAA-T ***
10066135-CA-C 10228526-CA-C 11×A***
13142801-CC-TA 10632287-CC-TA ***
13447180-TG-CC 11291504-TG-CC ***
15604353-TCAA-T 13492473-TCAA-T ***
16996647-C-CTTT 14884767-C-CTTT ***
17522522-TG-T 15410642-TG-T ***
58895742-T-A 56695129-A-T ***
58892442-T-C 56698429-A-G ***
21569958-TAAAAAAAAAAAAAAAAAAAAAAAA-T 19408072-TAAAAAAAAAAAAAAAAAAAAAAAA-T 46×A***
58850800-T-A 56740071-A-T ***
25709416-T-G 23563269-T-G P1_b3 ***
26543486-C-G 24397339-C-G P1_g2 ***
27814173-A-G 25668026-A-G P1_Y2 ***
28162793-T-A 26016646-T-A P1_b4 ***
28187246-T-C 26041099-T-C P1_b4 ***
28488402-A-G 26342255-A-G ***
28556210-T-A 26410063-T-A ***
28563249-C-A 26417102-C-A ***
58850731-C-T 56740140-G-A ***
58853472-G-A 56737399-C-T ***
58892283-A-G 56698588-T-C ***
13798802-G-T 11678096-G-T ***
58862705-A-C 56728166-T-G ***
58868198-A-G 56722673-T-C ***
11657432-G-T ***
11645926-T-A ***
58868236-C-G 56722635-G-C ***
58868278-G-T 56722593-C-A ***
58868334-T-C 56722537-A-G ***
58883374-C-T 56707497-G-A ***
58892232-T-G 56698639-A-C ***
17564912-GAAAAAA-G 15453032-GAAAAAA-G 16×A***
23747205-CTTTTTT-C 21585319-CTTTTTT-C 29×T***
25510861-C-A 23364714-C-A P1_gr1 ***
8033994-A-G 8165953-A-G ***
8987567-G-T 9149958-G-T ***
21039312-CT-C 18877426-CT-C 10×T***
2649789-C-G 2781748-C-G ***
8286733-C-A 8418692-C-A ***
22783184-T-C 20621298-T-C ***
8273638-T-C 8405597-T-C MF3280 ***
8171102-T-A 8303061-T-A ***
23196200-A-T 21034314-A-T ***
8125054-AG-A,AAGAAG 8257013-AG-A,AAGAAG ***
13802772-G-A 11682066-G-A ***
9075170-T-C 9237561-T-C ***
14571404-C-A 12459604-C-A ***
10763276-CA-C ***
7853157-C-A 7985116-C-A ***
10763280-C-CG ***
7765646-C-A 7897605-C-A ***
7157720-TA-T 7289679-TA-T ***
13802771-T-C 11682065-T-C ***
23463276-G-T 21301390-G-T ***
11652932-C-A ***
21785240-T-TA 19623354-T-TA 10×A***
9003059-G-T 9165450-G-T ***
21990522-C-A 19828636-C-A ***
25200893-A-AAG 23054746-A-AAG g1 ***
9852671-C-A 10015062-C-A ***
26730200-GA-AAAAAG 24584053-GA-AAAAAG P1_g2 ***
28818262-AAATT-GAATC 26672115-AAATT-GAATC ***
58982126-C-CA 56835979-C-CA ***
59030171-AGGT-GG 56884024-AGGT-GG ***
4240669-C-A 4372628-C-A ***
18161218-C-T 16049338-C-T ***
56827687-T-GCATGCCATCCGATTC ***
23380297-C-A 21218411-C-A ***
18384474-C-A 16272594-C-A P6_Gap ***
10678039-CTCCAC-C,CTCCAT ***
9371471-T-C 9533862-T-C ***
7134859-C-A 7266818-C-A ***
10692264-C-A,T ***
5368175-G-T 5500134-G-T ***
10669639-C-A ***
5720811-C-A 5852770-C-A ***
10804798-T-TCAATG ***
22783190-G-A 20621304-G-A ***
9771054-ATT-A,AT 9933445-ATT-A,AT 16×T***
9462034-G-T 9624425-G-T ***
10780644-G-A,T ***
25566306-A-T 23420159-A-T P1_gr1 ***
25200901-A-G 23054754-A-G g1 ***
6045614-A-G 6177573-A-G ***
13992149-A-C 11871443-A-C ***
13338027-C-G 11182351-C-G ***
13363029-C-T 11207353-C-T ***
15789298-C-A 13677418-C-A ***
13523538-G-A 11367862-G-A ***
13549431-G-C 11393755-G-C ***
13567117-C-G 11411441-C-G ***
13708647-A-C 11552971-A-C ***
13744219-A-G 11588543-A-G ***
13977223-G-C 11856517-G-C ***
14058724-G-A 11938018-G-A ***
13141174-G-T 10630660-G-T ***
14119347-A-G 11998641-A-G ***
15471001-G-A 13359121-G-A ***
14632193-A-G 12520262-A-G ***
14633033-A-G 12521102-A-G ***
14739844-C-T 12627912-C-T ***
14739850-C-T 12627918-C-T ***
14795103-T-G 12683174-T-G ***
15307529-T-C 13195631-T-C ***
14986275-T-G 12874343-T-G ***
15363942-C-T 13252062-C-T ***
13239531-G-A 11083855-G-A ***
10000117-A-G 10162508-A-G ***
15853095-T-C 13741215-T-C ***
16046184-TC-A 13934304-TC-A ***
6485542-A-T 6617501-A-T ***
6617305-G-A 6749264-G-A ***
6726181-A-G 6858140-A-G ***
6726208-C-A 6858167-C-A ***
7021726-T-G 7153685-T-G ***
7027365-C-T 7159324-C-T ***
7298121-A-C 7430080-A-C ***
7311410-A-T 7443369-A-T ***
16180781-C-A 14068901-C-A ***
7311414-C-T 7443373-C-T ***
9997735-G-T 10160126-G-T ***
16039480-T-C 13927600-T-C ***
7311438-C-T 7443397-C-T ***
7775638-A-G 7907597-A-G ***
7895233-A-C 8027192-A-C ***
15984529-C-A 13872649-C-A ***
8236374-G-A 8368333-G-A ***
9231405-T-G 9393796-T-G ***
9303220-A-G 9465611-A-G ***
9472937-T-A 9635328-T-A ***
9994867-A-T 10157258-A-T ***
15637426-T-C 13525546-T-C ***
15904231-T-C 13792351-T-C ***
24081079-G-T 21934932-G-T P3_b1 ***
22151200-C-A 19989314-C-A ***
21368893-G-C 19207007-G-C ***
21633691-C-A 19471805-C-A ***
14143469-C-A 12022763-C-A ***
21914267-C-G 19752381-C-G ***
22017529-C-A 19855643-C-A ***
22017578-G-T 19855692-G-T ***
14462889-C-A 12342162-C-A ***
14460089-G-T 12339362-G-T ***
22100835-T-C 19938949-T-C ***
22542973-T-C 20381087-T-C ***
20804926-T-C 18643040-T-C P4_Gap ***
22599098-A-T 20437212-A-T ***
22623451-T-A 20461565-T-A ***
22767184-G-A 20605298-G-A ***
22841766-C-T 20679880-C-T ***
22972484-T-C 20810598-T-C ***
22991896-A-T 20830010-A-T ***
23261564-A-G 21099678-A-G ***
23288807-T-C 21126921-T-C ***
23439689-T-C 21277803-T-C ***
23521335-T-C 21359449-T-C ***
21141101-C-A 18979215-C-A ***
20002099-A-G 17890219-A-G P5_Prx ***
16022420-A-C 13910540-A-C ***
17027159-T-C 14915279-T-C ***
16025338-C-T 13913458-C-T ***
16313381-A-G 14201501-A-G ***
16364067-T-G 14252187-T-G ***
16502641-A-G 14390761-A-G ***
16677611-G-C 14565731-G-C ***
14866123-T-C 12754189-T-C ***
14849040-C-A 12737106-C-A ***
16998249-T-C 14886369-T-C ***
14784364-A-C 12672434-A-C ***
17128537-T-C 15016657-T-C ***
20002097-A-G 17890217-A-G P5_Prx ***
14735426-C-A 12623494-C-A ***
17163741-C-A 15051861-C-A ***
14694270-C-A 12582336-C-A ***
17338457-T-A 15226577-T-A ***
17428709-G-C 15316829-G-C ***
17932784-A-T 15820904-A-T ***
17983599-T-C 15871719-T-C ***
18228013-T-G 16116133-T-G ***
18542187-C-T 16430307-C-T ***
19437982-A-G 17326102-A-G ***
21714011-C-T 19552125-C-T ***

In the table above, the meaning of the confidence field depends on whether the data comes from an FTDNA kit or an FGC kit. For FTDNA kits, + implies a "PASS" result with just one possible variant, * indicates a "PASS" but with multiple variants, ** indicates "REJECTED" with just a single variant, and *** indicates "REJECTED" with multiple possible variants. 'A*' are heterozygous variants not called by FTDNA, but still pulled from the VCF file. For FGC kits, + indicates over 99% likely genuine (95% for INDELs); * over 95% likely genuine (90% for INDELs); ** about 40% likely genuine; *** about 10% likely genuine. Manual entries read directly from a BAM file will be either + indicating positive, or * indicating that the data show a mixture of possible variants.

For the FTDNA kits, the BED data is encoded in the background color of the cells. Those cells with a white background have coverage, those with a grey background indicate no coverage in the BED file, and those with a pink background indicate the mutation is on the edge of a coverage region. These pink regions often indicate that the individual may be positive for a SNP even if there is no corresponding entry in the vcf file.

The combBED column indicates whether or not the mutation is a SNP and falls in the combBED region defined in Defining a New Rate Constant for Y-Chromosome SNPs based on Full Sequencing Data by Dmitry Adamov, Vladimir Guryanov, Sergey Karzhavin, Vladimir Tagankin, Vadim Urasin.

The McDonald BED column indicates whether or not the mutation is a SNP and falls in the BED region used by Dr. Iain McDonald in the age analysis he does for R-U106 men.

ERROR: There was an error querying the server about the notes for this person.



Big Tree Main Page