Tree Position

R-U106/S21 > Z2265 > Z381/S263 > S264/Z156 > S5520 > BY12135 > FGC11660 > FGC11674 > Z17301 > FGC11685

Unique Mutations

The mutations unique to this man are summarized in the table below. Those with a '+' or '*' confidence level are considered by FamilyTreeDNA or FullGenomesCorp to be high quality SNPs/INDELs. For completeness, all other mutations of lesser confidence are included as well. These additional mutations may be useful for distinguishing between very closely related men.

Occasionally, some of the mutations listed here will be thought to be shared with other men in which case they might appear in upstream blocks on the tree. When this happens, the 'Blocks' field will indicate what block they appear in. Such a situation might arise with BigY men if the BED data suggests another man may be positive for a SNP, even though it doesn't appear in his VCF data. It might also happen if Chromo2 testing or Sanger sequencing of other men not on the tree show the SNP to be shared.

POS-REF-ALT (hg19) POS-REF-ALT (hg38) Blocks Names Region McDonald BED combBED STRKane-FGC
35043
FGC
1ZRQD
10781412-T-TCTACTCTAATCCATTCCTCTCCACTAAATTCC +
56680183-AAATGG-A 5×AATGG+
22342061-G-A 20180175-G-A DYZ19 +
10912219-A-G +
22311341-G-A 20149455-G-A DYZ19 +
22311339-G-A 20149453-G-A DYZ19 +
22311323-G-C 20149437-G-C DYZ19 +
22332782-G-T 20170896-G-T DYZ19 +***
10776102-T-G +
22342083-G-C 20180197-G-C DYZ19 +
13469285-G-C 11313609-G-C +
58834702-C-T 56756169-G-A +
22266383-G-T 20104497-G-T FGC82952 DYZ19 +
56680274-G-A +
13463095-C-CAGG 11307419-C-CAGG +
2985-G-C FGC77505 +
22342063-G-A 20180177-G-A DYZ19 +
22342102-T-G 20180216-T-G DYZ19 +
15672120-A-G 13560240-A-G FGC11676 Y+*
26056221-A-T 23910074-A-T P1_Y1 +***
26056220-C-T 23910073-C-T P1_Y1 +
10918082-G-T +
3205616-G-A 3337575-G-A +
15876403-C-T 13764523-C-T FGC11677 YY+*
10975683-G-T +
22887687-C-CTT 20725801-C-CTT 15×T+
25877787-A-G 23731640-A-G P1_Y1 +**
22361036-TG-T 20199150-TG-T DYZ19 +
10910492-C-T FT369710 +
10910496-G-A +
14172759-A-AATTAAAATAAT 12052053-A-AATTAAAATAAT +
14172757-A-ACAAATCATGC 12052051-A-ACAAATCATGC +
10963256-T-C +
22503926-G-T 20342040-G-T DYZ19 +***
16397095-C-T 14285215-C-T FGC11679 Y+*
15214217-T-C 13102303-T-C Y+***
13877899-A-G 11757193-A-G Y+
10862586-T-G +
10913619-A-T +
10912216-T-C +
24386994-A-ATATATATATATCTCCTATATATATCC 22240847-A-ATATATATATATCTCCTATATATATCC +
10912196-T-C +
10912172-G-T +
10909614-T-A +
22332800-T-C 20170914-T-C DYZ19 +**
10918072-G-A +
10776093-T-TCAAC +
10776096-A-C +
22342077-T-A 20180191-T-A DYZ19 +
22342076-C-T 20180190-C-T DYZ19 +
10811377-TTCCAA-T +
22342067-A-G 20180181-A-G DYZ19 +
10918027-C-T +
22332781-G-T 20170895-G-T DYZ19 +***
14733804-T-C 12621872-T-C YY+***
14751-TGGGG-T +
14633319-C-A 12521388-C-A FGC11671 Y++
9122321-C-T +
14260983-A-T 12140277-A-T Y+**
14260974-A-T 12140268-A-T Y+**
56683936-C-G +
14755-G-GTCAT +
10913886-T-G +
4098452-C-T 4230411-C-T +***
26056218-G-T 23910071-G-T P1_Y1 +
10783266-C-T +
10783268-C-T +
10036815-G-T 10199206-G-T +**
13370-GGTTCATGGTCTTGCTCACTTCAAGAATGAAGCTGCAGACCTTTACGGTGAGTGTTACAACACTTAAAGGTGTTATGTCCAGAGTTTGTTCCTCTGGATGTGTCCAGAGTTTCGTCCTTCTGGCAA-G +
4289724-C-T 4421683-C-T +***
10913614-T-A +
10862307-T-C +
22342070-G-A 20180184-G-A DYZ19 +
4844522-C-T 4976481-C-T +
56722380-G-A +
30512-T-A +
56695612-T-A +
22358345-T-G 20196459-T-G DYZ19 +
58868474-G-C 56722397-C-G +
22358344-G-T 20196458-G-T DYZ19 +
22358339-T-C 20196453-T-C DYZ19 +
13419455-C-T 11263779-C-T *
13426755-T-C 11271079-T-C *
13434993-A-G 11279317-A-G *
13441179-C-T 11285503-C-T *
13442794-G-A 11287118-G-A *
13935424-A-G 11814718-A-G Y*
14277924-G-A 12157218-G-A YY*
13444501-C-T 11288825-C-T *
13417361-C-T 11261685-C-T *
11293638-G- *
13450251-G-A 11294575-G-A *
13450503-ACACTC-A 11294827-ACACTC-A *
13450801-C-CATCTCCACTCT 11295125-C-CATCTCCACTCT *
13451838-G-GCTGTAGTGCAGTGGCACAATCTAAGTATCCATTTCATTCCA 11296162-G-GCTGTAGTGCAGTGGCACAATCTAAGTATCCATTTCATTCCA *
13461127-ACTATAGGTAGAGCCTAGAAAAGATTTACATGACCTAGGTGATCAGTGCAGAGATACATCGCAATGCCC-A 11305451-ACTATAGGTAGAGCCTAGAAAAGATTTACATGACCTAGGTGATCAGTGCAGAGATACATCGCAATGCCC-A *
14281175-GTT-G 12160469-GTT-G *
13398717-A-C 11243041-A-C *
13410932-C-A 11255256-C-A *
13345919-A-T 11190243-A-T *
13342994-A-G 11187318-A-G *
14342534-T-A 12221829-T-A YY*
14314482-A-G 12193776-A-G YY*
13345914-TAA-T 11190238-TAA-T *
13345918-A-AACACAC 11190242-A-AACACAC *
14301201-T-C 12180495-T-C YY*
13355805-T-C 11200129-T-C *
13410931-T-A 11255255-T-A *
13367869-A-T 11212193-A-T *
13389604-G-A 11233928-G-A *
13395342-G-T 11239666-G-T *
14295867-G-A 12175161-G-A FT34358 YY*
13461528-CAAAGCCCCCATACACAGAGCCTAGAGAAGAGTCCCATCACTTGGGTGATCAGTGCAGAAATATGTCAAAATGCCCCCATAGGCAGATCCTACACAAGAGTTACATCACCTGGGTGATCTGCGTAGAGATATGTCACAATGCCCCCATAGGCAGAGCGTAGACAAAAGTCCCATCACCTGGCTGATCAGTGCAGAGTTATGTCACA-C 11305852-CAAAGCCCCCATACACAGAGCCTAGAGAAGAGTCCCATCACTTGGGTGATCAGTGCAGAAATATGTCAAAATGCCCCCATAGGCAGATCCTACACAAGAGTTACATCACCTGGGTGATCTGCGTAGAGATATGTCACAATGCCCCCATAGGCAGAGCGTAGACAAAAGTCCCATCACCTGGCTGATCAGTGCAGAGTTATGTCACA-C *
13399036-G-A 11243360-G-A *
14283082-C-T 12162376-C-T YY*
13461209-CTTGACAAGTGGTATATCACCTGGGTGATCATTGCAGGGATATGTCACAAAGCACCCAG-C 11305533-CTTGACAAGTGGTATATCACCTGGGTGATCATTGCAGGGATATGTCACAAAGCACCCAG-C *
13462711-C-T 11307035-C-T *
13462058-G-T 11306382-G-T *
13469404-CT-C 11313728-CT-C *
13468864-G-T 11313188-G-T *
13468960-T-C 11313284-T-C *
13468962-G-C 11313286-G-C *
13469162-A-C 11313486-A-C *
13469197-CTCCATAGGCAAATCCAAGTTGAGATTCTGTCACCTGTGTGATCAGTGCAGACATATGTG-C 11313521-CTCCATAGGCAAATCCAAGTTGAGATTCTGTCACCTGTGTGATCAGTGCAGACATATGTG-C *
13469260-ATGCCCCCAG-A 11313584-ATGCCCCCAG-A *
14257047-G-A 12136341-G-A Y*
13467996-A-T 11312320-A-T *
13469675-C-T 11313999-C-T *
13469807-A-T 11314131-A-T *
13469885-C-CT 11314209-C-CT *
13469948-C-T 11314272-C-T *
13470033-T-TGG 11314357-T-TGG *
13470074-C-A 11314398-C-A *
13470077-TGC-T 11314401-TGC-T *
13468382-C-T 11312706-C-T *
13467975-C-T 11312299-C-T *
13462671-G-C 11306995-G-C *
13464513-C-G 11308837-C-G *
13333944-A-T 11178268-A-T *
13462715-ACC-A 11307039-ACC-A *
14276712-G-T 12156006-G-T YY*
13462719-A-ATG 11307043-A-ATG *
13463041-C-T 11307365-C-T BY85644 *
14271154-G-T 12150448-G-T FTA7751 Y*
14270319-G-A 12149613-G-A Y*
14270318-T-A 12149612-T-A Y*
11312225-CAGAATTCCCTGTAGGCAGTGCTTATAAAAGTGTTACATCACCTAGGTGATCAGTGCAG- *
13464954-T-C 11309278-T-C *
14259448-A-T 12138742-A-T Y*
13464968-C-T 11309292-C-T *
13464969-T-A 11309293-T-A *
13465945-A-T 11310269-A-T *
13465946-A-G 11310270-A-G *
13467891-AGAGATTTGT-A 11312215-AGAGATTTGT-A *
13337046-G-T 11181370-G-T *
13330518-G-T 11174842-G-T *
13332872-C-T 11177196-C-T *
14406636-CAG-C 12285934-CAG-C *
14451814-A-G 12331087-A-G Y*
10920908-C-T FT354122 *
10920935-T-TGTGCCTAAATTAACTTTTTGACATAACCCTGTA *
10925240-G-A *
14426258-A-G 12305533-A-G YY*
14406640-CTGGGT-C 12285938-CTGGGT-C *
10940415-C-A *
10920629-T-A *
10940416-C-A *
10950450-T-C *
10964449-A-G *
10972985-T-A *
10975701-C-T *
10975702-A-G *
10975708-C-T *
10920642-G-C *
14473232-A-G 12352501-A-G Y*
14406633-AGG-A 12285931-AGG-A *
10889312-C-CGTGTT *
14629772-A-T 12517841-A-T YY*
14617779-A-T 12505977-A-T Y*
14605694-A-G 12493896-A-G Y*
14601574-G-A 12489776-G-A YY*
10819425-G-T *
10824812-C-G *
10895995-T-C *
14486046-A-G 12365315-A-G FT329271 YY*
10898598-C-G *
14558595-C-T 12446796-C-T YY*
14549330-G-A 12437531-G-A YY*
14535114-C-T 12423315-C-T YY*
14515081-A-G 12403286-A-G YY*
10913594-C-T *
14486579-C-T 12365848-C-T YY*
10975711-C-T *
10975712-A-G *
13332047-T-A 11176371-T-A *
14395039-C-G 12274335-C-G YY*
13253899-TG-T 11098223-TG-T *
13259251-A-C 11103575-A-C *
13272774-C-CTTT 11117098-C-CTTT 13×T*
13278459-C-T 11122783-C-T *
13287766-G-T 11132090-G-T *
13292858-C-A 11137182-C-A *
14385963-C-T 12265259-C-T Y*
14395040-C-T 12274336-C-T YY*
13307668-C-T 11151992-C-T *
13315943-A-T 11160267-A-T *
13323214-G-A 11167538-G-A *
13328416-G-A 11172740-G-A *
13470252-A-T 11314576-A-T *
13332038-T-A 11176362-T-A *
14383806-C-T 12263102-C-T Y*
13253543-C-T 11097867-C-T *
13243537-C-G 11087861-C-G *
10979315-C-T FT438971 *
14402618-A-G 12281915-A-G YY*
10986865-T-TCCATTCCACTCCATG *
10999053-A-G *
11007798-C-G *
11015179-C-G *
11018296-T-C *
11030324-G-C *
11034120-CTCCAT-C *
14395041-C-T 12274337-C-T YY*
13233778-T-A 11078102-T-A *
11037626-C-T *
13205964-A-G 11050288-A-G *
13208524-T-C 11052848-T-C *
13215211-T-C 11059535-T-C *
13221319-C-T 11065643-C-T BY84606 *
13228334-T-A 11072658-T-A *
13233769-T-A 11078093-T-A *
13470200-G-T 11314524-G-T *
13470538-G-C 11314862-G-C *
13933926-C-T 11813220-C-T Y*
13601156-G-T 11445480-G-T *
13543458-A-G 11387782-A-G *
13543947-G-A 11388271-G-A *
13543949-A-G 11388273-A-G *
13561408-C-A 11405732-C-A *
13568234-T-A 11412558-T-A *
13581667-A-T 11425991-A-T *
13597005-C-T 11441329-C-T FT446229 *
13609573-A-G 11453897-A-G *
13531284-T-A 11375608-T-A *
13626128-TCA-T 11470452-TCA-T *
13635167-A-T 11479491-A-T *
14015804-A-G 11895098-A-G Y*
13650983-C-T 11495307-C-T BY87069 *
13654384-G-A 11498708-G-A *
14015799-A-T 11895093-A-T Y*
13676541-C-T 11520865-C-T *
13531498-G-A 11375822-G-A 10×A*
14024615-C-T 11903909-C-T YY*
13684312-A-C 11528636-A-C *
13489878-T-G 11334202-T-G *
13489149-T-A 11333473-T-A *
13489427-G-C 11333751-G-C *
13489428-T-A 11333752-T-A *
13489473-C-CA 11333797-C-CA *
13489475-TG-T 11333799-TG-T *
13489549-C-T 11333873-C-T *
13489854-C-T 11334178-C-T *
13494551-T-TATATA 11338875-T-TATATA *
13528956-T-C 11373280-T-C *
13499950-TAA-T 11344274-TAA-T *
13505037-C-T 11349361-C-T *
13506070-T-A 11350394-T-A *
13515367-C-G 11359691-C-G *
13519106-G-GA 11363430-G-GA *
13519114-A-T 11363438-A-T *
13520354-C-A 11364678-C-A *
13677885-A-G 11522209-A-G *
13684313-C-G 11528637-C-G *
13488811-G-T 11333135-G-T *
14015786-G-T 11895080-G-T Y*
13825680-A-G 11704974-A-G *
13825681-T-A 11704975-T-A *
13851961-C-T 11731255-C-T BY189050 *
13861539-C-T 11740833-C-T *
13867267-G-T 11746561-G-T *
14015787-A-G 11895081-A-G Y*
13872440-T-A 11751734-T-A Y*
13979879-T-A 11859173-T-A Y*
13825661-T-A 11704955-T-A *
13872442-A-T 11751736-A-T Y*
13973188-G-T 11852482-G-T YY*
13908275-T-A 11787569-T-A YY*
13911466-G-T 11790760-G-T Y*
13911715-G-T 11791009-G-T Y*
13930200-G-A 11809494-G-A Y*
13930211-G-A 11809505-G-A Y*
13825666-T-A 11704960-T-A *
13825657-G-A 11704951-G-A *
13684328-A-G 11528652-A-G *
11562628-T- *
13692469-G-T 11536793-G-T *
13702602-TGA-T 11546926-TGA-T *
13702606-T-A 11546930-T-A *
13702621-T-C 11546945-T-C *
13705170-T-C 11549494-T-C *
13710488-A-G 11554812-A-G *
13717317-G-A,A 11561641-G-A,A *
11650775-A-G *
13825647-A-T 11704941-A-T *
11664251-T-A *
11677361-G-A *
13801323-GGTA-G 11680617-GGTA-G *
13825635-T-C 11704929-T-C *
13825637-G-A 11704931-G-A *
13825638-C-A 11704932-C-A *
13825642-T-G 11704936-T-G *
13489113-C-T 11333437-C-T *
13488626-T-A 11332950-T-A *
13470541-C-CGAT 11314865-C-CGAT *
13473083-G-T 11317407-G-T *
14193336-G-T 12072630-G-T YY*
14191452-T-A 12070746-T-A Y*
14157225-A-G 12036519-A-G Y*
14156928-G-A 12036222-G-A Y*
14141553-A-T 12020847-A-T YY*
14123958-G-A 12003252-G-A YY*
14123952-A-G 12003246-A-G YY*
14121352-A-T 12000646-A-T Y*
13473060-C-A 11317384-C-A *
13473842-T-A 11318166-T-A *
13474312-G-A 11318636-G-A *
13474332-T-G 11318656-T-G *
13474341-G-T 11318665-G-T *
13474369-T-G 11318693-T-G *
13475275-C-T 11319599-C-T *
10817821-A-G *
14236539-C-T 12115833-C-T YY*
13473044-T-TG 11317368-T-TG *
13476750-G-T 11321074-G-T *
13470802-A-T 11315126-A-T *
13470543-C-A 11314867-C-A *
14256504-A-T 12135798-A-T Y*
13470545-AGCC-A 11314869-AGCC-A *
13470564-C-CAGTA 11314888-C-CAGTA *
13470572-G-A 11314896-G-A *
13470578-C-A 11314902-C-A *
14250136-C-T 12129430-C-T YY*
13472031-C-CAGTGGAGA 11316355-C-CAGTGGAGA *
13473042-T-G 11317366-T-G *
13472431-C-T 11316755-C-T *
13472439-G-A 11316763-G-A *
13472476-C-G 11316800-C-G *
13472562-A-C 11316886-A-C *
13472567-C-T 11316891-C-T *
13472576-A-G 11316900-A-G *
14245791-C-T 12125085-C-T YY*
11320861-CCA- *
13477396-GCCATCGGCATTCCAGAGTCCAGGGTCCCGATTTGGTTTCACAATGAGAGGTCACGCCAGCTGAGGCAACATCGGCGGGAATCTTGGCCCTGGCCCGGA-G 11321720-GCCATCGGCATTCCAGAGTCCAGGGTCCCGATTTGGTTTCACAATGAGAGGTCACGCCAGCTGAGGCAACATCGGCGGGAATCTTGGCCCTGGCCCGGA-G *
13488339-A-T 11332663-A-T *
13486561-A-C 11330885-A-C *
13485110-C-A 11329434-C-A *
13485111-T-A 11329435-T-A *
13485370-G-C 11329694-G-C *
14090079-A-T 11969373-A-T YY*
14084542-G-A 11963836-G-A YY*
13485642-TGTTACATCACTTAGGTGATCAGTGCAGATATATGTCACAATACCCCCTGTAAGCAGAGCCTAGACAAGA-T 11329966-TGTTACATCACTTAGGTGATCAGTGCAGATATATGTCACAATACCCCCTGTAAGCAGAGCCTAGACAAGA-T *
13486549-A-T 11330873-A-T *
13487339-A-G 11331663-A-G *
13484193-C-A 11328517-C-A *
13487350-T-G 11331674-T-G *
13487375-G-C 11331699-G-C *
13487383-C-T 11331707-C-T *
14055723-A-T 11935017-A-T YY*
14042881-G-A 11922175-G-A YY*
14037274-T-A 11916568-T-A YY*
13487388-G-A 11331712-G-A *
13484350-G-C 11328674-G-C *
13484160-G-A 11328484-G-A *
13477503-C-T 11321827-C-T *
13481475-A-G 11325799-A-G *
13478511-G-A 11322835-G-A *
13479040-G-T 11323364-G-T *
13480682-T-A 11325006-T-A *
14119927-G-T 11999221-G-T Y*
13480718-C-A 11325042-C-A *
14114581-T-A 11993875-T-A Y*
13480742-T-A 11325066-T-A *
13481592-C-CT 11325916-C-CT *
13484158-T-G 11328482-T-G *
13483027-T-C 11327351-T-C *
13483033-C-T 11327357-C-T *
13483190-TATCACCTGGGTGATCAGTGCGGAGATACTTCACAATACC-T 11327514-TATCACCTGGGTGATCAGTGCGGAGATACTTCACAATACC-T *
13483416-C-A 11327740-C-A *
14113306-G-T 11992600-G-T Y*
14112012-G-T 11991306-G-T Y*
13483418-G-A 11327742-G-A *
13483442-GGC-G 11327766-GGC-G *
13476531-TCA-T 11320855-TCA-T *
10677719-ATT-A *
10811420-C-G *
6365722-T-A 6497681-T-A *
6054355-T-C 6186314-T-C *
6068115-C-T 6200074-C-T *
6082369-T-A 6214328-T-A *
6092242-G-A 6224201-G-A *
6098788-A-T 6230747-A-T *
6200356-A-T 6332315-A-T IR3_Dst *
6200357-G-T 6332316-G-T IR3_Dst *
6200375-T-A 6332334-T-A IR3_Dst *
6413476-C-CT 6545435-C-CT 9×T*
6033935-G-A 6165894-G-A *
6438482-C-A 6570441-C-A *
6449984-T-A 6581943-T-A *
6453772-C-T 6585731-C-T *
6460556-C-A 6592515-C-A *
6466567-G-T 6598526-G-T *
6472040-A-G 6603999-A-G *
6473038-T-A 6604997-T-A *
6483921-A-G 6615880-A-G *
6054343-G-C 6186302-G-C *
6017777-C-G 6149736-C-G *
6529834-C-A 6661793-C-A *
5933233-C-CA,CAA 6065192-C-CA,CAA 18×A*
5804852-G-T 5936811-G-T *
5806272-C-T 5938231-C-T *
5816155-A-T 5948114-A-T *
5842572-T-A 5974531-T-A *
5853152-G-T 5985111-G-T *
5870960-A-G 6002919-A-G *
5899534-A-G 6031493-A-G *
5923165-TC-T 6055124-TC-T *
5937960-T-A 6069919-T-A *
6005649-A-G 6137608-A-G *
5946182-G-T 6078141-G-T *
5959415-T-A 6091374-T-A *
5966974-G-T 6098933-G-T *
5983792-T-A 6115751-T-A *
5985917-A-T 6117876-A-T *
5986487-C-T 6118446-C-T *
5986494-T-C 6118453-T-C *
5987583-C-T 6119542-C-T *
6003983-C-T 6135942-C-T *
6529398-A-G 6661357-A-G *
6543242-T-C 6675201-T-C *
5793040-T-A 5924999-T-A *
6969012-GA-G 7100971-GA-G 10×A*
6814555-A-G 6946514-A-G YY*
6819654-T-C 6951613-T-C Y*
6853750-T-A 6985709-T-A YY*
6880404-A-T 7012363-A-T YY*
6896575-G-A 7028534-G-A YY*
6910660-C-T 7042619-C-T YY*
6926606-G-A 7058565-G-A Y*
6966911-T-A 7098870-T-A YY*
6974627-G-C 7106586-G-C YY*
6812125-A-T 6944084-A-T YY*
6977358-T-A 7109317-T-A Y*
7001925-G-A 7133884-G-A Y*
7019141-A-G 7151100-A-G Y*
7021804-G-A 7153763-G-A Y*
7032092-T-A 7164051-T-A Y*
7046067-TAACA-T 7178026-TAACA-T *
7046073-G-T 7178032-G-T YY*
7060900-T-C 7192859-T-C Y*
7061067-G-A 7193026-G-A Y*
6812131-G-C 6944090-G-C YY*
6796279-T-TCTTACTAAAAAAACTTATTCTCTCTATTATACCACAATCTA 6928238-T-TCTTACTAAAAAAACTTATTCTCTCTATTATACCACAATCTA *
6576223-C-T 6708182-C-T *
6720817-C-A 6852776-C-A Y*
6576279-G-T 6708238-G-T *
6581686-G-T 6713645-G-T *
6581713-T-C 6713672-T-C *
6582674-G-A 6714633-G-A *
6613346-C-T 6745305-C-T *
6613556-T-A 6745515-T-A *
6634745-G-T 6766704-G-T YY*
6640226-G-A 6772185-G-A Y*
6720956-G-A 6852915-G-A Y*
6779021-G-T 6910980-G-T YY*
6720960-A-G 6852919-A-G Y*
6724547-A-T 6856506-A-T Y*
6732095-C-T 6864054-C-T YY*
6738960-G-T 6870919-G-T YY*
6744519-A-T 6876478-A-T YY*
6744545-C-T 6876504-C-T YY*
6746069-T-C 6878028-T-C YY*
6758354-G-T 6890313-G-T YY*
6772942-A-T 6904901-A-T Y*
5796567-T-A 5928526-T-A *
5765840-A-G 5897799-A-G *
7062037-T-A 7193996-T-A Y*
5140843-T- *
4917942-A-T 5049901-A-T *
4917944-G-T 5049903-G-T *
4927967-T-G 5059926-T-G *
4962891-G-A 5094850-G-A *
4990461-A-T 5122420-A-T *
4991609-T-G 5123568-T-G *
5003173-A-T 5135132-A-T *
5004503-A-G 5136462-A-G *
5014305-T-C 5146264-T-C *
4914275-T-A 5046234-T-A *
5057176-GTT-G 5189135-GTT-G *
5098800-T-C 5230759-T-C *
5106134-A-G 5238093-A-G *
5136903-AT-A 5268862-AT-A *
5152505-C-T 5284464-C-T *
5183105-A-T 5315064-A-T *
5196135-G-A 5328094-G-A *
5221964-G-A 5353923-G-A FT156120 *
4914423-C-T 5046382-C-T *
4904514-A-G 5036473-A-G *
5259510-C-T 5391469-C-T *
4728714-C-G 4860673-C-G *
4648512-G-C 4780471-G-C *
4650072-C-T 4782031-C-T *
4653637-G-A 4785596-G-A *
4689180-C-T 4821139-C-T *
4694474-T-C 4826433-T-C *
4703731-A-T 4835690-A-T *
4703745-TAC-T 4835704-TAC-T *
4703750-TAA-T 4835709-TAA-T *
4732355-T-C 4864314-T-C *
4844506-C-T 4976465-C-T *
4751720-A-T 4883679-A-T *
4759807-T-C 4891766-T-C *
4783417-C-A 4915376-C-A *
4783453-A-G 4915412-A-G *
4794514-C-T 4926473-C-T *
4804511-G-A 4936470-G-A FTB50255 *
4809392-A-G 4941351-A-G *
4825340-C-T 4957299-C-T FT78236 *
4836202-A-T 4968161-A-T *
5239223-T-C 5371182-T-C *
5288333-C-A 5420292-C-A *
5764905-C-T 5896864-C-T *
5611355-A-G 5743314-A-G *
5536112-T-A 5668071-T-A *
5536114-C-A 5668073-C-A *
5548094-C-A 5680053-C-A *
5550203-T-C 5682162-T-C *
5586492-A-T 5718451-A-T *
5593175-G-T 5725134-G-T *
5593190-G-A 5725149-G-A *
5607361-C-A 5739320-C-A *
5627027-G-T 5758986-G-T *
5536107-A-T 5668066-A-T FT17678 *
5633417-G-A 5765376-G-A *
5647738-A-G 5779697-A-G *
5651145-A-G 5783104-A-G *
5651155-C-T 5783114-C-T *
5668807-A-G 5800766-A-G *
5692883-T-A 5824842-T-A *
5710386-T-A 5842345-T-A *
5712773-C-T 5844732-C-T *
5738464-C-T 5870423-C-T *
5536108-A-T 5668067-A-T *
5520077-C-A 5652036-C-A *
5293610-A-T 5425569-A-T *
5343440-A-G 5475399-A-G *
5297763-G-A 5429722-G-A *
5299612-T-A 5431571-T-A *
5309558-G-C 5441517-G-C *
5311449-G-C 5443408-G-C *
5311933-G-A 5443892-G-A *
5322275-T-C 5454234-T-C *
5330692-T-A 5462651-T-A *
5334729-A-T 5466688-A-T *
5349195-T-C 5481154-T-C *
5519746-G-T 5651705-G-T *
5349218-TAGGCACAGGAGGGA-T 5481177-TAGGCACAGGAGGGA-T *
5349234-TTTCCCA-T 5481193-TTTCCCA-T *
5351122-T-C 5483081-T-C *
5395018-A-G 5526977-A-G *
5418737-T-A 5550696-T-A *
5428103-G-A 5560062-G-A *
5452358-T-C 5584317-T-C *
5485672-T-C 5617631-T-C *
5502276-G-A 5634235-G-A *
7061485-C-A 7193444-C-A Y*
7062073-G-A 7194032-G-A Y*
10811416-A-G *
9802255-G-A 9964646-G-A Y*
9432580-T-C 9594971-T-C Y*
9444709-G-A 9607100-G-A YY*
9444714-G-A 9607105-G-A YY*
9444721-G-A 9607112-G-A YY*
9462237-G-A 9624628-G-A FT294445 Y*
9511280-G-T 9673671-G-T *
9766313-A-G 9928704-A-G Y*
9801350-T-A 9963741-T-A Y*
9804972-T-A 9967363-T-A YY*
9430676-GCCCT-G 9593067-GCCCT-G *
9826988-T-C 9989379-T-C YY*
9873821-G-A 10036212-G-A Y*
9885677-T-C 10048068-T-C YY*
9890822-GA-G 10053213-GA-G *
9900059-G-C 10062450-G-C Y*
9930165-A-T 10092556-A-T Y*
9936839-T-A 10099230-T-A Y*
9936840-A-G 10099231-A-G Y*
9430680-T-TAAAAA 9593071-T-TAAAAA *
9413011-G-A 9575402-G-A Y*
9939107-A-T 10101498-A-T Y*
9127169-A-G *
8854922-A-T 8986881-A-T YY*
8914379-A-T 9046338-A-T *
9108641-G-GA *
9108655-T-A *
9116550-A-G *
9117759-T-A *
9117769-A-G *
9125143-T-A BY164393 *
8968647-C-T 9131038-C-T *
9411729-T-C 9574120-T-C Y*
8970842-GA-G,GAA 9133233-GA-G,GAA 16×A*
8983866-G-A 9146257-G-A *
9030276-C-T 9192667-C-T Y*
9071750-C-A 9234141-C-A Y*
9072006-A-T 9234397-A-T Y*
9077831-A-T 9240222-A-T *
9340831-AACACAC-A,AACACACAC 9503222-AACACAC-A,AACACACAC 22×AC*
9409352-G-T 9571743-G-T Y*
9410133-T-A 9572524-T-A Y*
9939007-C-T 10101398-C-T FTB54309 Y*
9941239-G-A 10103630-G-A Y*
8813071-T-C 8945030-T-C Y*
14664829-C-T 12552895-C-T YY*
10061767-A-T 10224158-A-T *
10061768-A-C 10224159-A-C *
10065527-T-TA 10227918-T-TA 9×A*
10076588-TTG-T 10238979-TTG-T *
10083413-G-T 10245804-G-T *
10653552-C-T *
10654428-AT-A *
10677706-A-ACG *
10677722-CCATTACACTCCAT-C *
10046280-C-G 10208671-C-G *
10757416-A-C *
10757419-C-T *
10757422-T-C *
10765758-C-T,T *
10771966-C-T *
15072319-G-GA 12960410-G-GA 9×A*
10806516-C-T *
10811386-ATTACATTCAATTACT-A *
10811408-T-C *
10046322-C-G 10208713-C-G *
10038826-T-A 10201217-T-A *
9949505-A-G 10111896-A-G Y*
9999622-G-A 10162013-G-A Y*
9955334-T-C 10117725-T-C Y*
9955336-G-T 10117727-G-T Y*
9966903-T-A 10129294-T-A Y*
9970555-A-G 10132946-A-G Y*
9970562-A-T 10132953-A-T Y*
9988162-C-T 10150553-C-T Y*
9993830-A-G 10156221-A-G Y*
9997454-T-A 10159845-T-A BY82675 Y*
9999765-C-T 10162156-C-T Y*
10031964-G-A 10194355-G-A Y*
9999766-A-T 10162157-A-T Y*
10003719-T-C 10166110-T-C Y*
10013821-T-A 10176212-T-A Y*
10016422-TC-T 10178813-TC-T *
10018667-CT-C 10181058-CT-C *
10018673-T-A 10181064-T-A Y*
10018677-G-GA 10181068-G-GA *
10018683-G-A 10181074-G-A Y*
10026535-T-C 10188926-T-C Y*
8813282-GTT-G 8945241-GTT-G *
8807131-C-T 8939090-C-T Y*
7068092-T-C 7200051-T-C YY*
7576939-G-A 7708898-G-A Y*
7393646-A-G 7525605-A-G Y*
7415252-C-T 7547211-C-T YY*
7421478-A-G 7553437-A-G YY*
7423698-C-A 7555657-C-A Y*
7430618-A-G 7562577-A-G YY*
7432293-TG-T 7564252-TG-T *
7469561-T-C 7601520-T-C IR1_L *
7544994-G-A 7676953-G-A YY*
7577062-T-A 7709021-T-A Y*
7373005-G-A 7504964-G-A Y*
7580745-T-C 7712704-T-C YY*
7586718-A-AT 7718677-A-AT *
7599874-C-T 7731833-C-T YY*
7606124-A-T 7738083-A-T YY*
7615585-G-A 7747544-G-A YY*
7626656-T-A 7758615-T-A YY*
7629949-G-T 7761908-G-T YY*
7636520-C-T 7768479-C-T YY*
7388920-G-T 7520879-G-T YY*
7372324-A-T 7504283-A-T Y*
7662635-C-T 7794594-C-T YY*
7233009-A-T 7364968-A-T YY*
7069264-C-T 7201223-C-T BY63160 YY*
7074318-C-T 7206277-C-T YY*
7101086-A-G 7233045-A-G Y*
7122714-T-A 7254673-T-A Y*
7124276-A-T 7256235-A-T Y*
7141145-G-A 7273104-G-A Y*
7166202-C-T 7298161-C-T Y*
7173480-T-A 7305439-T-A YY*
7239997-G-A 7371956-G-A Y*
7371268-G-T 7503227-G-T Y*
7245183-A-G 7377142-A-G YY*
7254185-G-C 7386144-G-C Y*
7254187-G-A 7386146-G-A Y*
7284556-A-G 7416515-A-G YY*
7320286-A-G 7452245-A-G YY*
7325791-G-A 7457750-G-A YY*
7338699-T-C 7470658-T-C Y*
7369254-T-C 7501213-T-C Y*
7369648-C-T 7501607-C-T Y*
7662273-A-T 7794232-A-T YY*
7696337-T-TCCCATACGCACACCGATAGCTTTAGCAGTGTATGATTTGTGTGGGAAGA 7828296-T-TCCCATACGCACACCGATAGCTTTAGCAGTGTATGATTTGTGTGGGAAGA *
8805305-A-C 8937264-A-C YY*
8475756-T-A 8607715-T-A YY*
8237003-C-A 8368962-C-A Y*
8239722-G-A 8371681-G-A YY*
8256279-G-A 8388238-G-A YY*
8276445-G-T 8408404-G-T Y*
8284451-A-T 8416410-A-T YY*
8324569-A-G 8456528-A-G Y*
8344456-G-A 8476415-G-A Y*
8430711-T-C 8562670-T-C YY*
8564436-G-T 8696395-G-T YY*
8236975-C-A 8368934-C-A Y*
8583574-C-A 8715533-C-A YY*
8583970-T-C 8715929-T-C YY*
8600792-G-T 8732751-G-T YY*
8612403-C-A 8744362-C-A YY*
8673623-G-C 8805582-G-C Y*
8679206-A-G 8811165-A-G Y*
8703449-A-ATT 8835408-A-ATT 10×T*
8724780-AT-A 8856739-AT-A 9×T*
8735945-G-A 8867904-G-A Y*
8237000-CCT-C 8368959-CCT-C *
8236793-C-T 8368752-C-T Y*
7696341-T-TAATCCAAACTTTACCACCACGTTTC 7828300-T-TAATCCAAACTTTACCACCACGTTTC *
7895375-T-A 8027334-T-A Y*
7755986-A-T 7887945-A-T YY*
7758223-A-AT 7890182-A-AT *
7783738-C-A 7915697-C-A YY*
7809073-A-G 7941032-A-G YY*
7829694-T-A 7961653-T-A YY*
7848687-T-A 7980646-T-A YY*
7862714-G-T 7994673-G-T YY*
7880310-T-A 8012269-T-A YY*
7898669-C-A 8030628-C-A YY*
8220507-G-T 8352466-G-T YY*
7966769-A-T 8098728-A-T Y*
8046036-T-A 8177995-T-A YY*
8066203-A-G 8198162-A-G Y*
8091268-C-T 8223227-C-T Y*
8091269-A-T 8223228-A-T Y*
8135854-T-C 8267813-T-C Y*
8136615-G-A 8268574-G-A Y*
8170446-G-A 8302405-G-A YY*
8218379-G-T 8350338-G-T YY*
14663403-C-T 12551468-C-T YY*
19065040-A-G 16953160-A-G Y*
14664830-A-T 12552896-A-T YY*
21728902-G-T 19567016-G-T YY*
21632525-T-C 19470639-T-C Y*
21632532-G-C 19470646-G-C Y*
21643057-A-ACTT 19481171-A-ACTT *
21673965-T-A 19512079-T-A YY*
21674597-G-A 19512711-G-A YY*
21687577-G-A 19525691-G-A YY*
21709354-G-A 19547468-G-A YY*
21715333-G-A 19553447-G-A YY*
21729017-T-C 19567131-T-C YY*
21623428-G-T 19461542-G-T YY*
21729035-C-G 19567149-C-G YY*
21744187-T-C 19582301-T-C Y*
21753676-G-A 19591790-G-A YY*
21793777-T-A 19631891-T-A Y*
21826332-G-T 19664446-G-T YY*
21835250-C-T 19673364-C-T Y*
21896808-A-T 19734922-A-T YY*
21900617-A-G 19738731-A-G YY*
21631415-C-A 19469529-C-A Y*
21612926-T-A 19451040-T-A YY*
21941139-G-A 19779253-G-A Y*
21576173-A-G 19414287-A-G Y*
21526497-A-ACTAG 19364611-A-ACTAG *
21526503-T-C 19364617-T-C Y*
21526516-GGAA-G 19364630-GGAA-G *
21537771-G-C 19375885-G-C Y*
21538255-G-A 19376369-G-A Y*
21540233-G-T 19378347-G-T Y*
21563513-A-G 19401627-A-G YY*
21572707-C-A 19410821-C-A YY*
21577978-T-A 19416092-T-A Y*
21612416-A-T 19450530-A-T YY*
21578137-GT-G 19416251-GT-G *
21586051-C-G 19424165-C-G Y*
21595355-A-AGTAT 19433469-A-AGTAT *
21595358-A-AGCTCTACTCCAACGTGATTTACTACAGTTTCAACTACTTGATCCAAGGTATGAGT 19433472-A-AGCTCTACTCCAACGTGATTTACTACAGTTTCAACTACTTGATCCAAGGTATGAGT *
21600400-A-T 19438514-A-T Y*
21606080-C-A 19444194-C-A YY*
21609892-C-A 19448006-C-A YY*
21611061-G-A 19449175-G-A YY*
21934169-A-T 19772283-A-T YY*
21944984-A-G 19783098-A-G Y*
21486927-G-A 19325041-G-A YY*
22546338-T-A 20384452-T-A Y*
22319170-A-T,T 20157284-A-T,T DYZ19 *
22358802-G-C 20196916-G-C DYZ19 *
22364518-T-G 20202632-T-G DYZ19 *
22488222-CCTTCAGATGTTTCCAGAGTTTCTTCCTTCTAGCAGGTTCGTGGTCTTGCTCACTTCTTTAATGAAGCTGCAGACCTTACTTGTGAGTGTTACAGCACTTAAATGTGTTATGTCCAGAGTTTGTTT-C 20326336-CCTTCAGATGTTTCCAGAGTTTCTTCCTTCTAGCAGGTTCGTGGTCTTGCTCACTTCTTTAATGAAGCTGCAGACCTTACTTGTGAGTGTTACAGCACTTAAATGTGTTATGTCCAGAGTTTGTTT-C DYZ19 *
22541826-T-A 20379940-T-A Y*
22541834-A-G 20379948-A-G Y*
22545622-T-A 20383736-T-A Y*
22545864-C-A 20383978-C-A Y*
22564040-C-A 20402154-C-A YY*
22287092-AAG-A 20125206-AAG-A DYZ19 *
22566860-GA-G 20404974-GA-G 9×A*
22571037-G-A 20409151-G-A YY*
22604371-A-T 20442485-A-T YY*
22609732-G-T 20447846-G-T YY*
22610769-G-A 20448883-G-A YY*
22641358-A-G 20479472-A-G Y*
22644537-T-A 20482651-T-A Y*
22656003-A-G 20494117-A-G YY*
22311316-G-A 20149430-G-A DYZ19 *
22252017-T-G 20090131-T-G DYZ19 *
21945017-G-T 19783131-G-T Y*
22032068-T-C 19870182-T-C YY*
21960151-C-T 19798265-C-T YY*
21965962-T-A 19804076-T-A Y*
21968987-T-C 19807101-T-C Y*
21987005-A-G 19825119-A-G YY*
21990069-G-A 19828183-G-A FTB12949 YY*
21996327-A-T 19834441-A-T YY*
21999277-A-T 19837391-A-T Y*
22029948-A-T 19868062-A-T YY*
22057774-C-A 19895888-C-A Y*
22235567-A-T 20073681-A-T DYZ19 *
22075326-C-A 19913440-C-A YY*
22086497-A-G 19924611-A-G YY*
22099039-G-A 19937153-G-A FT43896 YY*
22099049-A-G 19937163-A-G YY*
22114756-A-T 19952870-A-T YY*
22114763-A-T 19952877-A-T YY*
22196471-T-C 20034585-T-C Y*
22197554-C-T 20035668-C-T Y*
22229290-A-T,T 20067404-A-T,T DYZ19 *
21501275-G-A 19339389-G-A Y*
21465922-G-T 19304036-G-T YY*
22676769-T-TAA 20514883-T-TAA 10×A*
19554255-T-C 17442375-T-C Y*
19376093-T-C 17264213-T-C YY*
19377047-G-A 17265167-G-A YY*
19427658-C-A 17315778-C-A Y*
19427996-G-GA 17316116-G-GA *
19480514-T-C 17368634-T-C YY*
19493637-C-A 17381757-C-A YY*
19497351-A-C 17385471-A-C YY*
19523926-G-T 17412046-G-T YY*
19554263-A-G 17442383-A-G Y*
19328326-C-T 17216446-C-T Y*
19554275-A-T 17442395-A-T Y*
19557665-C-T 17445785-C-T Y*
19558983-A-T 17447103-A-T Y*
19561145-A-T 17449265-A-T Y*
19563378-G-A 17451498-G-A FT331379 Y*
19758915-T-C 17647035-T-C P5_Prx *
21036055-A-G 18874169-A-G Y*
21041203-T-A 18879317-T-A Y*
19365645-C-T 17253765-C-T YY*
19327286-T-C 17215406-T-C Y*
21042533-A-G 18880647-A-G Y*
19099160-T-A 16987280-T-A Y*
19042435-G-A 16930555-G-A Y*
19051294-T-C 16939414-T-C YY*
19061898-C-A 16950018-C-A YY*
19062069-T-C 16950189-T-C YY*
3279734-T-TAAATAAAC 3411693-T-TAAATAAAC *
19066261-G-T 16954381-G-T YY*
19066262-G-C 16954382-G-C YY*
19071678-A-T 16959798-A-T Y*
19145508-T-C 17033628-T-C YY*
19321404-A-T 17209524-A-T YY*
19148547-T-C 17036667-T-C YY*
19207511-A-T 17095631-A-T YY*
19208448-G-T 17096568-G-T YY*
19241341-C-T 17129461-C-T YY*
19241342-A-G 17129462-A-G YY*
19249754-A-T 17137874-A-T Y*
19263188-C-T 17151308-C-T YY*
19266179-C-T 17154299-C-T YY*
19282280-T-C 17170400-T-C YY*
21041520-C-T 18879634-C-T Y*
21042555-A-G 18880669-A-G Y*
21458688-A-G 19296802-A-G Y*
21339700-C-T 19177814-C-T Y*
21289526-A-T 19127640-A-T YY*
21290997-G-C 19129111-G-C YY*
21295577-CA-C 19133691-CA-C *
21295929-A-T 19134043-A-T YY*
21324960-T-C 19163074-T-C Y*
21325409-T-C 19163523-T-C Y*
21331499-A-C 19169613-A-C YY*
21338306-C-T 19176420-C-T Y*
21343873-A-T 19181987-A-T YY*
21287771-TC-T 19125885-TC-T *
21349006-T-C 19187120-T-C Y*
21377923-T-C 19216037-T-C Y*
21411207-G-A 19249321-G-A YY*
21424938-C-T 19263052-C-T YY*
21430546-C-A 19268660-C-A YY*
21436096-TTC-T 19274210-TTC-T *
21448582-T-G 19286696-T-G Y*
21448641-C-A 19286755-C-A Y*
21287773-A-T 19125887-A-T YY*
21275414-CT-C 19113528-CT-C *
21046822-G-A 18884936-G-A Y*
21183278-T-C 19021392-T-C YY*
21059877-T-A 18897991-T-A Y*
21073532-T-TA 18911646-T-TA 8×A*
21078544-A-G 18916658-A-G Y*
21081373-T-C 18919487-T-C YY*
21081390-G-A 18919504-G-A YY*
21124091-A-G 18962205-A-G FTB41845 Y*
21152540-C-T 18990654-C-T Y*
21164379-A-T 19002493-A-T YY*
21184461-G-A 19022575-G-A YY*
21261685-A-T 19099799-A-T YY*
21191121-A-T 19029235-A-T YY*
21200795-A-G 19038909-A-G YY*
21201074-G-A 19039188-G-A YY*
21211285-A-AT 19049399-A-AT *
21230373-T-A 19068487-T-A YY*
21256043-A-G 19094157-A-G YY*
21256048-T-A 19094162-T-A YY*
21256056-G-A 19094170-G-A YY*
21256063-T-C 19094177-T-C BY180776 YY*
22668556-C-A 20506670-C-A Y*
22682413-C-CAA 20520527-C-CAA 11×A*
19007184-A-T 16895304-A-T YY*
28640990-G-T 26494843-G-T *
28572988-C-A 26426841-C-A *
28584812-C-T 26438665-C-T *
26441905-TC- *
28604630-A-T 26458483-A-T *
28611471-GTTC-G 26465324-GTTC-G *
28616751-G-T 26470604-G-T *
28623421-A-T 26477274-A-T Y*
28634312-G-T 26488165-G-T *
28657162-G-A 26511015-G-A *
28558005-T-A 26411858-T-A *
28661846-T-A 26515699-T-A Y*
28667354-T-A 26521207-T-A *
28667392-C-T 26521245-C-T *
28691892-C-CA 26545745-C-CA *
28694354-C-T 26548207-C-T *
28704341-T-C 26558194-T-C *
28709101-A-G 26562954-A-G *
28713136-A-G 26566989-A-G *
28560808-G-A 26414661-G-A *
28555850-G-A 26409703-G-A *
28725056-G-GT 26578909-G-GT 8×T*
26334907-C-A 24188760-C-A P1_Y1 *
24489076-G-T 22342929-G-T *
24489077-A-T 22342930-A-T *
24489862-A-T 22343715-A-T *
24503128-T-A 22356981-T-A *
24672465-A-T 22526318-A-T P3_b2 *
25021428-A-G 22875281-A-G g1 *
25044981-C-A 22898834-C-A g1 *
26318602-A-G 24172455-A-G P1_Y1 *
26344264-G-A 24198117-G-A P1_Y1 *
28506794-A-T 26360647-A-T Y*
27561776-C-T 25415629-C-T P1_Y2 *
27861588-C-T 25715441-C-T P1_Y2 *
27861597-A-T 25715450-A-T P1_Y2 *
27988014-G-T 25841867-G-T P1_Y2 *
28463726-C-T 26317579-C-T *
28471327-G-T 26325180-G-T *
28498447-A-G 26352300-A-G *
28506787-A-T 26360640-A-T Y*
28722710-A-G 26576563-A-G *
28733344-C-T 26587197-C-T Y*
24405951-C-T 22259804-C-T *
56850862-ACT-A *
56825934-T-TAATTCCATTCGATTGCATTCCATTCGATTG *
56833850-C- *
56833852-C- *
56834442-C-CCATTT *
56838594-CTTG-C *
56838598-T-TAA *
56845065-CTA- *
56845070-GTGGCATTGTGACATATCTCTGCACTGATCACCCATGTGATATAACTCTTGTCTGGGCTCTGCCTAC- *
56850974-T-C *
56752224-T-TTCGAATGGAATGCAA *
56850975-G-A *
56851016-C-T *
56851017-C-G *
56863451-G-A *
13388-CTTCAA- *
13394-GAATGAAGCTGCAGACCTTTACGGTGAGTGTTACAACACTTAAAGGTGTTATGTCCAGAGTTTGTTCCTCTGGATGTGTCCAGAGTTTCGTCCTTCTGGCAAGTTCATGGTCTTGCTCACT- *
36593-A-AGAAT *
36601-C-A,G *
56765982-G-A *
56747937-G-T *
28750237-CA-C 26604090-CA-C *
56674840-G-C *
28750713-T-C 26604566-T-C *
28751459-TCA-T 26605312-TCA-T *
28781046-C-T 26634899-C-T *
28787319-G-GAATTAACCCA 26641172-G-GAATTAACCCA *
26645134-CGGAGTGGAGT- 5×GGAGT*
28803110-A-G 26656963-A-G *
28814072-G-GC 26667925-G-GC *
28814073-G-GTGGA 26667926-G-GTGGA *
56674849-T-A *
56734427-A-G *
56680260-A-G *
56702588-A-C *
56705762-A-C *
56709915-A-T *
56709919-C-T *
56710208-C-T *
56710212-G-A *
56728050-A-G *
56732052-C-T *
24407514-A-T 22261367-A-T *
24402203-A-AT 22256056-A-AT *
22683049-C-T 20521163-C-T YY*
22960619-G-T 20798733-G-T YY*
22872575-C-A 20710689-C-A Y*
22877329-A-G 20715443-A-G Y*
22885459-T-A 20723573-T-A YY*
22898493-C-T 20736607-C-T YY*
22901840-G-A 20739954-G-A YY*
22902712-G-A 20740826-G-A YY*
22911390-T-C 20749504-T-C YY*
22923014-A-G 20761128-A-G YY*
22971840-A-C 20809954-A-C YY*
22863764-C-T 20701878-C-T YY*
22971961-A-G 20810075-A-G YY*
22971995-G-T 20810109-G-T YY*
22991295-T-C 20829409-T-C YY*
22995399-TCACCG-T 20833513-TCACCG-T *
23026731-G-C 20864845-G-C YY*
23026738-T-C 20864852-T-C YY*
23029637-A-T 20867751-A-T Y*
23029645-TCTA-T 20867759-TCTA-T *
22872540-G-A 20710654-G-A Y*
22859476-A-G 20697590-A-G YY*
23051818-C-T 20889932-C-T Y*
22735560-A-T 20573674-A-T YY*
22686550-C-T 20524664-C-T YY*
22692760-A-T 20530874-A-T Y*
22706870-C-A 20544984-C-A YY*
22710712-A-G 20548826-A-G YY*
22711611-C-T 20549725-C-T YY*
22724775-G-A 20562889-G-A YY*
22730135-A-T 20568249-A-T YY*
22734140-G-A 20572254-G-A YY*
22761855-T-C 20599969-T-C YY*
22848070-CA-C 20686184-CA-C *
22777381-T-A 20615495-T-A Y*
22790608-T-A 20628722-T-A Y*
22790609-G-A 20628723-G-A Y*
22803039-G-A 20641153-G-A YY*
22809728-G-A 20647842-G-A FT314686 Y*
22817967-A-G 20656081-A-G YY*
22824484-A-C 20662598-A-C YY*
22839703-G-C 20677817-G-C Y*
22840598-C-T 20678712-C-T Y*
23050760-A-T 20888874-A-T Y*
23056678-T-C 20894792-T-C YY*
24375617-G-A 22229470-G-A *
23790157-T-A 21628271-T-A *
23448751-C-T 21286865-C-T Y*
23459642-T-C 21297756-T-C YY*
23513070-T-C 21351184-T-C Y*
23517868-C-A 21355982-C-A Y*
23519308-A-C 21357422-A-C Y*
23520466-G-A 21358580-G-A Y*
23531658-C-A 21369772-C-A YY*
23602314-T-A 21440428-T-A Y*
23809163-T-A 21647277-T-A Y*
23422078-T-C 21260192-T-C YY*
23829612-T-TA 21667726-T-TA 8×A*
23848831-A-T 21686945-A-T Y*
23849683-G-A 21687797-G-A Y*
23849685-C-T 21687799-C-T Y*
23850153-A-T 21688267-A-T Y*
23856014-G-A 21694128-G-A Y*
21751542-A-T *
21753096-A-T *
23427608-G-T 21265722-G-T YY*
23406154-A-G 21244268-A-G YY*
23062070-C-T 20900184-C-T Y*
23161881-A-T 20999995-A-T Y*
23082186-A-C 20920300-A-C YY*
23095267-C-G 20933381-C-G Y*
23100152-G-C 20938266-G-C Y*
23107009-TC-T 20945123-TC-T *
23107013-TA-T 20945127-TA-T *
23146860-T-A 20984974-T-A YY*
23147108-G-T 20985222-G-T YY*
23159430-G-A 20997544-G-A Y*
23161910-G-T 21000024-G-T Y*
23367696-A-T 21205810-A-T YY*
23162055-G-T 21000169-G-T Y*
23190353-CT-C 21028467-CT-C *
23190683-C-A 21028797-C-A Y*
23204080-G-T 21042194-G-T Y*
23205315-A-G 21043429-A-G Y*
23244749-T-A 21082863-T-A YY*
23265842-T-A 21103956-T-A YY*
23271732-TAA-T 21109846-TAA-T 11×A*
23296899-T-C 21135013-T-C YY*
19016289-A-G 16904409-A-G Y*
18990238-TG-T 16878358-TG-T *
14668468-CTG-C 12556534-CTG-C *
16080946-G-T 13969066-G-T Y*
16000256-C-T 13888376-C-T Y*
16001933-G-A 13890053-G-A Y*
16024695-C-G 13912815-C-G Y*
16024714-T-C 13912834-T-C Y*
16042093-A-G 13930213-A-G YY*
16049613-A-G 13937733-A-G YY*
16056984-C-G 13945104-C-G Y*
16071730-AT-A,ATTTT 13959850-AT-A,ATTTT 17×T*
16082642-G-A 13970762-G-A Y*
16000195-T-C 13888315-T-C Y*
16132871-C-T 14020991-C-T *
16185522-G-T 14073642-G-T Y*
16195733-T-A 14083853-T-A YY*
16207700-G-C 14095820-G-C Y*
16208062-T-C 14096182-T-C Y*
16209624-A-G 14097744-A-G Y*
16216205-A-G 14104325-A-G Y*
16266507-A-G 14154627-A-G Y*
16000203-G-T 13888323-G-T Y*
15999377-C-T 13887497-C-T YY*
16288555-A-T 14176675-A-T YY*
15819006-G-A 13707126-G-A YY*
15745030-C-A 13633150-C-A YY*
15788287-T-A 13676407-T-A Y*
15790399-G-A 13678519-G-A Y*
15800034-A-C 13688154-A-C YY*
15806313-A-C 13694433-A-C Y*
15806339-TAAAG-T 13694459-TAAAG-T *
15807629-G-A 13695749-G-A Y*
15818982-A-G 13707102-A-G YY*
15836137-T-A 13724257-T-A Y*
15999353-A-T 13887473-A-T YY*
15885193-A-T 13773313-A-T Y*
15887137-T-G 13775257-T-G Y*
15936299-T-C 13824419-T-C YY*
15936306-T-C 13824426-T-C YY*
15956866-CT-C,CTTT 13844986-CT-C,CTTT 15×T*
15956976-A-G 13845096-A-G YY*
15958771-A-T 13846891-A-T Y*
15995613-A-G 13883733-A-G YY*
16266998-A-T 14155118-A-T Y*
16303855-A-G 14191975-A-G YY*
15735689-T-C 13623809-T-C YY*
16633450-G-T 14521570-G-T YY*
16546999-C-T 14435119-C-T YY*
16554169-C-T 14442289-C-T YY*
16554229-T-C 14442349-T-C YY*
16554237-G-GAA 14442357-G-GAA 10×A*
16569831-A-G 14457951-A-G YY*
16591230-G-A 14479350-G-A YY*
16599688-A-T 14487808-A-T YY*
16622475-A-G 14510595-A-G Y*
16656867-G-T 14544987-G-T YY*
16540454-A-T 14428574-A-T Y*
16682843-T-A 14570963-T-A YY*
16700880-A-T 14589000-A-T Y*
16707465-GA-G 14595585-GA-G 8×A*
16733547-C-A 14621667-C-A YY*
16738936-G-T 14627056-G-T Y*
16754143-G-A 14642263-G-A YY*
16763414-T-C 14651534-T-C YY*
16763472-A-T 14651592-A-T YY*
16542450-A-C 14430570-A-C YY*
16502623-A-G 14390743-A-G Y*
16330625-C-T 14218745-C-T YY*
16444273-A-T 14332393-A-T YY*
16334845-T-A 14222965-T-A YY*
16360287-G-A 14248407-G-A YY*
16372843-A-T 14260963-A-T YY*
16383964-T-A 14272084-T-A Y*
16385926-T-C 14274046-T-C YY*
16398587-G-A 14286707-G-A Y*
16416812-T-A 14304932-T-A YY*
16427025-T-A 14315145-T-A Y*
16445264-G-A 14333384-G-A YY*
16498615-C-T 14386735-C-T Y*
16445288-T-G 14333408-T-G YY*
16445375-T-C 14333495-T-C YY*
16450295-T-C 14338415-T-C YY*
16457672-A-G 14345792-A-G YY*
16462431-G-T 14350551-G-T YY*
16462508-C-T 14350628-C-T YY*
16468916-G-A 14357036-G-A Y*
16497541-T-A 14385661-T-A YY*
16497563-C-T 14385683-C-T YY*
15743890-G-A 13632010-G-A Y*
15734392-A-G 13622512-A-G YY*
16796066-G-A 14684186-G-A YY*
15318599-CA-C 13206705-CA-C 8×A*
15167344-G-A 13055430-G-A YY*
15186763-A-T 13074849-A-T Y*
15186798-A-T 13074884-A-T Y*
15189426-T-A 13077512-T-A Y*
15198609-T-A 13086695-T-A YY*
15295096-T-C 13183195-T-C Y*
15298575-C-T 13186674-C-T Y*
15301161-A-T 13189260-A-T Y*
15320382-G-A 13208488-G-A FTA39470 YY*
15148228-T-C 13036315-T-C Y*
15329525-A-T 13217643-A-T YY*
15341163-C-T 13229282-C-T YY*
15348959-A-C 13237078-A-C YY*
15349049-G-A 13237168-G-A YY*
15350519-C-T 13238638-C-T YY*
15350526-G-T 13238645-G-T YY*
15365203-A-T 13253323-A-T YY*
15381920-C-CT 13270040-C-CT 8×T*
15149676-A-T 13037763-A-T Y*
15148224-T-C 13036311-T-C Y*
15402730-C-T 13290850-C-T YY*
14781742-C-T 12669812-C-T YY*
14683034-A-G 12571100-A-G Y*
14698481-ACAAC-A 12586547-ACAAC-A *
36609-C-A *
14738704-A-G 12626772-A-G Y*
14738795-C-T 12626863-C-T Y*
14766866-T-G 12654935-T-G YY*
14771764-A-T 12659833-A-T YY*
14772947-G-T 12661016-G-T YY*
14788786-T-A 12676857-T-A YY*
15142765-C-A 13030852-C-A Y*
14874546-T-C 12762616-T-C YY*
14889259-T-C 12777325-T-C YY*
14914156-C-T 12802223-C-T YY*
15010076-CTTT-C 12898161-CTTT-C 14×T*
15028851-A-T 12916939-A-T YY*
4623942-G-T 4755901-G-T *
15077729-G-T 12965819-G-T YY*
15120607-T-A 13008694-T-A Y*
15142764-C-A 13030851-C-A Y*
15388644-A-T 13276764-A-T YY*
15416715-G-GT 13304835-G-GT 9×T*
15714514-T-C 13602634-T-C YY*
15651643-T-C 13539763-T-C YY*
15613616-C-T 13501736-C-T YY*
15617051-G-T 13505171-G-T YY*
15627745-G-T 13515865-G-T Y*
15628427-C-T 13516547-C-T Y*
15643216-T-A 13531336-T-A Y*
15643223-T-A 13531343-T-A Y*
15643239-T-C 13531359-T-C Y*
15643252-A-G 13531372-A-G Y*
15667024-T-C 13555144-T-C Y*
15587661-C-T 13475781-C-T YY*
15667047-A-G 13555167-A-G Y*
15672584-T-A 13560704-T-A Y*
15672585-G-T 13560705-G-T Y*
15672694-A-G 13560814-A-G Y*
15677970-A-T 13566090-A-T Y*
15678115-A-G 13566235-A-G Y*
15678773-T-A 13566893-T-A Y*
15696424-A-T 13584544-A-T YY*
15605856-G-T 13493976-G-T YY*
15587659-C-A 13475779-C-A FT175603 YY*
15420416-T-A 13308536-T-A YY*
15520502-C-T 13408622-C-T YY*
15445054-G-A 13333174-G-A Y*
15456619-T-C 13344739-T-C YY*
15458508-TG-T 13346628-TG-T *
15462937-T-A 13351057-T-A YY*
15494412-A-T 13382532-A-T YY*
15509395-C-T 13397515-C-T YY*
15509765-T-C 13397885-T-C YY*
15519063-C-T 13407183-C-T YY*
15536989-A-T 13425109-A-T YY*
15587651-A-G 13475771-A-G YY*
15538263-C-T 13426383-C-T YY*
15553799-A-G 13441919-A-G YY*
15554586-C-T 13442706-C-T YY*
15556280-GT-G 13444400-GT-G *
15556282-C-A 13444402-C-A YY*
15556284-G-A 13444404-G-A YY*
15569699-G-GTAGCGAGGTTCCCTGCCAGGCTGCACTTC 13457819-G-GTAGCGAGGTTCCCTGCCAGGCTGCACTTC *
15572576-G-A 13460696-G-A YY*
15587645-T-G 13475765-T-G YY*
16763822-A-T 14651942-A-T YY*
16802669-T-A 14690789-T-A YY*
18987205-A-G 16875325-A-G Y*
18141121-C-T 16029241-C-T Y*
18087771-T-A 15975891-T-A YY*
18095017-T-A 15983137-T-A YY*
18108135-G-T 15996255-G-T YY*
18119687-G-A 16007807-G-A YY*
18125144-C-A 16013264-C-A YY*
18129041-G-A 16017161-G-A YY*
18139136-A-G 16027256-A-G Y*
18140864-T-C 16028984-T-C Y*
18141726-A-G 16029846-A-G Y*
18065205-A-T 15953325-A-T YY*
18143488-GT-G 16031608-GT-G *
18150952-GTGCT-G 16039072-GTGCT-G *
18150956-T-TAAAA 16039076-T-TAAAA *
18162206-G-T 16050326-G-T YY*
18191551-G-A 16079671-G-A Y*
18223922-A-T 16112042-A-T Y*
18227182-C-T 16115302-C-T *
18227333-G-T 16115453-G-T *
18076660-ATCTG-A 15964780-ATCTG-A 4×TCTG*
18058532-C-G 15946652-C-G Y*
18261840-A-T 16149960-A-T *
17912804-A-G 15800924-A-G YY*
17837537-G-T 15725657-G-T Y*
17837594-T-G 15725714-T-G Y*
17837656-G-A 15725776-G-A Y9×A*
17842564-G-GGGCTTATTGCCATATGGTAAAACTAAAA 15730684-G-GGGCTTATTGCCATATGGTAAAACTAAAA *
17850073-A-G 15738193-A-G YY*
17876975-T-A 15765095-T-A YY*
17898396-C-T 15786516-C-T Y*
17910590-G-C 15798710-G-C YY*
17927402-G-A 15815522-G-A YY*
18055515-A-G 15943635-A-G Y*
17938508-T-A 15826628-T-A YY*
17952623-C-CT,T 15840743-C-CT,T 16×T*
17996534-A-G 15884654-A-G P7_Gap Y*
18001458-T-A 15889578-T-A P7_Gap Y*
18007368-G-T 15895488-G-T P7_Gap Y*
18007400-T-C 15895520-T-C P7_Gap Y*
18027766-G-A 15915886-G-A Y*
18039396-TGCTTAAAGGCATGTAC-T 15927516-TGCTTAAAGGCATGTAC-T *
18041396-G-T 15929516-G-T Y*
18252220-G-T 16140340-G-T Y*
18264442-T-A 16152562-T-A *
17806147-GA-G 15694267-GA-G *
18934573-T-A 16822693-T-A YY*
18813556-G-A 16701676-G-A YY*
18820916-A-G 16709036-A-G YY*
18840187-T-A 16728307-T-A YY*
18851630-G-T 16739750-G-T YY*
18865134-C-T 16753254-C-T YY*
18878349-CT-C 16766469-CT-C *
18900418-T-A 16788538-T-A YY*
18909644-C-T 16797764-C-T YY*
18941543-G-T 16829663-G-T YY*
18795129-G-A 16683249-G-A YY*
18941634-C-T 16829754-C-T YY*
18949579-C-T 16837699-C-T YY*
18951210-A-G 16839330-A-G YY*
18959735-A-T 16847855-A-T YY*
18959799-T-A 16847919-T-A YY*
18967880-G-A 16856000-G-A Y*
18968385-T-A 16856505-T-A Y*
18983124-T-A 16871244-T-A YY*
18797863-T-C 16685983-T-C Y*
18794011-G-A 16682131-G-A Y*
18385419-G-A 16273539-G-A P6_Gap *
18558178-C-T 16446298-C-T FTA19701 YY*
18388576-C-A 16276696-C-A P6_Gap *
18388594-T-A 16276714-T-A P6_Gap *
18408700-A-T 16296820-A-T P6_Gap *
18421658-A-T 16309778-A-T P6_Gap *
18423887-CA-AA,C 16312007-CA-AA,C P6_Gap 15×A*
18434735-A-G 16322855-A-G P6_Dst *
18549146-A-T 16437266-A-T Y*
18555419-A-T 16443539-A-T YY*
18565088-AGT-A 16453208-AGT-A *
18793344-T-C 16681464-T-C YY*
18585656-A-G 16473776-A-G YY*
18595167-A-T 16483287-A-T YY*
18623629-G-A 16511749-G-A Y*
18641128-T-A 16529248-T-A YY*
18667472-G-T 16555592-G-T YY*
18673565-T-C 16561685-T-C YY*
18723218-A-G 16611338-A-G YY*
18734647-G-T 16622767-G-T Y*
18792149-G-A 16680269-G-A FT347823 Y*
17835810-C-T 15723930-C-T Y*
17785330-A-T 15673450-A-T Y*
16814846-A-G 14702966-A-G Y*
17096498-AT-A 14984618-AT-A *
17069477-A-T 14957597-A-T Y*
17069494-G-T 14957614-G-T Y*
17069495-A-T 14957615-A-T Y*
17070709-G-T 14958829-G-T Y*
17083228-CCA-C 14971348-CCA-C *
17083231-T-TGA 14971351-T-TGA *
17083626-A-G 14971746-A-G Y*
17089677-A-G 14977797-A-G YY*
17123685-T-C 15011805-T-C Y*
17008637-T-C 14896757-T-C YY*
17128812-A-G 15016932-A-G YY*
17130400-C-T 15018520-C-T YY21×T*
17139625-G-T 15027745-G-T YY*
17143088-G-A 15031208-G-A BY20001 YY*
17156770-T-C 15044890-T-C YY*
17179385-T-C 15067505-T-C YY*
17188881-G-A 15077001-G-A YY*
17226456-A-G 15114576-A-G Y*
17025348-A-G 14913468-A-G Y*
17006329-C-T 14894449-C-T YY*
17252179-G-T 15140299-G-T YY*
16881728-C-T 14769848-C-T Y*
16824698-G-A 14712818-G-A YY*
16832631-T-A 14720751-T-A YY*
16842134-A-G 14730254-A-G YY*
16846220-T-C 14734340-T-C YY*
16849687-A-G 14737807-A-G YY*
16860151-A-G 14748271-A-G YY*
16878621-T-C 14766741-T-C YY*
16878622-A-T 14766742-A-T YY*
16917860-C-T 14805980-C-T YY*
16997011-G-T 14885131-G-T Y*
16926366-A-G 14814486-A-G Y*
16953348-A-G 14841468-A-G YY*
16970911-T-A 14859031-T-A YY*
16974271-TA-T 14862391-TA-T *
16974617-A-G 14862737-A-G Y*
16976153-C-A 14864273-C-A Y*
16977609-C-A 14865729-C-A Y*
16980082-A-G 14868202-A-G YY*
16994873-A-C 14882993-A-C Y*
17243826-A-T 15131946-A-T YY*
17261999-T-C 15150119-T-C Y*
17771510-G-GA 15659630-G-GA 9×A*
17595455-C-T 15483575-C-T YY*
17533269-G-T 15421389-G-T YY*
17540176-C-A 15428296-C-A Y*
17541473-G-T 15429593-G-T Y*
17542618-C-A 15430738-C-A Y*
17545563-C-T 15433683-C-T Y*
17556166-C-T 15444286-C-T YY*
17563036-G-T 15451156-G-T YY*
17580055-T-A 15468175-T-A YY*
17618573-A-G 15506693-A-G Y*
17521068-A-T 15409188-A-T Y*
17681005-T-A 15569125-T-A YY*
17699077-G-A 15587197-G-A Y*
17699089-GTT-G 15587209-GTT-G *
17699092-G-A 15587212-G-A Y*
17699213-AG-A 15587333-AG-A *
17727782-T-A 15615902-T-A Y*
17728421-C-G 15616541-C-G Y*
17747693-GA-G 15635813-GA-G 9×A*
17530339-A-T 15418459-A-T YY*
17520256-C-A 15408376-C-A Y*
17262041-T-A 15150161-T-A Y*
17387318-A-ATAT 15275438-A-ATAT *
17269070-G-T 15157190-G-T Y*
17338104-G-T 15226224-G-T Y*
17365447-C-T 15253567-C-T YY*
17370393-A-G 15258513-A-G YY*
17370419-A-G 15258539-A-G YY*
17370697-C-T 15258817-C-T YY*
17372057-C-T 15260177-C-T YY*
17372090-C-T 15260210-C-T YY*
17395641-T-C 15283761-T-C YY*
17514173-C-A 15402293-C-A YY*
17417426-T-A 15305546-T-A YY*
17436867-T-A 15324987-T-A YY*
17443759-G-T 15331879-G-T YY*
17443760-A-T 15331880-A-T YY*
17457246-G-T 15345366-G-T YY*
17461886-C-T 15350006-C-T YY*
17481281-T-A 15369401-T-A YY*
17502671-A-T 15390791-A-T Y*
17511110-A-G 15399230-A-G YY*
4632142-G-T 4764101-G-T *
14715542-G-A 12603609-G-A FT281706 Y*
4621438-A-T 4753397-A-T *
56839476-A-T *
9911366-G-C 10073757-G-C FT333110 Y*
9911351-G-C 10073742-G-C Y*
9911343-T-A 10073734-T-A Y*
9911321-C-G 10073712-C-G Y*
9911320-G-T 10073711-G-T Y*
8533867-CAA-C 8665826-CAA-C 13×A*
13469625-C-A 11313949-C-A *
10073248-T-C 10235639-T-C *
10073246-T-A 10235637-T-A *
27287-G-A *
8272545-G-GT 8404504-G-GT 10×T*
27390-G-T *
9911380-T-A 10073771-T-A Y*
3303468-A-AT 3435427-A-AT 10×T*
20809718-C-A 18647832-C-A P4_Gap *
9444704-G-A 9607095-G-A YY*
9825002-C-T 9987393-C-T Y*
15734411-G-T 13622531-G-T YY*
19760-C-T *
19731-A-T *
14538183-C-CA 12426384-C-CA 9×A*
13567202-A-G 11411526-A-G *
8025170-G-A 8157129-G-A YY*
7139785-A-AT 7271744-A-AT 9×T*
13465960-T-A 11310284-T-A *
9911369-C-A 10073760-C-A Y*
9911382-A-G 10073773-A-G Y*
10848046-G-C *
13930206-G-A 11809500-G-A Y*
17679167-T-A 15567287-T-A FT237233 YY11×A*
3141361-G-A 3273320-G-A *
11022816-C-A *
58990783-A-C 56844636-A-C *
58990752-A-G 56844605-A-G *
3297672-A-T 3429631-A-T *
10757417-T-C *
13496234-A-C 11340558-A-C *
28793764-T-A 26647617-T-A *
13474743-C-A 11319067-C-A *
13709499-T-C 11553823-T-C *
7325789-C-A 7457748-C-A YY*
9911394-A-G 10073785-A-G Y*
3833652-C-CAA 3965611-C-CAA 16×A*
21201075-C-A 19039189-C-A YY*
10958893-C-T *
10889313-C-T *
7233034-A-T 7364993-A-T YY*
3796333-C-CTA 3928292-C-CTA 9×TA*
56839456-T-A *
13933388-A-T 11812682-A-T Y*
14549334-G-A 12437535-G-A YY*
4096419-A-AT 4228378-A-AT 10×T*
14191934-G-T 12071228-G-T YY*
10848060-T-C *
24890224-ATTT-A 22744077-ATTT-A g1 13×T*
9198209-A-T 9360600-A-T Y*
6631480-A-AT 6763439-A-AT 10×T*
13487741-CCT-C 11332065-CCT-C *
13709473-A-C 11553797-A-C *
36604-C-G *
13474399-T-C 11318723-T-C *
19356963-CA-C,CAA 17245083-CA-C,CAA 14×A*
10940407-A-C *
13483433-G-A 11327757-G-A *
13474479-C-A 11318803-C-A *
13478258-AGTG-A 11322582-AGTG-A *
18031120-C-CA 15919240-C-CA 10×A*
11027143-A-G *
56718313-A-G *
13488892-C-G 11333216-C-G *
14549326-G-A 12437527-G-A YY*
14486057-G-A 12365326-G-A YY*
10906225-T-A *
10906218-G-A *
3463382-AAAAAC-A 3595341-AAAAAC-A 5×AAAAC*
56842433-C-T *
56842408-T-C *
13477259-G-A 11321583-G-A *
13477249-A-G 11321573-A-G *
9983416-A-C 10145807-A-C Y*
8973278-G-GA 9135669-G-GA 11×A*
13431838-G-T 11276162-G-T *
14962336-CT-C 12850411-CT-C 12×T*
34258-G-T FGC77591 *
13488838-C-T 11333162-C-T *
13336459-G-T 11180783-G-T *
10658601-C-A *
13336447-G-T 11180771-G-T *
13696785-G-T 11541109-G-T *
4094541-C-A 4226500-C-A *
16634980-TTTA-T 14523100-TTTA-T 5×TTA*
56850831-G-A *
22674962-C-CAA 20513076-C-CAA 11×A*
10883579-C-T *
18589673-AT-A 16477793-AT-A 8×T*
16468810-G-A 14356930-G-A Y*
10799645-C-A *
10776027-T-C *
10658599-A-G *
22610750-G-GA 20448864-G-GA 9×A*
13461060-C-T 11305384-C-T *
22235565-A-AC 20073679-A-AC DYZ19 *
10884623-A-G *
14061366-ATTTTT-A 11940660-ATTTTT-A 17×T*
56850986-C-A *
13726236-G-A 11570560-G-A *
15734400-A-T 13622520-A-T Y41130 YY*
14840252-GTT-G 12728319-GTT-G 12×T*
23351487-A-AT 21189601-A-AT 9×T*
10824810-C-A *
10909724-G-A *
28794204-A-C 26648057-A-C *
10759280-T-A *
3849045-C-A 3981004-C-A *
16634085-A-AT 14522205-A-AT Y29027 8×T*
2855298-G-A 2987257-G-A FT234926 YY*
56699595-T-A *
5095644-C-T 5227603-C-T *
13487831-C-A 11332155-C-A *
29730-T-C *
13466024-C-A 11310348-C-A *
13472443-G-A 11316767-G-A *
9983312-A-G 10145703-A-G Y*
10803241-A-C *
10975692-A-G *
22811753-G-GA 20649867-G-GA *
13486531-C-T 11330855-C-T *
11031310-C-G *
10677702-TTG-T *
7473-T-C FGC77633 *
13485380-A-T 11329704-A-T *
10807612-T-G *
13472074-A-G 11316398-A-G *
28812287-A-T 26666140-A-T *
11008668-G-T *
10884622-C-G *
10803243-T-C *
29764-T-G *
28239-A-C *
27353-A-C *
27336-T-C *
13462049-C-A 11306373-C-A *
29814-T-C FGC77634 *
22485573-A-T 20323687-A-T DYZ19 *
28583410-C-G 26437263-C-G *
28813240-C-G 26667093-C-G *
16618045-G-A 14506165-G-A Y*
13567342-G-A 11411666-G-A *
13472035-A-T 11316359-A-T *
13383050-T-C 11227374-T-C *
13254344-C-A 11098668-C-A *
9929379-G-C 10091770-G-C Y*
9929374-T-C 10091765-T-C Y*
9929373-G-A 10091764-G-A Y*
9929372-T-C 10091763-T-C Y*
28583415-T-C 26437268-T-C *
28583382-G-C 26437235-G-C *
10677713-TTCA-T *
13504123-A-G 11348447-A-G *
13470061-C-T 11314385-C-T *
13467600-C-A 11311924-C-A *
13445770-C-A 11290094-C-A *
10940408-T-C *
5567416-T-C 5699375-T-C *
4779808-C-CA 4911767-C-CA *
13462016-C-A 11306340-C-A *
13348073-A-G 11192397-A-G *
10005913-G-T 10168304-G-T Y*
9929378-A-T 10091769-A-T Y*
4179023-A-T 4310982-A-T FTB54703 *
13239659-T-C 11083983-T-C *
13474448-C-A 11318772-C-A *
17515838-G-GA 15403958-G-GA 9×A*
9909158-T-C 10071549-T-C Y*
13463214-A-T 11307538-A-T *
4067402-G-A 4199361-G-A *
10958888-C-T *
15431764-C-CT 13319884-C-CT 8×T*
13477203-G-A 11321527-G-A *
16734886-G-A 14623006-G-A YY*
8075936-C-CTT 8207895-C-CTT 17×T*
9983327-T-A 10145718-T-A Y*
14549339-T-A 12437540-T-A YY*
9909176-A-G 10071567-A-G Y*
9909163-T-A 10071554-T-A Y*
9909153-A-C 10071544-A-C Y*
6688165-T-TA 6820124-T-TA 10×A*
13487822-A-C 11332146-A-C *
10920912-G-A *
13272257-C-A 11116581-C-A *
6658264-AT-A 6790223-AT-A 10×T*
10848035-T-A *
4488327-G-GA 4620286-G-GA 10×A*
10811419-C-G FT432244 *
13709476-T-A 11553800-T-A *
21320267-C-A 19158381-C-A Y*
11015174-C-A *
21116888-C-A 18955002-C-A YY*
7298801-T-C 7430760-T-C Y*
5349501-C-T 5481460-C-T *
22811107-C-T 20649221-C-T Y*
22146493-C-A 19984607-C-A YY*
14486056-T-C 12365325-T-C YY*
14486026-G-A 12365295-G-A YY*
13488702-TG-T 11333026-TG-T *
16991073-G-GTT 14879193-G-GTT 13×T*
24499652-CTGTG-C 22353505-CTGTG-C 8×TG*
9983407-G-A 10145798-G-A Y*
9983397-T-G 10145788-T-G Y*
13478229-T-C 11322553-T-C *
2833179-T-C 2965138-T-C YY*
27221-T-C *
13479009-G-A 11323333-G-A *
13672023-C-T 11516347-C-T BY87858 *
18200686-C-A 16088806-C-A YY*
5808483-C-T 5940442-C-T 13×T*
11018290-C-G *
5992518-G-A 6124477-G-A FT159306 *
13463160-C-A 11307484-C-A *
3809552-AT-A 3941511-AT-A 9×T*
7385824-C-T 7517783-C-T YY*
13482920-C-T 11327244-C-T *
13272696-A-G 11117020-A-G *
13463988-C-T 11308312-C-T *
16209127-AT-A 14097247-AT-A 8×T*
20807083-T-A 18645197-T-A P4_Gap *
23521345-T-G 21359459-T-G Y*
21526487-T-C 19364601-T-C Y*
7161513-G-T 7293472-G-T M5592 YY14×T*
18884324-C-T 16772444-C-T Y55006 YY*
56856693-G-A *
13261238-G-A 11105562-G-A *
8476198-TTG-T 8608157-TTG-T *
8544510-GAC-G 8676469-GAC-G *
9911334-T-C 10073725-T-C Y*
9911335-G-A 10073726-G-A Y*
9930156-G-C 10092547-G-C Y*
3315648-A-G 3447607-A-G ****
9936735-T-A 10099126-T-A Y*
9983389-A-T 10145780-A-T Y*
10005997-A-T 10168388-A-T A10369 Y*
10006006-G-T 10168397-G-T A10370 Y*
13243576-G-A 11087900-G-A *
13262170-T-C 11106494-T-C *
6721706-C-T 6853665-C-T Y*
13264176-T-C 11108500-T-C *
13266368-T-G 11110692-T-G *
13266634-A-T 11110958-A-T *
13297284-G-T 11141608-G-T *
13332090-C-T 11176414-C-T *
13340951-T-A 11185275-T-A Z26128 *
13411803-C-T 11256127-C-T *
13352003-A-T 11196327-A-T *
13857960-G-C 11737254-G-C *
13734212-G-T 11578536-G-T *
13432802-G-A 11277126-G-A *
58916150-C-T 56674721-G-A *
7568941-TAC-T 7700900-TAC-T *
6617575-T-C 6749534-T-C Y*
13474122-A-G 11318446-A-G *
22358798-T-G 20196912-T-G DYZ19 *
22811851-GA-G 20649965-GA-G *
28237890-TTG-T 26091743-TTG-T P1_b4 22×TG*
28643615-C-G 26497468-C-G *
28643622-A-G 26497475-A-G CTS12619 *
28721523-G-A 26575376-G-A *
28721528-G-A 26575381-G-A *
58884232-C-G 56706639-G-C *
59000266-C-T 56854119-C-T *
59003980-C-T 56857833-C-T *
13526326-C-T 11370650-C-T ****
9962562-A-G 10124953-A-G FT369806 Y*
13489144-G-A 11333468-G-A *
7299242-G-T 7431201-G-T Y****
58858955-T-G 56731916-A-C *
4844566-C-T 4976525-C-T *
13461201-G-A 11305525-G-A *
13333074-C-A 11177398-C-A ****
13465038-G-T 11309362-G-T *
22503298-C-G 20341412-C-G DYZ19 *
9432570-G-A 9594961-G-A Y****
3927689-A-G 4059648-A-G *
5273889-G-T 5405848-G-T FGC69292 *
8137262-A-G 8269221-A-G Y****
5293616-C-T 5425575-C-T *
6065370-C-T 6197329-C-T Z10118 *
13442817-A-T 11287141-A-T *
13487760-C-CAT 11332084-C-CAT *
14940072-T-A 12828146-T-A YY*
22887672-T-G 20725786-T-G YY*
19376085-G-A 17264205-G-A YY*
9963287-T-A 10125678-T-A Y*
9963286-T-A 10125677-T-A Y*
22287097-G-T 20125211-G-T DYZ19 *
13740237-G-A 11584561-G-A *
22255870-T-G 20093984-T-G BY188772 DYZ19 *
22255871-G-A 20093985-G-A DYZ19 *
15330458-C-CA 13218576-C-CA 9×A*
2830969-A-AT 2962928-A-AT 10×T*
22443905-G-T 20282019-G-T FT456734 DYZ19 *
22811719-T-C 20649833-T-C FT51485 FGC59208 Y*
22443895-T-C 20282009-T-C DYZ19 *
21369511-AAC-A 19207625-AAC-A *
22443888-T-A 20282002-T-A DYZ19 *
22443879-C-A 20281993-C-A BY6678 DYZ19 *
23519008-C-G 21357122-C-G Y*
13719741-A-ATGGAATGGAT 11564065-A-ATGGAATGGAT *
14123928-C-T 12003222-C-T Y*
22281941-C-T 20120055-C-T FGC81814 DYZ19 *
9987414-A-G 10149805-A-G Y*
59013371-C-T 56867224-C-T *
59012990-T-G 56866843-T-G *
59012989-G-T 56866842-G-T *
59000277-C-A 56854130-C-A *
58969803-T-C 56823656-T-C *
22255839-G-C 20093953-G-C DYZ19 *
19746097-C-A 17634217-C-A P5_Prx *
14270296-A-AT 12149590-A-AT 9×T*
13471782-G-A 11316106-G-A *
22311287-G-T 20149401-G-T DYZ19 *
13507807-G-A 11352131-G-A *
58827091-A-C 56763780-T-G *
13513622-A-G 11357946-A-G *
13531312-A-G 11375636-A-G *
13483060-T-G 11327384-T-G *
13566336-C-G 11410660-C-G *
13600446-G-A 11444770-G-A *
13694650-T-A 11538974-T-A BY44585BY44611 *
13842648-G-A 11721942-G-A *
14613450-G-T 12501648-G-T AM01975 Y*
15545737-T-C 13433857-T-C CTS4286 YY*
19474832-CCT-C 17362952-CCT-C *
22364485-C-A 20202599-C-A DYZ19 *
13489231-C-T 11333555-C-T *
26344249-CAAA-C 24198102-CAAA-C P1_Y1 14×A*
13489561-G-A 11333885-G-A *
58916072-G-C 56674799-C-G *
13477500-G-C 11321824-G-C *
13477494-A-G 11321818-A-G *
10005500-C-T 10167891-C-T Y*
9983306-G-A 10145697-G-A Y*
9936761-C-A 10099152-C-A Y*
9936760-C-A 10099151-C-A Y*
17652131-CTG-C 15540251-CTG-C *
22475865-T-A 20313979-T-A DYZ19 *
14234336-T-G 12113630-T-G YY*
13857962-A-C 11737256-A-C *
28721518-G-A 26575371-G-A *
13699320-G-A 11543644-G-A FGC59460 *
5632637-C-T 5764596-C-T FT108953 *
22311202-G-T 20149316-G-T DYZ19 ****
17477484-G-A 15365604-G-A YY14×A****
58916131-G-C 56674740-C-G *
18968369-G-A 16856489-G-A Y*
58844098-T-G 56746773-A-C *
58837633-A-G 56753238-T-C *
28578920-C-T 26432773-C-T *
28580779-G-T 26434632-G-T CTS12349 *
28580784-T-C 26434637-T-C CTS12350 *
13526375-T-G 11370699-T-G *
28750930-T-A 26604783-T-A ****
59002952-T-C 56856805-T-C *
28643734-G-A 26497587-G-A CTS12621 *
8716918-A-AT 8848877-A-AT 10×T*
14490237-C-T 12369506-C-T M1345 YY*
23521814-T-C 21359928-T-C Y****
17379521-G-A 15267641-G-A FGC16007 Y*
22695600-A-G 20533714-A-G Y****
22620152-G-A 20458266-G-A Y****
22542880-G-T 20380994-G-T Y****
28643632-C-G 26497485-C-G CTS12620 *
28691900-T-A 26545753-T-A 13×A*
17105140-A-AT 14993260-A-AT 10×T*
22266210-G-T 20104324-G-T DYZ19 *
17926560-G-A 15814680-G-A YY*
3194437-C-T 3326396-C-T *
4610747-G-C 4742706-G-C *
58988604-T-A 56842457-T-A *
22475730-A-G 20313844-A-G DYZ19 *
18584330-A-AT 16472450-A-AT 9×T*
18057078-G-GTT 15945198-G-GTT 12×T*
13469164-C-G 11313488-C-G *
13464539-C-T 11308863-C-T *
13466087-T-C 11310411-T-C *
28583394-T-C 26437247-T-C CTS12373 *
13489519-A-G 11333843-A-G *
9909154-T-A 10071545-T-A Y*
22446109-G-T 20284223-G-T DYZ19 *
13464433-C-T 11308757-C-T *
18833242-A-AT 16721362-A-AT 10×T*
13472553-C-A 11316877-C-A *
13705036-TGAATGGACGCGAAAGGAATATAATGGAATG-T 11549360-TGAATGGACGCGAAAGGAATATAATGGAATG-T *
13473040-AT-A 11317364-AT-A *
24891190-A-AT 22745043-A-AT g1 10×T*
22466041-G-T 20304155-G-T FT458642 DYZ19 *
10005919-T-C 10168310-T-C Y*
22461633-G-GT 20299747-G-GT DYZ19 *
13291125-C-T 11135449-C-T *
4163297-T-C 4295256-T-C *
14738413-CTT-C 12626481-CTT-C 17×T*
13485114-T-A 11329438-T-A *
9965063-T-TAGG 10127454-T-TAGG *
21913219-A-C 19751333-A-C Y****
24166636-C-A 22020489-C-A P3_b1 *
13938916-T-G 11818210-T-G Y*
15888068-G-C 13776188-G-C Y****
10005584-T-C 10167975-T-C Y*
18042566-C-T 15930686-C-T Y****
10005992-G-A 10168383-G-A Y*
13252184-A-G 11096508-A-G *
13338480-A-G 11182804-A-G *
13338555-A-G 11182879-A-G *
13414853-G-A 11259177-G-A *
13431742-T-C 11276066-T-C *
13431758-G-A 11276082-G-A *
13438688-G-T 11283012-G-T *
13482900-C-T 11327224-C-T *
15807089-A-T 13695209-A-T Y****
9997082-C-A 10159473-C-A Y*
15640409-T-G 13528529-T-G Y****
13507808-A-G 11352132-A-G *
13531346-T-A 11375670-T-A *
13553211-T-A 11397535-T-A *
13553223-A-G 11397547-A-G *
13567214-A-C 11411538-A-C *
13571598-T-A 11415922-T-A *
13575656-C-A 11419980-C-A *
13576732-G-A 11421056-G-A *
14431598-G-A 12310871-G-A Y****
13576786-G-A 11421110-G-A FT183139 *
13588891-C-T 11433215-C-T *
10005568-A-G 10167959-A-G Y*
9997062-C-A 10159453-C-A F10492 Y*
2833174-CA-C 2965133-CA-C *
5502271-G-A 5634230-G-A *
3126786-A-G 3258745-A-G Z8495 *
3166904-T-C 3298863-T-C *
3166913-G-A 3298872-G-A *
3845315-G-A 3977274-G-A *
3926742-G-A 4058701-G-A *
3927225-A-G 4059184-A-G *
4167676-G-A 4299635-G-A *
4377969-C-T 4509928-C-T 19×T*
4917927-G-T 5049886-G-T *
4997503-T-C 5129462-T-C FT17078 *
5399403-T-C 5531362-T-C *
5564088-A-G 5696047-A-G *
19304825-G-T 17192945-G-T YY****
6451975-A-T 6583934-A-T FT320 *
6605758-T-C 6737717-T-C *
7367933-G-A 7499892-G-A YY16×A*
8417959-A-C 8549918-A-C YY*
8740693-A-T 8872652-A-T Y*
8805308-A-C 8937267-A-C YY*
9429693-G-A 9592084-G-A Y*
9929359-C-A 10091750-C-A Y*
9931548-G-A 10093939-G-A Y*
9944541-C-T 10106932-C-T FT227810 Y*
9983342-T-A 10145733-T-A Y*
9983344-C-T 10145735-C-T Y*
56680293-C-G *
22929693-G-GAA 20767807-G-GAA 14×A*
19770-C-T *
3954864-G-T 4086823-G-T FT271644 *
10972967-C-T *
6498772-G-A 6630731-G-A *
13512208-A-C 11356532-A-C *
3849041-AGT-A 3981000-AGT-A *
3867534-G-GTTT 3999493-G-GTTT 12×T*
13725792-A-T 11570116-A-T *
3868983-G-A 4000942-G-A *
3873330-A-T 4005289-A-T *
3889346-T-C 4021305-T-C *
3911285-T-C 4043244-T-C *
3929288-C-A 4061247-C-A *
3959312-C-T 4091271-C-T *
10972979-A-T *
3970314-T-C 4102273-T-C *
3985180-A-T 4117139-A-T *
3994654-C-T 4126613-C-T *
3996450-C-T 4128409-C-T *
3999267-T-A 4131226-T-A *
4011780-C-T 4143739-C-T *
4063475-G-A 4195434-G-A *
4063580-G-T 4195539-G-T *
4063621-C-A 4195580-C-A *
4078239-A-T 4210198-A-T *
4096808-T-C 4228767-T-C *
4109546-A-T 4241505-A-T *
3837210-G-T 3969169-G-T *
3809537-T-A 3941496-T-A *
4118820-A-T 4250779-A-T *
3738392-T-C 3870351-T-C *
13338718-C-T 11183042-C-T *
13267614-G-A 11111938-G-A *
3642308-G-T 3774267-G-T *
3645490-A-G 3777449-A-G *
3645499-A-G 3777458-A-G *
3650882-C-T 3782841-C-T *
3678380-A-T 3810339-A-T *
3679250-C-A 3811209-C-A *
3717635-G-C 3849594-G-C *
3718189-A-G 3850148-A-G *
3728177-A-C 3860136-A-C *
3763326-G-T 3895285-G-T *
3805589-T-C 3937548-T-C *
3770157-T-A 3902116-T-A *
3770258-G-T 3902217-G-T *
11017855-A-G *
11017849-T-C *
3772112-AC-A 3904071-AC-A *
3772135-C-A 3904094-C-A *
11017837-C-A *
3777768-A-AT 3909727-A-AT *
11017831-T-A *
3783202-G-T 3915161-G-T *
3783407-T-C 3915366-T-C *
11017823-A-G *
4116524-C-T 4248483-C-T *
4122534-C-G 4254493-C-G *
3601971-A-T 3733930-A-T *
56841625-C-G *
13469867-G-C 11314191-G-C *
4527650-A-C 4659609-A-C *
4531238-T-A 4663197-T-A *
13204531-TGGC-T 11048855-TGGC-T *
13448483-C-G 11292807-C-G *
10082061-A-T 10244452-A-T *
11292827-G- *
56841663-G-T *
56841649-T-C *
56841646-G-T *
56841626-A-T *
22811760-GTTA-G 20649874-GTTA-G *
4518076-A-G 4650035-A-G *
4602568-T-C 4734527-T-C *
22811759-G-GCT 20649873-G-GCT *
22811715-T-C 20649829-T-C Y*
22811714-T-C 20649828-T-C Y*
22480275-A-G 20318389-A-G BY25231 DYZ19 *
22238276-GACACATCTGAAGGAACAAACTCTGGACATAACACCTTTAATTGCTGTAAAACTCACCACTAAGGTCTGCAGCTTCATTCTTGAAGTGAGCAAGACCATGAACCTGCCAGAAGGAAGAAACTCTGA-G 20076390-GACACATCTGAAGGAACAAACTCTGGACATAACACCTTTAATTGCTGTAAAACTCACCACTAAGGTCTGCAGCTTCATTCTTGAAGTGAGCAAGACCATGAACCTGCCAGAAGGAAGAAACTCTGA-G DYZ19 *
13479261-T-C 11323585-T-C *
13478384-AGGAG-A 11322708-AGGAG-A *
13478381-A-ATCCG 11322705-A-ATCCG *
13478368-C-A 11322692-C-A *
13477271-C-A 11321595-C-A *
13474123-A-G 11318447-A-G *
13488707-C-CT 11333031-C-CT *
4509379-A-T 4641338-A-T *
4124964-A-T 4256923-A-T *
4261258-G-T 4393217-G-T *
4125624-A-G 4257583-A-G *
4140944-C-A 4272903-C-A *
4147493-T-A 4279452-T-A *
4148975-A-T 4280934-A-T *
4159527-T-C 4291486-T-C *
16300321-G-T 14188441-G-T YY*
4168930-A-T 4300889-A-T *
4222424-A-G 4354383-A-G *
4230273-G-A 4362232-G-A *
13689745-G-A 11534069-G-A *
4260328-C-T 4392287-C-T *
4285964-T-C 4417923-T-C *
4502824-G-A 4634783-G-A *
4290495-A-G 4422454-A-G *
4292045-G-T 4424004-G-T *
4324067-C-G 4456026-C-G *
4349612-GA-G 4481571-GA-G *
4373800-C-T 4505759-C-T *
4391256-TA-T 4523215-TA-T *
4402657-C-T 4534616-C-T *
4404266-T-C 4536225-T-C *
4445624-A-G 4577583-A-G *
4459693-G-A 4591652-G-A *
4475634-T-TA 4607593-T-TA 8×A*
4502356-T-C 4634315-T-C *
3623426-G-A 3755385-G-A *
3577425-C-T 3709384-C-T *
9983419-C-T 10145810-C-T Y*
2936121-A-G 3068080-A-G *
10758013-T-C,C *
10758017-A-C,C *
2656287-A-G 2788246-A-G YY*
2767767-G-T 2899726-G-T YY*
11022060-CCA-C *
2800105-A-G 2932064-A-G YY*
2819119-C-A 2951078-C-A YY*
2857056-G-T 2989015-G-T Y*
2896956-G-T 3028915-G-T Y*
2902946-C-A 3034905-C-A YY*
2928320-G-A 3060279-G-A *
2944266-A-T 3076225-A-T *
10757988-T-TCC,TCC *
2946469-T-C 3078428-T-C *
2955836-G-T 3087795-G-T *
2962415-C-T 3094374-C-T *
3014844-G-A 3146803-G-A *
3035878-A-T 3167837-A-T *
3047856-T-A 3179815-T-A *
3054027-T-C 3185986-T-C *
3054355-G-A 3186314-G-A *
3055056-C-A 3187015-C-A *
3057631-A-T 3189590-A-T *
3068251-C-T 3200210-C-T *
3094330-TGC-T 3226289-TGC-T *
10757989-A-ATTC,ATTC *
11022065-CTATCTCACTCCTT-C *
3102775-T-G 3234734-T-G *
10036937-C-T 10199328-C-T *
10082035-T-C 10244426-T-C *
6720973-T-C 6852932-T-C Y*
2924386-T-C 3056345-T-C *
20837634-G-GA 18675748-G-GA P4_Gap 10×A*
6402207-G-C 6534166-G-C *
28784221-G-GAATGA 26638074-G-GAATGA *
13701444-CAATGA-C 11545768-CAATGA-C *
13701433-GAAATGGAATT-G 11545757-GAAATGGAATT-G *
13527530-C-T 11371854-C-T *
19025723-C-A 16913843-C-A Y*
13506068-A-G 11350392-A-G *
9983297-A-G 10145688-A-G Y*
11022088-CTCCACTCCAT-C *
5903554-G-A 6035513-G-A *
13714030-T-A 11558354-T-A *
56829174-T- 4×ATTCC*
13487751-CCA-C 11332075-CCA-C *
13465992-AC-A 11310316-AC-A *
13463231-A-AGG 11307555-A-AGG *
28791284-AGTGGAGT-A 26645137-AGTGGAGT-A *
22811738-G-A 20649852-G-A Y*
28791280-ACGG-A 26645133-ACGG-A *
13706082-T-A 11550406-T-A *
13602297-C-A 11446621-C-A *
13442810-A-T 11287134-A-T *
3102772-GCA-G 3234731-GCA-G *
3113243-T-A 3245202-T-A *
3576744-TCA-T 3708703-TCA-T *
13486000-G-C 11330324-G-C *
13600468-A-T 11444792-A-T *
13531311-T-A 11375635-T-A *
3317893-A-T 3449852-A-T *
3324354-G-T 3456313-G-T *
3333803-C-CA 3465762-C-CA 8×A*
3340451-G-A 3472410-G-A *
3354158-A-C 3486117-A-C *
3357953-C-T 3489912-C-T *
3372788-C-A 3504747-C-A *
3375409-A-G 3507368-A-G *
3402748-A-G 3534707-A-G *
13479062-C-T 11323386-C-T *
3296492-A-G 3428451-A-G *
3403444-TAATAAATA-T,TAATA 3535403-TAATAAATA-T,TAATA 10×AATA*
3423916-CA-C 3555875-CA-C *
3471148-A-T 3603107-A-T *
3480255-T-A 3612214-T-A *
3487241-A-G 3619200-A-G *
13469463-A-T 11313787-A-T *
3507962-T-A 3639921-T-A *
13438497-C-G 11282821-C-G *
3514790-A-G 3646749-A-G *
13438489-C-T 11282813-C-T *
3556392-A-G 3688351-A-G *
13438487-T-C 11282811-T-C *
3297196-G-A 3429155-G-A *
3281801-G-T 3413760-G-T *
3127343-A-G 3259302-A-G *
28550758-T-C 26404611-T-C *
10958904-TTCATGCCGTTCTGCTGCA-T *
3127373-T-A 3259332-T-A *
3159716-A-T 3291675-A-T *
10958900-CCA-C *
10958886-C-T *
13748506-T-C 11592830-T-C *
10624490-T-C *
17631142-T-C 15519262-T-C FT207546 YY*
28813200-G-A 26667053-G-A *
28586986-T-A 26440839-T-A *
28550768-G-A 26404621-G-A *
28550756-A-G 26404609-A-G *
3277548-A-T 3409507-A-T *
3171558-G-T 3303517-G-T *
3173338-G-T 3305297-G-T *
3207324-A-T 3339283-A-T *
3208581-A-T 3340540-A-T *
3240705-G-T 3372664-G-T *
13704476-A-T 11548800-A-T *
3243992-A-G 3375951-A-G *
3244017-A-C 3375976-A-C *
3270918-T-A 3402877-T-A *
3271529-G-A 3403488-G-A *
3274879-T-C 3406838-T-C *
3275962-G-A 3407921-G-A *
17401131-A-G 15289251-A-G YY*
9983428-T-C 10145819-T-C Y*
29806-T-C *
22475883-T-A 20313997-T-A DYZ19 *
56874786-CT-C 11×T*
13711745-AATGGAACGGAATGGAATTAAATGGAACGGAATGGAATGGC-A 11556069-AATGGAACGGAATGGAATTAAATGGAACGGAATGGAATGGC-A *
13688004-C-T 11532328-C-T *
13496205-TG-T 11340529-TG-T *
13476474-T-G 11320798-T-G *
13469584-T-G 11313908-T-G *
13411785-A-T 11256109-A-T *
13575671-G-T 11419995-G-T *
13506065-G-A 11350389-G-A *
9936825-T-C 10099216-T-C Y*
58997031-C-T 56850884-C-T *
13463187-C-T 11307511-C-T *
9944517-C-A 10106908-C-A Y*
13463171-C-A 11307495-C-A *
13469187-G-C 11313511-G-C *
10005937-C-G 10168328-C-G Y*
10005933-C-T 10168324-C-T Y*
13448048-C-T 11292372-C-T *
56839055-T-G *
7141254-G-GA 7273213-G-GA 10×A*
14793579-G-GT 12681650-G-GT 9×T*
13465116-C-T 11309440-C-T *
14683571-G-A 12571637-G-A Y*
29743-G-A *
7433-T-C *
13486487-T-A 11330811-T-A *
9944521-A-T 10106912-A-T Y*
28550710-G-C 26404563-G-C FT59704 *
13484891-A-G 11329215-A-G *
9943878-G-A 10106269-G-A Y*
56710188-C-T *
13479580-T-A 11323904-T-A *
13467571-A-T 11311895-A-T *
13461464-GCCCC-G 11305788-GCCCC-G *
3895704-G-A 4027663-G-A *
13481505-C-G 11325829-C-G *
13481501-A-G 11325825-A-G *
13489990-C-T 11334314-C-T *
13489975-G-A 11334299-G-A *
13486002-G-C 11330326-G-C *
13479579-C-A 11323903-C-A *
9944524-A-T 10106915-A-T Y*
13477218-G-A 11321542-G-A *
13477209-G-GTT 11321533-G-GTT *
13477205-CCA-C 11321529-CCA-C *
13450834-T-TCCCCTCCTCTCCATC 11295158-T-TCCCCTCCTCTCCATC *
13443602-G-T 11287926-G-T *
10068211-A-T 10230602-A-T *
10068210-C-A 10230601-C-A *
10068203-G-C 10230594-G-C *
10068201-A-T 10230592-A-T *
10005498-G-A 10167889-G-A Y*
10005497-C-T 10167888-C-T Y*
9962569-C-T 10124960-C-T Y*
28578949-G-T 26432802-G-T *
28550684-C-T 26404537-C-T *
29798-C-A *
13628086-C-T 11472410-C-T *
13438462-A-C 11282786-A-C *
4158086-A-AT 4290045-A-AT 10×T*
29832-C-T *
13462028-G-C 11306352-G-C *
13462017-G-T 11306341-G-T *
3331462-A-AAT 3463421-A-AAT 8×AT*
18565092-C-A 16453212-C-A YY*
15218734-C-A 13106820-C-A Y*
28793855-A-T 26647708-A-T *
3836918-G-GAA 3968877-G-GAA 9×A*
9936301-A-T 10098692-A-T Y*
28793734-G-C 26647587-G-C *
3172334-T-C 3304293-T-C *
13492886-T-C 11337210-T-C *
13411544-A-G 11255868-A-G *
5987414-C-A 6119373-C-A *
13694033-G-A 11538357-G-A *
10005928-A-G 10168319-A-G BY82726 Y*
27629-T-A FGC78286 *
27248-C-A *
13607674-T-C 11451998-T-C *
13489964-C-A 11334288-C-A *
56871623-T-TAA 9×A*
16971604-C-T 14859724-C-T FT68197 Y*
28812558-G-T 26666411-G-T *
13527964-G-C 11372288-G-C *
22252005-G-A 20090119-G-A DYZ19 *
13479820-A-T 11324144-A-T *
22475895-C-T 20314009-C-T BY47356 DYZ19 *
13475965-G-A 11320289-G-A *
13475961-A-T 11320285-A-T *
13475960-G-T 11320284-G-T *
23296051-G-GT 21134165-G-GT 9×T*
13476656-G-C 11320980-G-C *
13479222-G-C 11323546-G-C *
13567356-G-A 11411680-G-A *
13278043-C-CA 11122367-C-CA 9×A*
13531304-A-G 11375628-A-G *
22341439-T-C 20179553-T-C DYZ19 *
22446683-G-T 20284797-G-T DYZ19 *
28578931-C-T 26432784-C-T *
13405640-A-AT 11249964-A-AT *
13351341-G-T 11195665-G-T *
11656124-G-A *
13601639-G-T 11445963-G-T *
9939006-G-C 10101397-G-C Y*
13338704-G-A 11183028-G-A *
9944527-G-T 10106918-G-T Y*
9943866-G-C 10106257-G-C Y*
56707471-A-C *
22984828-C-T 20822942-C-T Y*
13476664-A-G 11320988-A-G *
13477229-C-T 11321553-C-T *
13470055-C-T 11314379-C-T *
13469178-C-A 11313502-C-A *
9943883-AC-A 10106274-AC-A *
9943885-ATTACATTAAACTCAGTGCTGCCATGTCAGTAAAGACCTGGCAGAATTCATCACCTGCTGACTAAAGAACCCCTGTAC-A 10106276-ATTACATTAAACTCAGTGCTGCCATGTCAGTAAAGACCTGGCAGAATTCATCACCTGCTGACTAAAGAACCCCTGTAC-A *
13477301-G-T 11321625-G-T *
13448050-C-G 11292374-C-G *
13465990-GC-G 11310314-GC-G *
13465986-C-CAA 11310310-C-CAA *
11307508-A- *
11291456-CATTCCATTCCATTCCATTCCATTCT- *
10920929-A-C *
9943876-C-T 10106267-C-T Y*
7717737-C-CTTCCTTCT,CTTCCTTCT 7849696-C-CTTCCTTCT,CTTCCTTCT 13×TTCT*
13468414-A-T 11312738-A-T *
13462487-C-G 11306811-C-G *
13462481-G-T 11306805-G-T *
13460869-T-A 11305193-T-A *
13448041-ACTC-A 11292365-ACTC-A *
13470566-ATCCG-A 11314890-ATCCG-A *
13448038-TCC-T 11292362-TCC-T *
13448032-ACTCC-A 11292356-ACTCC-A *
13489535-T-A 11333859-T-A *
13478613-A-T 11322937-A-T *
10765743-TCACTGCACTCCACTC- *
3301427-CAAA-C 3433386-CAAA-C 12×A*
13484648-G-C 11328972-G-C *
13476525-T-TTG 11320849-T-TTG *
13474717-C-T 11319041-C-T *
10126556-C- *
26659082-G- *
13465995-T-G 11310319-T-G *
13486096-C-A 11330420-C-A *
28791752-A-ATT 26645605-A-ATT *
13386059-G-GA 11230383-G-GA 10×A*
13464984-G-A 11309308-G-A *
13707693-G-A 11552017-G-A BY156287 *
22479687-CAG-C 20317801-CAG-C DYZ19 *
22479684-C-CAT 20317798-C-CAT DYZ19 *
13721126-C-T 11565450-C-T *
13721109-A-T 11565433-A-T *
13469008-C-T 11313332-C-T *
13464780-C-G 11309104-C-G *
3371923-A-G 3503882-A-G *
13478972-C-CCT 11323296-C-CCT *
13478968-CTT-C 11323292-CTT-C *
26663972-AAGTGGATTGGAGTGGAATGGAGTGCAATGGACTGGAGTGGATTGGAATGGAT- *
13469116-T-C 11313440-T-C *
13469832-G-T 11314156-G-T *
13469814-G-C 11314138-G-C *
13334385-A-G 11178709-A-G *
13748503-G-GAT 11592827-G-GAT *
13748500-ATG-A 11592824-ATG-A *
13484192-A-T 11328516-A-T *
13479124-T-C 11323448-T-C *
13469821-G-C 11314145-G-C *
13433596-AAG-A 11277920-AAG-A *
9963288-T-A,TA 10125679-T-A,TA *
9923953-A-G 10086344-A-G Y*
13487354-G-A 11331678-G-A *
13487749-C-CAA 11332073-C-CAA *
28791754-TGG-T 26645607-TGG-T *
11349373-A- *
13489288-G-C 11333612-G-C *
10803247-A-C *
10803240-A-G *
13722808-G-C 11567132-G-C *
13372575-G-T 11216899-G-T *
13708107-GAA-G 11552431-GAA-G *
13708106-G-GTT 11552430-G-GTT *
13478497-C-A 11322821-C-A *
22475729-A-G 20313843-A-G DYZ19 *
13469944-C-T 11314268-C-T *
13420523-T-C 11264847-T-C *
26060207-AGACTAAAAGAAAAT-A 23914060-AGACTAAAAGAAAAT-A P1_Y1 *
13586374-C-A 11430698-C-A *
13489286-T-G 11333610-T-G *
10803256-C-T *
13489280-C-CTT 11333604-C-CTT *
13488362-C-G 11332686-C-G *
13487602-C-T 11331926-C-T *
13477141-G-T 11321465-G-T *
13477114-G-C 11321438-G-C BY85968 *
13463765-G-GA 11308089-G-GA *
10807614-C-A *
9962564-G-A 10124955-G-A Y*
8740695-G-T 8872654-G-T Y*
22508602-G-GA 20346716-G-GA DYZ19 *
22508601-C-A 20346715-C-A DYZ19 *
22508598-TC-T 20346712-TC-T DYZ19 *
22319066-A-T,T 20157180-A-T,T DYZ19 *
10803255-C-A FT431892 *
13465117-C-A 11309441-C-A *
13497440-G-A 11341764-G-A *
13465160-G-C 11309484-G-C *
13469202-T-A 11313526-T-A *
13465027-A-T 11309351-A-T *
13462475-T-G 11306799-T-G *
11291461-CATTCCATTCCATTCCATTCT- *
22325693-TTCCAGAGTTTGTTCCTTGAGATGTGTCCAGAGTTTCTTCCTTCTGGCAGGCTCATGGTCTTGCTCACTTCAAGAAAGAAGCTGCAGAACTTAGTGGTGAGTTTTGCAGCACTTAAAGGTTTTATG-T 20163807-TTCCAGAGTTTGTTCCTTGAGATGTGTCCAGAGTTTCTTCCTTCTGGCAGGCTCATGGTCTTGCTCACTTCAAGAAAGAAGCTGCAGAACTTAGTGGTGAGTTTTGCAGCACTTAAAGGTTTTATG-T DYZ19 *
13699365-G-C 11543689-G-C *
13478650-C-A 11322974-C-A BY86006 *
13448474-CA-C 11292798-CA-C *
28802990-A-G 26656843-A-G *
22252001-T-A 20090115-T-A DYZ19 *
22252000-G-C 20090114-G-C DYZ19 *
22251989-G-C 20090103-G-C DYZ19 *
13494553-T-A 11338877-T-A *
13469939-G-C 11314263-G-C *
13469208-A-T 11313532-A-T *
13435009-A-G 11279333-A-G *
56699811-CAATGGAATGGAATGGAATGGAATGCAATGGAATGGAATGG-C 4×AATGG*
13477310-G-C 11321634-G-C *
13477306-G-C 11321630-G-C *
13477298-G-T 11321622-G-T *
13477291-C-A 11321615-C-A *
13477286-G-C 11321610-G-C *
13469693-C-A 11314017-C-A *
13479275-C-T 11323599-C-T *
58823336-C-CA 56767533-A-AT **
17835127-G-C 15723247-G-C **
17835167-A-C 15723287-A-C **
14286913-A-C 12166207-A-C **
20569614-C-CAAAAAAAA 18407728-C-CAAAAAAAA P5_Dst 33×A**
15865946-C-CTTTTTTT 13754066-C-CTTTTTTT 37×T**
22504831-G-T 20342945-G-T DYZ19 **
17385421-C-A 15273541-C-A 15×A**
5588617-C-A 5720576-C-A ***
22234912-AC-TG 20073026-AC-TG DYZ19 ***
58841167-T-C 56749704-A-G ***
20541578-T-C 18379692-T-C P5_Dst ***
58870598-CCCA-C 56720269-ATGG-A ***
13140097-CAG-C 10629583-CAG-C ***
58857159-G-C 56733712-C-G ***
22481444-G-T 20319558-G-T DYZ19 ***
20541573-T-C 18379687-T-C P5_Dst ***
22244984-T-G 20083098-T-G DYZ19 ***
20541527-T-A 18379641-T-A P5_Dst ***
20541524-A-G 18379638-A-G P5_Dst ***
20368243-G-C 18206357-G-C P5_Dst ***
20368200-A-T 18206314-A-T P5_Dst ***
20368191-A-T 18206305-A-T P5_Dst ***
20368187-A-C 18206301-A-C P5_Dst ***
20368186-T-G 18206300-T-G P5_Dst ***
20368177-T-C 18206291-T-C P5_Dst ***
13481504-GCAGT-ACAGG 11325828-GCAGT-ACAGG ***
13465489-G-C 11309813-G-C ***
20368174-G-A 18206288-G-A P5_Dst ***
9952688-TC-AT 10115079-TC-AT ***
22273615-A-C 20111729-A-C DYZ19 ***
19025727-CGG-TGT 16913847-CGG-TGT ***
22352888-ACTC-GTTT 20191002-ACTC-GTTT DYZ19 ***
8660569-G-A 8792528-G-A ***
22481323-A-T 20319437-A-T DYZ19 ***
17835121-G-A 15723241-G-A ***
13683026-CAA-TGG 11527350-CAA-TGG ***
22366651-T-G 20204765-T-G DYZ19 ***
22257040-G-GA 20095154-G-GA DYZ19 ***
58823285-CT-TC 56767585-AG-GA ***
22355223-C-T 20193337-C-T DYZ19 ***
22355204-T-G 20193318-T-G DYZ19 ***
22342748-A-C 20180862-A-C DYZ19 ***
58823348-ATTCA-GATCT 56767519-TGAAT-AGATC ***
25323141-T-C 23176994-T-C FGC474 P2_r1 ***
22226736-A-C 20064850-A-C DYZ19 ***
20368175-G-A 18206289-G-A P5_Dst ***
20368169-T-C 18206283-T-C P5_Dst ***
20368170-G-A 18206284-G-A P5_Dst ***
22341240-TAGAGTTTGTTCC-CATTGTGTCCTCG 20179354-TAGAGTTTGTTCC-CATTGTGTCCTCG DYZ19 ***
58877000-A-C 56713871-T-G ***
58865755-C-T 56725116-G-A ***
23192199-G-T 21030313-G-T ***
58840568-T-C 56750303-A-G ***
22342938-G-C 20181052-G-C DYZ19 ***
19937302-G-C 17825422-G-C P5_Prx ***
13740788-G-T 11585112-G-T ***
58840600-C-T 56750271-G-A ***
58908644-T-C 56682227-A-G ***
22366464-C-T 20204578-C-T DYZ19 ***
13734116-G-A 11578440-G-A ***
13734106-G-A 11578430-G-A ***
13460310-T-C 11304634-T-C ***
22234904-C-G 20073018-C-G DYZ19 ***
27791968-T-G 25645821-T-G P1_Y2 ***
22357247-G-A 20195361-G-A DYZ19 ***
58877042-C-T 56713829-G-A ***
58908655-T-C 56682216-A-G ***
22352889-C-T 20191003-C-T DYZ19 ***
22229322-A-AG 20067436-A-AG DYZ19 ***
20368166-C-A 18206280-C-A P5_Dst ***
20368163-T-A 18206277-T-A P5_Dst ***
20368162-A-G 18206276-A-G P5_Dst ***
20368157-C-T 18206271-C-T P5_Dst ***
13108641-T-C 10598127-T-C ***
22344769-T-A 20182883-T-A DYZ19 ***
24388087-T-TAG 22241940-T-TAG ***
58913069-C-A 56677802-G-T ***
58913063-T-C 56677808-A-G ***
58909150-G-C 56681721-C-G ***
58909147-C-T 56681724-G-A ***
28802746-T-A 26656599-T-A ***
22360419-G-A 20198533-G-A DYZ19 ***
14258396-A-T 12137690-A-T ***
13728312-T-A 11572636-T-A ***
9700780-C-CAAA 9863171-C-CAAA FGC5285 IR3_Prx 23×A***
22273631-G-T 20111745-G-T DYZ19 ***
22457243-ACAGCACTTTAAGGTGT-TCAGAAATGAAAGATGC 20295357-ACAGCACTTTAAGGTGT-TCAGAAATGAAAGATGC DYZ19 ***
13223513-G-A 11067837-G-A ***
28491404-C-A 26345257-C-A ***
15885016-A-T 13773136-A-T ***
13473579-C-G 11317903-C-G ***
58884736-T-A 56706135-A-T ***
22234713-T-G 20072827-T-G DYZ19 ***
13579546-AAAAAAAAACAGAAAC-A 11423870-AAAAAAAAACAGAAAC-A ***
13140072-TCGAGTGCGTGTGATTCCATTAAATCA-T 10629558-TCGAGTGCGTGTGATTCCATTAAATCA-T ***
10031876-AGGAC-GGGAG 10194267-AGGAC-GGGAG ***
14613459-CTTTTTTTTTTTTTT-C 12501657-CTTTTTTTTTTTTTT-C 26×T***
22289475-AC-GG 20127589-AC-GG DYZ19 ***
19937304-T-C 17825424-T-C P5_Prx ***
13126006-A-T 10615492-A-T ***
3561528-T-A 3693487-T-A ***
22352624-GCAGA-TTAGT 20190738-GCAGA-TTAGT DYZ19 ***
20541583-T-C 18379697-T-C P5_Dst ***
13503675-ATG-TTA 11347999-ATG-TTA ***
20009310-T-A 17897430-T-A P5_Prx ***
22252895-CCTTA-TCTTC 20091009-CCTTA-TCTTC DYZ19 ***
58844027-T-TTCCATTCCA 56746842-A-AATGGAATGG ***
22263779-GGTGT-AGTGG 20101893-GGTGT-AGTGG DYZ19 ***
58847870-T-C 56743001-A-G ***
22503118-G-T 20341232-G-T DYZ19 ***
2729648-C-CTTTTTT 2861607-C-CTTTTTT 25×T***
21409460-C-CAAAAAAA 19247574-C-CAAAAAAA 30×A***
13142443-GCCAGTC-TG 10631929-GCCAGTC-TG ***
17926560-G-AAA 15814680-G-AAA ***
24485692-G-GTTTTTTTTTTTTTTT 22339545-G-GTTTTTTTTTTTTTTT 13×TTATT***
22289494-CTAACA-GTTCCT 20127608-CTAACA-GTTCCT DYZ19 ***
13292230-C-T 11136554-C-T ***
10083979-T-C 10246370-T-C ***
58844850-T-C 56746021-A-G ***
22273608-G-C 20111722-G-C DYZ19 ***
13373761-C-T 11218085-C-T ***
13319707-C-T 11164031-C-T ***
22703626-GAAAGAAAG-AAAAAAAAA 20541740-GAAAGAAAG-AAAAAAAAA ***
13143949-GA-CC 10633435-GA-CC ***
58872431-C-A 56718440-G-T ***
19646334-T-C 17534454-T-C P5_Prx ***
9559510-G-A 9721901-G-A IR3_Prx ***
14698458-C-CAAAAAAAAAAAAAAAAAA 12586524-C-CAAAAAAAAAAAAAAAAAA 19×A***
3481527-C-A 3613486-C-A FT197615 12×A***
22359782-G-T 20197896-G-T DYZ19 ***
22366624-A-T 20204738-A-T DYZ19 ***
22420627-C-T 20258741-C-T DYZ19 ***
22366619-C-T 20204733-C-T DYZ19 ***
22256924-C-G 20095038-C-G DYZ19 ***
13311487-C-T 11155811-C-T ***
13105430-G-A 10594916-G-A ***
13105460-G-A 10594946-G-A ***
22360649-G-T 20198763-G-T DYZ19 ***
58907255-A-G 56683616-T-C ***
58876988-C-T 56713883-G-A ***
58844856-G-C 56746015-C-G ***
22273627-G-A 20111741-G-A DYZ19 ***
13292702-C-T 11137026-C-T ***
22361163-G-A 20199277-G-A DYZ19 ***
58844633-T-C 56746238-A-G ***
5986600-TTTTTTTT-GTTTTTG 6118559-TTTTTTTT-GTTTTTG ***
20368176-G-A 18206290-G-A P5_Dst ***
22366628-C-G 20204742-C-G DYZ19 ***
58907254-A-C 56683617-T-G ***
4778194-G-A 4910153-G-A ***
22273617-C-G 20111731-C-G DYZ19 ***
13105451-G-A 10594937-G-A ***
13496777-TGAAG-CGAAA 11341101-TGAAG-CGAAA ***
58844826-G-C 56746045-C-G ***
22297389-T-G 20135503-T-G DYZ19 ***
19646345-G-A 17534465-G-A P5_Prx ***
13530684-A-T 11375008-A-T ***
13811109-GAATGGAATGGAATGC-G 11690403-GAATGGAATGGAATGC-G ***
9416727-CTTTG-TTTTT 9579118-CTTTG-TTTTT ***
58882303-G-A 56708568-C-T ***
22367929-C-T 20206043-C-T DYZ19 ***
22360070-T-C 20198184-T-C DYZ19 ***
20542037-C-T 18380151-C-T P5_Dst ***
59007959-C-CAAAAAAAAA 56861812-C-CAAAAAAAAA 26×A***
22273629-C-A 20111743-C-A DYZ19 ***
22366638-A-C 20204752-A-C DYZ19 ***
13463400-T-A 11307724-T-A ***
13463430-C-A 11307754-C-A ***
13728272-C-A 11572596-C-A ***
58907254-AAATTGCA-CGATCT 56683610-TGCAATTT-AGATCG ***
25207665-T-A 23061518-T-A P2_r1 ***
27423350-T-A 25277203-T-A P1_g3 ***
27576029-G-T 25429882-G-T P1_Y2 ***
27462649-C-T 25316502-C-T P1_Y2 ***
27454112-G-A 25307965-G-A P1_Y2 ***
27454109-T-A 25307962-T-A P1_Y2 ***
27438479-A-T 25292332-A-T P1_Y2 ***
27423371-C-A 25277224-C-A P1_g3 ***
27423362-G-A 25277215-G-A P1_g3 ***
27378801-C-A 25232654-C-A P1_g3 ***
27753107-C-T 25606960-C-T P1_Y2 ***
27378791-A-G 25232644-A-G P1_g3 ***
27378788-G-A 25232641-G-A P1_g3 ***
27218673-G-T 25072526-G-T P1_g3 ***
27180129-T-A 25033982-T-A P1_g3 ***
27179401-C-A 25033254-C-A P1_g3 ***
27160370-C-A 25014223-C-A P1_g3 ***
26971176-C-T 24825029-C-T P1_r4 ***
27581322-T-A 25435175-T-A P1_Y2 ***
27753108-C-T 25606961-C-T P1_Y2 ***
26481625-C-T 24335478-C-T P1_Y1 ***
27941925-C-A 25795778-C-A P1_Y2 ***
28435701-C-A 26289554-C-A P1_gr2 ***
28435653-G-C 26289506-G-C P1_gr2 ***
28207523-T-C 26061376-T-C P1_b4 ***
27994724-A-T 25848577-A-T P1_Y2 ***
27994723-C-T 25848576-C-T P1_Y2 ***
27994717-A-T 25848570-A-T P1_Y2 ***
27941926-G-A 25795779-G-A P1_Y2 ***
27941923-G-A 25795776-G-A P1_Y2 ***
27753117-G-A 25606970-G-A P1_Y2 ***
27941919-G-A 25795772-G-A P1_Y2 ***
27900729-G-C 25754582-G-C P1_Y2 ***
27900723-C-T 25754576-C-T P1_Y2 ***
27900716-T-A 25754569-T-A P1_Y2 ***
27782988-C-A 25636841-C-A P1_Y2 ***
27753134-C-T 25606987-C-T P1_Y2 ***
27753130-C-T 25606983-C-T P1_Y2 ***
26481626-C-T 24335479-C-T P1_Y1 ***
26194497-A-T 24048350-A-T P1_Y1 ***
28435726-C-T 26289579-C-T P1_gr2 ***
22503114-T-G 20341228-T-G DYZ19 ***
24381275-A-C 22235128-A-C ***
24305819-A-T 22159672-A-T P3_t1 ***
24193888-A-T 22047741-A-T P3_b1 ***
24193876-G-T 22047729-G-T P3_b1 ***
24193874-A-T 22047727-A-T P3_b1 ***
23121025-G-A 20959139-G-A ***
22534146-T-A 20372260-T-A ***
22503081-T-C 20341195-T-C DYZ19 ***
24581852-C-A 22435705-C-A P3_t2 ***
22500140-G-C 20338254-G-C DYZ19 ***
22500133-T-A 20338247-T-A DYZ19 ***
22499877-G-A 20337991-G-A DYZ19 ***
22435774-T-G 20273888-T-G DYZ19 ***
22366560-C-G 20204674-C-G DYZ19 ***
22359810-G-T 20197924-G-T DYZ19 ***
22357230-A-T 20195344-A-T DYZ19 ***
24422479-A-T 22276332-A-T ***
24581853-T-G 22435706-T-G P3_t2 ***
26194493-G-T 24048346-G-T P1_Y1 ***
25681231-C-A 23535084-C-A P1_b3 ***
26194491-C-T 24048344-C-T P1_Y1 ***
26194487-C-T 24048340-C-T P1_Y1 ***
26156747-G-T 24010600-G-T P1_Y1 ***
26156713-T-G 24010566-T-G P1_Y1 ***
26156709-T-A 24010562-T-A P1_Y1 ***
25850467-T-C 23704320-T-C P1_Y1 ***
25842013-T-A 23695866-T-A P1_b3 ***
25681229-C-A 23535082-C-A P1_b3 ***
24608599-T-A 22462452-T-A P3_t2 ***
25681225-C-A 23535078-C-A P1_b3 ***
25681211-T-A 23535064-T-A P1_b3 ***
25680766-A-T 23534619-A-T P1_b3 ***
25383563-C-A 23237416-C-A P2_r2 ***
25333665-C-T 23187518-C-T P2_r1 ***
25207658-C-A 23061511-C-A P2_r1 ***
24608643-C-A 22462496-C-A P3_t2 ***
24608642-C-A 22462495-C-A P3_t2 ***
28435718-G-A 26289571-G-A P1_gr2 ***
28454320-A-G 26308173-A-G P1_gr2 ***
22352656-G-T 20190770-G-T DYZ19 ***
17030587-TC-T 14918707-TC-T ***
22289441-ACAGACC-GCATAA 20127555-ACAGACC-GCATAA DYZ19 ***
22236716-TAC-CAG 20074830-TAC-CAG DYZ19 ***
19646296-TTGTGC-CTGCTT 17534416-TTGTGC-CTGCTT P5_Prx ***
19510264-C-CTT 17398384-C-CTT 27×T***
19130738-C-TTTT 17018858-C-TTTT 33×T***
17835137-TC-T 15723257-TC-T ***
17332750-C-CCCAAA 15220870-C-CCCAAA 22×A***
13734098-AATG-TATT 11578422-AATG-TATT ***
22289482-TG-GA 20127596-TG-GA DYZ19 ***
13716498-GAATAGAATC-CAGTGGAAGG 11560822-GAATAGAATC-CAGTGGAAGG ***
13559741-ACA-CTC 11404065-ACA-CTC ***
13535164-CATT-AATC 11379488-CATT-AATC ***
13513076-GGT-AGG 11357400-GGT-AGG ***
13488556-GGCGCGTT-AGCGGGTG 11332880-GGCGCGTT-AGCGGGTG ***
13483792-TCCTGAC-CCTTGAG 11328116-TCCTGAC-CCTTGAG ***
13481433-GTGC-TTGT 11325757-GTGC-TTGT ***
22289452-C-CT 20127566-C-CT DYZ19 ***
22297250-TTATGTG-AGATTTC 20135364-TTATGTG-AGATTTC DYZ19 ***
13480876-GGTG-CGTA 11325200-GGTG-CGTA ***
25954079-TTTTTC-ATATTT 23807932-TTTTTC-ATATTT P1_Y1 ***
58974056-C-CATTAA 56827909-C-CATTAA ***
58909104-CA-GC 56681766-TG-GC ***
58828104-AATCCC-A 56762761-AGGGAT-A ***
28802755-CATA-AATG 26656608-CATA-AATG ***
28653220-AGC-CCGATCT 26507073-AGC-CCGATCT ***
27971726-CAAA-C 25825579-CAAA-C P1_Y2 27×A***
27753130-CTTCC-TTTCT 25606983-CTTCC-TTTCT P1_Y2 ***
23192205-TATG-CATA 21030319-TATG-CATA ***
22332781-GG-TT 20170895-GG-TT DYZ19 ***
22802868-A-ATTTTTTTTTTTTTTTTTTTTTTTTTTT 20640982-A-ATTTTTTTTTTTTTTTTTTTTTTTTTTT 32×T***
22768819-CTTTTT-C 20606933-CTTTTT-C 20×T***
22500115-TA-GT 20338229-TA-GT DYZ19 ***
22435752-TAGTGGTGAGTTTT-CTGG 20273866-TAGTGGTGAGTTTT-CTGG DYZ19 ***
22360716-AC-CA 20198830-AC-CA DYZ19 ***
22360028-GAGTTTCTTCC-TTGTGTCCCCT 20198142-GAGTTTCTTCC-TTGTGTCCCCT DYZ19 ***
22352646-CCATCT-TCTTCTG 20190760-CCATCT-TCTTCTG DYZ19 ***
13481390-TGTAAGCAGAGCCTAGAAAAGA-ATAGGTAGATCCAACACAAGG 11325714-TGTAAGCAGAGCCTAGAAAAGA-ATAGGTAGATCCAACACAAGG ***
13473684-CTTA-AGTT 11318008-CTTA-AGTT ***
28491406-C-A 26345259-C-A ***
58844356-C-A 56746515-G-T ***
58883987-A-C 56706884-T-G ***
58883983-G-C 56706888-C-G ***
58883977-C-G 56706894-G-C ***
58883973-T-C 56706898-A-G ***
58883969-A-T 56706902-T-A ***
58883961-T-A 56706910-A-T ***
58847879-C-T 56742992-G-A ***
58833827-C-T 56757044-G-A ***
58890357-A-T 56700514-T-A ***
58819857-A-C 56771014-T-G ***
58819844-T-A 56771027-A-T ***
58819828-T-C 56771043-A-G ***
28818905-A-T 26672758-A-T ***
28804461-G-A 26658314-G-A ***
28491409-G-A 26345262-G-A ***
28491408-T-A 26345261-T-A ***
58884764-C-T 56706107-G-A ***
58909155-C-A 56681716-G-T ***
13467562-GCCT-ACCC 11311886-GCCT-ACCC ***
6720956-GCTCA-ACTCG 6852915-GCTCA-ACTCG ***
13465317-AGAGCT-TGAACC 11309641-AGAGCT-TGAACC ***
13463768-G-GT 11308092-G-GT ***
7984040-TAAAAAAA-T 8115999-TAAAAAAA-T 21×A***
7918033-GT-G 8049992-GT-G ***
7223194-CAAAAA-C 7355153-CAAAAA-C 22×A***
6808134-C-CAA 6940093-C-CAA 22×A***
6786911-ATTTTTT-A 6918870-ATTTTTT-A 17×T***
6147446-ATTTTTT-A 6279405-ATTTTTT-A IR3_Dst 19×T***
58913072-C-T 56677799-G-A ***
5138547-C-CAAA 5270506-C-CAAA 17×A***
2888902-A-AAAAC 3020861-A-AAAAC ***
15750521-C-TT 13638641-C-TT ***
58916253-A-T 56674618-T-A ***
58916245-A-T 56674626-T-A ***
58913114-A-T 56677757-T-A ***
58913103-G-T 56677768-C-A ***
58913100-T-C 56677771-A-G ***
22352881-G-T 20190995-G-T DYZ19 ***
22349319-G-C 20187433-G-C DYZ19 ***
22359793-G-T 20197907-G-T DYZ19 ***
9302727-C-G 9465118-C-G ***
13319725-A-G 11164049-A-G ***
13292640-G-A 11136964-G-A ***
13292617-A-C 11136941-A-C ***
13246543-A-G 11090867-A-G ***
9784671-G-T 9947062-G-T ***
9559509-T-A 9721900-T-A IR3_Prx ***
9529076-A-G 9691467-A-G ***
9216268-A-G 9378659-A-G ***
13340809-A-T 11185133-A-T ***
8007771-C-T 8139730-C-T ***
7536042-C-A 7668001-C-A 28×A***
6699046-G-T 6831005-G-T ***
6493940-T-C 6625899-T-C ***
6392247-T-A 6524206-T-A ***
6328301-A-T 6460260-A-T IR3_Dst ***
6175208-G-A 6307167-G-A IR3_Dst ***
13329321-A-G 11173645-A-G ***
13340813-T-C 11185137-T-C ***
4761062-A-G 4893021-A-G ***
13710273-G-A 11554597-G-A ***
13743193-T-C 11587517-T-C ***
13740747-G-T 11585071-G-T ***
13740726-T-A 11585050-T-A ***
13734626-G-A 11578950-G-A ***
13728302-C-T 11572626-C-T ***
13724949-G-T 11569273-G-T ***
13716487-A-G 11560811-A-G ***
13571913-C-T 11416237-C-T ***
13461638-T-A 11305962-T-A ***
13476360-T-A 11320684-T-A ***
13476008-G-T 11320332-G-T ***
13473632-A-T 11317956-A-T ***
13473585-A-T 11317909-A-T ***
13473574-G-A 11317898-G-A ***
13465643-C-A 11309967-C-A ***
13465618-G-A 11309942-G-A ***
5105922-C-A 5237881-C-A ***
4621674-C-A 4753633-C-A ***
13743208-C-T 11587532-C-T ***
58844837-TTTCA-ATTCC 56746030-TGAAA-GGAAT ***
17385419-TAC-AAA 15273539-TAC-AAA ***
58908615-A-T 56682256-T-A ***
19646319-T-C 17534439-T-C P5_Prx ***
19646313-A-C 17534433-A-C P5_Prx ***
13470764-C-G 11315088-C-G ***
58837356-C-T 56753515-G-A ***
13654575-CTGGA-GTGGC 11498899-CTGGA-GTGGC ***
13140091-TTAAA-T 10629577-TTAAA-T ***
22357781-G-T 20195895-G-T DYZ19 ***
58863124-T-A 56727747-A-T ***
22231934-T-C 20070048-T-C DYZ19 ***
25207667-C-A 23061520-C-A P2_r1 ***
25207659-T-A 23061512-T-A P2_r1 ***
15604354-CAAAAAA-C 13492474-CAAAAAA-C 20×A***
22231941-A-T 20070055-A-T DYZ19 ***
22359820-C-T 20197934-C-T DYZ19 ***
58844632-A-C 56746239-T-G ***
58916506-C-T 56674365-G-A ***
3170617-C-A 3302576-C-A ***
2888701-G-A 3020660-G-A BY21821 ***
58913090-T-A 56677781-A-T ***
13465369-C-A 11309693-C-A ***
13105416-A-T 10594902-A-T ***
13468534-T-A 11312858-T-A ***
18970395-C-T 16858515-C-T ***
13105422-C-T 10594908-C-T ***
13105423-A-T 10594909-A-T ***
13108470-T-C 10597956-T-C ***
13481444-T-A 11325768-T-A ***
7119392-T-C 7251351-T-C ***
22227885-AT-TG 20065999-AT-TG DYZ19 ***
22231933-G-C 20070047-G-C DYZ19 ***
19210050-A-C 17098170-A-C ***
22251718-T-C 20089832-T-C DYZ19 ***
58844829-C-T 56746042-G-A ***
58844821-T-C 56746050-A-G ***
58909468-C-G 56681403-G-C ***
13743206-A-G 11587530-A-G ***
13743213-A-T 11587537-A-T ***
22349315-G-A 20187429-G-A DYZ19 ***
20425390-C-T 18263504-C-T P5_Dst ***
20688303-C-G 18526417-C-G P4_Prx ***
20688288-A-C 18526402-A-C P4_Prx ***
20463401-T-A 18301515-T-A P5_Dst ***
20463394-T-A 18301508-T-A P5_Dst ***
20463386-C-A 18301500-C-A P5_Dst ***
20463385-A-G 18301499-A-G P5_Dst ***
20463384-T-A 18301498-T-A P5_Dst ***
20424976-G-T 18263090-G-T P5_Dst ***
20688378-T-A 18526492-T-A P4_Prx ***
20292345-C-T 18130459-C-T P5_Dst ***
20292342-C-A 18130456-C-A P5_Dst ***
20292341-A-G 18130455-A-G P5_Dst ***
20292340-C-G 18130454-C-G P5_Dst ***
20292339-A-G 18130453-A-G P5_Dst ***
20266149-G-T 18104263-G-T P5_Dst ***
20262941-G-A 18101055-G-A P5_Dst ***
20688305-A-T 18526419-A-T P4_Prx ***
20758518-G-A 18596632-G-A P4_Prx ***
20262905-G-A 18101019-G-A P5_Dst ***
22311366-C-G 20149480-C-G DYZ19 ***
22349244-C-A 20187358-C-A DYZ19 ***
22349222-G-A 20187336-G-A DYZ19 ***
22344693-T-A 20182807-T-A DYZ19 ***
22342824-T-G 20180938-T-G DYZ19 ***
22341502-T-C 20179616-T-C DYZ19 ***
22332782-G-C 20170896-G-C DYZ19 ***
22311396-G-T 20149510-G-T DYZ19 ***
22311343-C-G 20149457-C-G DYZ19 ***
20758521-G-A 18596635-G-A P4_Prx ***
22308320-C-A 20146434-C-A DYZ19 ***
22289458-G-T 20127572-G-T DYZ19 ***
22251744-G-T 20089858-G-T DYZ19 ***
22251719-A-T 20089833-A-T DYZ19 ***
22251716-C-T 20089830-C-T DYZ19 ***
22227089-T-G 20065203-T-G DYZ19 ***
22090494-T-C 19928608-T-C ***
22090428-C-T 19928542-C-T ***
20262923-A-G 18101037-A-G P5_Dst ***
20262894-T-A 18101008-T-A P5_Dst ***
13743218-A-T 11587542-A-T ***
15363916-C-A 13252036-C-A ***
17402473-A-T 15290593-A-T 9×T***
16996715-G-A 14884835-G-A ***
16602714-C-T 14490834-C-T ***
16313417-A-G 14201537-A-G ***
16097369-T-A 13985489-T-A ***
16097364-T-A 13985484-T-A ***
15638673-G-A 13526793-G-A ***
15101883-G-C 12989971-G-C CTS3676 ***
17543757-G-T 15431877-G-T ***
14802974-A-G 12691045-A-G ***
14625850-G-A 12514119-G-A ***
14625848-G-A 12514117-G-A ***
14625824-A-T 12514092-A-T ***
14491217-G-C 12370486-A-C ***
14286910-A-C 12166204-A-C ***
14133646-G-A 12012940-G-A ***
17402481-T-A 15290601-T-A ***
17543778-G-A 15431898-G-A ***
20040615-G-A 17928735-G-A P5_Prx ***
19701407-C-A 17589527-C-A P5_Prx ***
20009309-C-A 17897429-C-A P5_Prx ***
20009290-G-A 17897410-G-A P5_Prx ***
19958079-G-T 17846199-G-T P5_Prx ***
19937307-A-C 17825427-A-C P5_Prx ***
19894071-T-G 17782191-T-G P5_Prx ***
19894062-C-A 17782182-C-A P5_Prx ***
19894006-T-G 17782126-T-G P5_Prx ***
19681992-A-T 17570112-A-T P5_Prx ***
17835064-G-C 15723184-G-C ***
19681970-G-A 17570090-G-A P5_Prx ***
19578967-A-T 17467087-A-T P5_Prx ***
19578953-T-A 17467073-T-A P5_Prx ***
18510981-G-T 16399101-G-T P6_Dst ***
18296389-T-A 16184509-T-A P6_Prx ***
18197648-G-T 16085768-G-T ***
18042682-A-T 15930802-A-T ***
17994954-C-A 15883074-C-A P7_Prx ***
22366762-GTTTCTC-TTTCCTT 20204876-GTTTCTC-TTTCCTT DYZ19 ***

In the table above, the meaning of the confidence field depends on whether the data comes from an FTDNA kit or an FGC kit. For FTDNA kits, + implies a "PASS" result with just one possible variant, * indicates a "PASS" but with multiple variants, ** indicates "REJECTED" with just a single variant, and *** indicates "REJECTED" with multiple possible variants. 'A*' are heterozygous variants not called by FTDNA, but still pulled from the VCF file. For FGC kits, + indicates over 99% likely genuine (95% for INDELs); * over 95% likely genuine (90% for INDELs); ** about 40% likely genuine; *** about 10% likely genuine. Manual entries read directly from a BAM file will be either + indicating positive, or * indicating that the data show a mixture of possible variants.

For the FTDNA kits, the BED data is encoded in the background color of the cells. Those cells with a white background have coverage, those with a grey background indicate no coverage in the BED file, and those with a pink background indicate the mutation is on the edge of a coverage region. These pink regions often indicate that the individual may be positive for a SNP even if there is no corresponding entry in the vcf file.

The combBED column indicates whether or not the mutation is a SNP and falls in the combBED region defined in Defining a New Rate Constant for Y-Chromosome SNPs based on Full Sequencing Data by Dmitry Adamov, Vladimir Guryanov, Sergey Karzhavin, Vladimir Tagankin, Vadim Urasin.

The McDonald BED column indicates whether or not the mutation is a SNP and falls in the BED region used by Dr. Iain McDonald in the age analysis he does for R-U106 men.

Age Analysis Information (work in progress)

AllMcDonaldYFull
Kit: 1ZRQD*16000000100000008300000
Kit: 350431520473097777028111687
Used in age calculations16000000100000008300000
Counts of SNPs937483
Variant counts last updated 2022-06-12 03:33:07.

* BED data not available. Using default values.


Big Tree Main Page