Tree Position

R-P312/S116 > Z40481 > FGC84729 > ZZ37 > ZZ38 > Z39300 > BY15581 > PH611 > Y66340 > Y77705

Unique Mutations

The mutations unique to this man are summarized in the table below. Those with a '+' or '*' confidence level are considered by FamilyTreeDNA or FullGenomesCorp to be high quality SNPs/INDELs. For completeness, all other mutations of lesser confidence are included as well. These additional mutations may be useful for distinguishing between very closely related men.

Occasionally, some of the mutations listed here will be thought to be shared with other men in which case they might appear in upstream blocks on the tree. When this happens, the 'Blocks' field will indicate what block they appear in. Such a situation might arise with BigY men if the BED data suggests another man may be positive for a SNP, even though it doesn't appear in his VCF data. It might also happen if Chromo2 testing or Sanger sequencing of other men not on the tree show the SNP to be shared.

POS-REF-ALT (hg19) POS-REF-ALT (hg38) Blocks Names Region McDonald BED combBED STRKane-BY3
B69927
FTDNA
B69927
BigY3
B69927
18287490-G-A 16175610-G-A P6_Prx ***A*
9205331-C-T 9367722-C-T Y+
22272624-C-T 20110738-C-T DYZ19 +
3544500-G-C 3676459-G-C FT82524 ++
22474801-C-G 20312915-C-G BY223224 DYZ19 ++**
4983890-T-G 5115849-T-G +
5280656-A-C 5412615-A-C FT83039 ++
19063842-C-T 16951962-C-T FT83956 Y++
3403268-A-C 3535227-A-C +
22488497-T-C 20326611-T-C DYZ19 +
3384590-T-C 3516549-T-C +**
22488496-G-T 20326610-G-T DYZ19 +
22272626-A-C 20110740-A-C DYZ19 +
22488509-T-A 20326623-T-A DYZ19 +
16552136-T-C 14440256-T-C Y70110 YY+++
8571269-T-G 8703228-T-G Y64093 YY+++
22272852-G-GAT 20110966-G-GAT DYZ19 +
9596493-ATGTG-A 9758884-ATGTG-A IR3_Prx 12×TG+
22235564-AAAACTTTTAAGTGCTGTAACACTCACCATAAAGGTCTGCAGCTTCATTCTTGAAGTAAGGAAGACCATGAACCTGCCAGAAGGAAGAAATTCTGGAC-A 20073678-AAAACTTTTAAGTGCTGTAACACTCACCATAAAGGTCTGCAGCTTCATTCTTGAAGTAAGGAAGACCATGAACCTGCCAGAAGGAAGAAATTCTGGAC-A DYZ19 +
3384592-T-G 3516551-T-G +**
13489696-C-CA 11334020-C-CA *
13707121-T-G 11551445-T-G *
13489697-GTGCCC-G 11334021-GTGCCC-G *
13489705-A-ACATG 11334029-A-ACATG *
13462115-CCA-C 11306439-CCA-C *
22270016-A-C 20108130-A-C DYZ19 *
13693717-TGGAAC-T 11538041-TGGAAC-T *
13707133-G-C 11551457-G-C *
56871655-A-ATATAT *
13448238-C-CCAAT 11292562-C-CCAAT *
13705480-GGAATGGAATGGAA-G 11549804-GGAATGGAATGGAA-G *
13489675-G-T 11333999-G-T *
56850659-A-AC,C *
13462612-T-C 11306936-T-C *
13470179-A-T 11314503-A-T *
21346061-ATT-A 19184175-ATT-A 12×T*
22490574-A-T 20328688-A-T DYZ19 *
18209106-GTAGATAGA-G,GTAGA 16097226-GTAGATAGA-G,GTAGA 12×TAGA*
15171226-CTTT-C,CTTTT 13059312-CTTT-C,CTTTT 19×T*
3567571-CCTCT-C 3699530-CCTCT-C 10×CT*
13711713-AGAATGGAATGGAATG-A 11556037-AGAATGGAATGGAATG-A BY33655 7×GAATG*
28814925-A-C 26668778-A-C *
9941896-G-GAA 10104287-G-GAA 8×A*
13462607-C-T 11306931-C-T *
28813240-C-G 26667093-C-G *
13694839-C-A 11539163-C-A *
5040891-GAA-G 5172850-GAA-G 10×A*
13351341-G-T 11195665-G-T *
17787106-CAA-C,CA 15675226-CAA-C,CA 19×A*
5035558-TTG-T,TTGTGTG 5167517-TTG-T,TTGTGTG 22×TG*
13692979-GGAATA-G 11537303-GGAATA-G *
14495831-G-GGT,GGTGT 12384028-G-GGT,GGTGT 17×GT*
10934868-CATTGCATTCCATCCCACTCAACTCA-C *
13470178-G-T 11314502-G-T *
56880822-T-A,TTA *
18581956-G-GGATA,GGATA 16470076-G-GGATA,GGATA 10×GATA*
13462250-A-AACGTGTCCCCCTCATCCCTTCCCCATCGCCCCCTTCTTCT 11306574-A-AACGTGTCCCCCTCATCCCTTCCCCATCGCCCCCTTCTTCT *
13476604-A-T 11320928-A-T *
13513926-A-G 11358250-A-G *
13545402-G-GAAAGAAAGAAA 11389726-G-GAAAGAAAGAAA *
13693738-GGAATGGCATA-G 11538062-GGAATGGCATA-G *
13712853-A-G 11557177-A-G *
13728484-G-A 11572808-G-A *
11652799-AGAATG-A,A *
18804474-AAGAGAGAGAG-A,AAGAGAG 16692594-AAGAGAGAGAG-A,AAGAGAG 26×AG*
9211677-A-G 9374068-A-G Y*
21229862-G-GT,GTT 19067976-G-GT,GTT 12×T*
22225198-CGT-C 20063312-CGT-C DYZ19 *
22306889-TGATGTGTCCAGAGTTTCTTCCTTCTGGCAGGTTCATGGTCTTGTTCTCTTCAGGAATGAAGCTGCAGACCTTAGCGGTGAGCGTTACAGCACTTAAAGGTTTTATGTCCAGAGTTGTTCCATC-T 20145003-TGATGTGTCCAGAGTTTCTTCCTTCTGGCAGGTTCATGGTCTTGTTCTCTTCAGGAATGAAGCTGCAGACCTTAGCGGTGAGCGTTACAGCACTTAAAGGTTTTATGTCCAGAGTTGTTCCATC-T DYZ19 *
22508454-T-A 20346568-T-A DYZ19 *
22508504-A-G 20346618-A-G DYZ19 *
22509302-TTGAGTGTTACAGCACTTACAGGTGTTGTGTCCAGAGTTTGTTCCTTCAGATGTGTCTAGAGTTTCTTCCTTCTTTCAGGTTCGTGGTCTTGCTCACTTCCTTAATGAAGCTGCAGACCTTACCGG-T 20347416-TTGAGTGTTACAGCACTTACAGGTGTTGTGTCCAGAGTTTGTTCCTTCAGATGTGTCTAGAGTTTCTTCCTTCTTTCAGGTTCGTGGTCTTGCTCACTTCCTTAATGAAGCTGCAGACCTTACCGG-T DYZ19 *
23672293-T-TGCCCCC,TGCCCCC 21510407-T-TGCCCCC,TGCCCCC *
28819186-G-C 26673039-G-C *
9779028-T-C 9941419-T-C Y*
8739154-A-AAAT,AAATAATAAT 8871113-A-AAAT,AAATAATAAT 13×AAT*
13489750-G-GCCT 11334074-G-GCCT *
28795779-T-A 26649632-T-A *
22235667-TGAAGGAACAAACTCTGGATATAACAAATTTAAGTGCTGTAACACTCACCGTAAATGTCTGCAGC-T 20073781-TGAAGGAACAAACTCTGGATATAACAAATTTAAGTGCTGTAACACTCACCGTAAATGTCTGCAGC-T DYZ19 *
17951299-ATT-A,AT 15839419-ATT-A,AT 25×T*
13476699-C-T 11321023-C-T *
9231698-AACACACACACACAC-A,AACACACACACAC 9394089-AACACACACACACAC-A,AACACACACACAC 22×AC*
13488844-G-GCC,GCT 11333168-G-GCC,GCT *
13489171-C-A 11333495-C-A *
16244792-GGTGT-G,G 14132912-GGTGT-G,G 16×GT*
13692959-G-A 11537283-G-A *
15752638-C-CCTTCTTCTT,CCTTCTTCTTCTT 13640758-C-CCTTCTTCTT,CCTTCTTCTTCTT 25×CTT*
6402943-CGTAAAATACCGACGTATATAGTATAGGTGTCGTGAAATACCGATGTATATATTATATTCCTAGGTGTCGTAAAATAACGTCATATATATTATATTTGTACGTGTT-C 6534902-CGTAAAATACCGACGTATATAGTATAGGTGTCGTGAAATACCGATGTATATATTATATTCCTAGGTGTCGTAAAATAACGTCATATATATTATATTTGTACGTGTT-C *
13718573-C-T 11562897-C-T *
10763233-T-TTTCATTCCACTCCACTCCATTCCACTCCACTCCATTCCATTCCATTCCACTTCATTCCATTCTATTCCATTACATTCCTTTCCAC,TTTCATTCCACTCCACTCCATTCCACTCCACTCCATTCCATTCCATTCCACTTCATTCCATTCTATTCCATTACATTCCTTTCCAC *
13451163-T-TCCTCTGCACTCC 11295487-T-TCCTCTGCACTCC *
13478450-T-A 11322774-T-A *
21361264-TATCCATCC-T,TATCC 19199378-TATCCATCC-T,TATCC 11×ATCC*
4483292-A-AT,ATTT 4615251-A-AT,ATTT 14×T*
5241786-TACACACACACACAC-T,T 5373745-TACACACACACACAC-T,T 16×AC*
6402515-C-T 6534474-C-T *
6402522-T-C 6534481-T-C *
11035773-C-A *
13693685-CCTAGAATGGAATGAA-C 11538009-CCTAGAATGGAATGAA-C *
22279588-G-T 20117702-G-T DYZ19 **
13462592-C-T 11306916-C-T *
13266533-A-C 11110857-A-C *
13484142-C-T 11328466-C-T *
13511115-A-T 11355439-A-T *
13574421-A-G 11418745-A-G *
22490658-A-T 20328772-A-T DYZ19 *
13574443-A-T 11418767-A-T *
22436911-T-C 20275025-T-C DYZ19 *
13745426-G-A 11589750-G-A *
13461117-T-A 11305441-T-A *
13471870-G-A 11316194-G-A *
17109091-AACACAC-A,AACAC 14997211-AACACAC-A,AACAC 25×AC*
13270742-A-G 11115066-A-G *
13362816-T-TAAGTC 11207140-T-TAAGTC *
13722901-T-A 11567225-T-A *
22225182-C-G 20063296-C-G DYZ19 *
14200742-TTAGATAGATAGATAGA-T,TTAGA 12080036-TTAGATAGATAGATAGA-T,TTAGA 15×TAGA*
22359646-G-T 20197760-G-T DYZ19 *
10818732-G-A *
24904490-CAA-C 22758343-CAA-C g1 17×A**
5207432-G-A 5339391-G-A FTB16535 **
25593490-G-T 23447343-G-T P1_gr1 **
23105858-AATAT-A 20943972-AATAT-A **
20489537-T-C 18327651-T-C P5_Dst *****
19326024-A-G 17214144-A-G ****
6446332-T-A 6578291-T-A ****
3635719-C-A 3767678-C-A ****
5207427-C-G 5339386-C-G **
18779-T-A **
3432976-A-AAGG 3564935-A-AAGG **
21276153-T-C 19114267-T-C **
7969889-TG-T 8101848-TG-T ****
10756736-T-C **
26715370-C-T 24569223-C-T P1_g2 **
16168-T-G **
9063398-G-A 9225789-G-A **
22272638-C-T 20110752-C-T DYZ19 **
10077003-T-C 10239394-T-C **
27791831-T-TTTCTTC 25645684-T-TTTCTTC P1_Y2 22×TTC**
13487055-AT-A 11331379-AT-A **
9063385-T-A 9225776-T-A **
6347777-GGAAA-G 6479736-GGAAA-G 9×GAAA**
9063388-C-A 9225779-C-A **
9063404-T-C 9225795-T-C **
56724092-A-G **
9300561-A-G 9462952-A-G **
9063405-G-A 9225796-G-A **
11021450-T-A **
11021449-C-T **
22475011-A-G 20313125-A-G BY223262 DYZ19 **
9916090-C-G 10078481-C-G **
7023492-T-A 7155451-T-A **
8174255-A-G 8306214-A-G **
14302593-A-G 12181887-A-G **
5088451-C-A 5220410-C-A 27×T**
11643718-G-T **
15178406-C-T 13066492-C-T YSC0000175 PF4710 **
22297599-G-T 20135713-G-T DYZ19 **
22272636-T-G 20110750-T-G DYZ19 **
22272632-A-G 20110746-A-G DYZ19 **
22272627-A-C 20110741-A-C DYZ19 **
16401939-C-T 14290059-C-T ***
6017736-T-A 6149695-T-A ***
5814488-G-GAAAA 5946447-G-GAAAA 18×A***
5784371-A-G 5916330-A-G ***
22259287-T-C 20097401-T-C DYZ19 ***
28786357-T-G 26640210-T-G ***
5493896-T-G 5625855-T-G ***
6346217-C-T 6478176-C-T ***
5264161-T-G 5396120-T-G ***
28788012-G-C 26641865-G-C ***
5223046-CATG-C 5355005-CATG-C ***
5007711-A-AT 5139670-A-AT ***
4952087-CT-C 5084046-CT-C ***
4725531-T-A 4857490-T-A ***
4725527-A-T 4857486-A-T ***
28802761-A-G 26656614-A-G ***
4725525-G-T 4857484-G-T ***
6183331-G-A 6315290-G-A BY59410 IR3_Dst ***
22237711-C-G 20075825-C-G DYZ19 ***
9804915-G-A 9967306-G-A ***
22225208-T-G 20063322-T-G BY213086 DYZ19 ***
9410922-T-C 9573313-T-C ***
9363321-G-A 9525712-G-A ***
22225206-A-C 20063320-A-C DYZ19 ***
13255665-C-T 11099989-C-T ***
13255676-C-T 11100000-C-T ***
9180974-G-A 9343365-G-A ***
8776547-CTT-C,CTTT 8908506-CTT-C,CTTT 24×T***
13255687-C-T 11100011-C-T ***
7513147-A-G 7645106-A-G ***
4693190-G-A 4825149-G-A ***
7240444-TCTA-T 7372403-TCTA-T ***
7179734-GTT-G,GTTTT 7311693-GTT-G,GTTTT 25×T***
22237171-G-T 20075285-G-T DYZ19 ***
28802758-A-G 26656611-A-G ***
6776497-CAAAA-C,CAAAAA 6908456-CAAAA-C,CAAAAA 28×A***
22237172-G-T 20075286-G-T DYZ19 ***
6700887-T-C 6832846-T-C ***
13462543-T-C 11306867-T-C ***
13462546-C-CCT 11306870-C-CCT ***
4725518-TC-T 4857477-TC-T ***
13473724-T-A 11318048-T-A ***
4693189-A-G 4825148-A-G ***
13462545-G-A 11306869-G-A ***
56731996-A-AATGGAATGGG ***
13479222-G-T 11323546-G-T ***
5310049-C-T 5442008-C-T ***
13471772-G-T 11316096-G-T ***
13471770-G-A 11316094-G-A ***
22508543-AC-A 20346657-AC-A DYZ19 ***
56850656-G-GT ***
13487910-A-G 11332234-A-G ***
13462541-G-T 11306865-G-T ***
13641547-C-A 11485871-C-A ***
19112200-AAC-A 17000320-AAC-A ***
21729939-TTC-T 19568053-TTC-T ***
22510714-T-A 20348828-T-A DYZ19 ***
56732046-A-T ***
3371923-A-G 3503882-A-G ***
22225210-G-C 20063324-G-C DYZ19 ***
13461996-G-C 11306320-G-C ***
13476736-G-C 11321060-G-C ***
13470156-A-T 11314480-A-T ***
22270035-C-T 20108149-C-T DYZ19 ***
4573079-C-CTT 4705038-C-CTT 9×T***
3130530-CT-C 3262489-CT-C 9×T***
9697146-TTGTGTGTG-T 9859537-TTGTGTGTG-T IR3_Prx 18×TG***
4427213-C-T 4559172-C-T ***
4332094-G-C 4464053-G-C ***
4163023-CTCTCCCTCTCCCTCTCCCTCTCCCTCTCCCTCTCCCCTCTTTCCATGG-C 4294982-CTCTCCCTCTCCCTCTCCCTCTCCCTCTCCCTCTCCCCTCTTTCCATGG-C ***
3965571-T-TA 4097530-T-TA ***
3511864-T-C 3643823-T-C ***
3349229-CA-C,CAA 3481188-CA-C,CAA 22×A***
3132845-C-CA 3264804-C-CA ***
13255692-C-G 11100016-C-G FGC49061 ***
13641531-C-T 11485855-C-T ***
13480941-C-T 11325265-C-T ***
22446012-T-G 20284126-T-G DYZ19 ***
22446004-T-A 20284118-T-A DYZ19 ***
22270440-A-C 20108554-A-C DYZ19 ***
16515611-G-GA 14403731-G-GA 9×A***
9340868-A-T 9503259-A-T ***
13461961-C-G 11306285-C-G ***
13484395-C-T 11328719-C-T ***
9507982-CT-C,CTT 9670373-CT-C,CTT 34×T***
9962555-A-T 10124946-A-T ***
59002708-A-G 56856561-A-G ***
13484396-C-G 11328720-C-G ***
13500085-C-T 11344409-C-T ***
17919880-ACAG-A 15808000-ACAG-A ***
13489861-G-T 11334185-G-T ***
13489388-T-TCACC 11333712-T-TCACC ***
13486047-G-T 11330371-G-T ***
13484411-C-T 11328735-C-T ***
27255138-A-G 25108991-A-G P1_g3 ***
13484401-T-C 11328725-T-C ***
13482107-T-A 11326431-T-A ***
17785271-G-T 15673391-G-T ***
13482060-T-C 11326384-T-C ***
13482038-C-T 11326362-C-T ***
13481010-C-A 11325334-C-A ***
13480978-T-A 11325302-T-A ***
13479527-A-C 11323851-A-C ***
13479170-A-G 11323494-A-G ***
18019832-CTTTTTT-C,CTTTT 15907952-CTTTTTT-C,CTTTT 22×T***
13479165-G-C 11323489-G-C ***
13500130-G-GA 11344454-G-GA ***
17785266-C-T 15673386-C-T ***
13477293-GCAA-G 11321617-GCAA-G ***
17785263-C-G 15673383-C-G ***
15928329-T-A 13816449-T-A ***
15422688-G-A 13310808-G-A ***
15044809-G-A 12932899-G-A ***
15044803-G-A 12932893-G-A ***
17065614-CA-C 14953734-CA-C ***
15007104-T-TAAA 12895189-T-TAAA 11×A***
14682798-A-G 12570864-A-G ***
14677010-A-C 12565076-A-C ***
14163647-G-A 12042941-G-A ***
13688645-GGAATGCAATGCTATTTAATC-G 11532969-GGAATGCAATGCTATTTAATC-G ***
14062010-CAAA-C,CAA 11941304-CAAA-C,CAA 34×A***
7490245-T-C 7622204-T-C FGC28982 Z26350 IR1_L ***
13421593-T-C 11265917-T-C ***
13869654-G-T 11748948-G-T ***
13702091-A-G 11546415-A-G ***
13699390-C-CGATCA 11543714-C-CGATCA ***
13696853-T-TGGAAC 11541177-T-TGGAAC ***
13400069-C-T 11244393-C-T ***
24600395-C-T 22454248-C-T P3_t2 ***
13478515-G-A 11322839-G-A ***
13477207-A-C 11321531-A-C ***
9941159-A-T 10103550-A-T ***
10818751-C-G ***
22510697-A-G 20348811-A-G DYZ19 ***
21354485-T-C 19192599-T-C ***
10921524-T-TCCATCCCATC ***
10921504-T-TTCCATTACATTCTGTCCCATTAGATTCCATTCCATACCACACCACTCCAGTCCACTCCACTCCATTCCATTCCATA ***
21574512-CA-C 19412626-CA-C ***
21795711-G-A 19633825-G-A ***
23070772-C-CTTT 20908886-C-CTTT 29×T***
22751997-AGTGT-A 20590111-AGTGT-A 13×GT***
10776056-A-ATGCCT ***
13223187-A-G 11067511-A-G ***
22225201-A-ACT 20063315-A-ACT DYZ19 ***
10756893-T-A ***
10756863-TCCACTCCACTCCAA-T ***
28802754-GCA-G 26656607-GCA-G ***
10756861-AC-A ***
10654159-T-C ***
10031161-A-G 10193552-A-G ***
15943887-G-A 13832007-G-A ***
10984541-A-ATTTCT ***
13275153-C-CTT 11119477-C-CTT 11×T***
27861040-GTT-G 25714893-GTT-G P1_Y2 17×T***
13448738-C-T 11293062-C-T ***
13472207-C-CCT 11316531-C-CCT ***
13574524-T-C 11418848-T-C ***
13462132-C-T 11306456-C-T ***
13462097-C-T 11306421-C-T ***
13461962-C-G 11306286-C-G ***
13461124-GCCACTATAGGTAGAGCCTAGAAAAGATTTACATGACCTAGGTGATCAGTGCAGAGATACATCGCAATGCCCCTGTAGGCAGGGCCTTGACAAGTGGTATATCACCTGGGTGATCATTGCAGGGATATGTCACAAAGCACCCAGTAGGCAGATCCTAGAGAAGAGTTATATCACCTGGGTGATCAGTGCAGAGATATGTCACAAGC-G 11305448-GCCACTATAGGTAGAGCCTAGAAAAGATTTACATGACCTAGGTGATCAGTGCAGAGATACATCGCAATGCCCCTGTAGGCAGGGCCTTGACAAGTGGTATATCACCTGGGTGATCATTGCAGGGATATGTCACAAAGCACCCAGTAGGCAGATCCTAGAGAAGAGTTATATCACCTGGGTGATCAGTGCAGAGATATGTCACAAGC-G ***
13458665-C-A 11302989-C-A ***
13458660-C-A 11302984-C-A ***
13429472-G-A 11273796-G-A ***
13283899-C-G 11128223-C-G ***
13429119-GTC-G 11273443-GTC-G ***
28802745-ATTCAAATT-A 26656598-ATTCAAATT-A ***
18672418-T-G 16560538-T-G ***
13354858-T-TAA 11199182-T-TAA 14×A***
17387296-A-G,G 15275416-A-G,G ***
13699369-T-A 11543693-T-A ***
13348698-CT-C 11193022-CT-C ***
20006096-A-G 17894216-A-G P5_Prx ***
21197990-C-T 19036104-C-T ***
22510668-A-T 20348782-A-T DYZ19 ***
5933233-CAAAA-C 6065192-CAAAA-C 18×A***
13482039-C-T 11326363-C-T ***
13590554-C-T 11434878-C-T ***
13257291-T-A 11101615-T-A ***
20816924-CA-C,CAAA 18655038-CA-C,CAAA P4_Gap 22×A***
16938218-CT-C,CTT 14826338-CT-C,CTT 19×T***
22484060-T-G 20322174-T-G DYZ19 ***
13378637-T-C 11222961-T-C ***
13590560-G-A 11434884-G-A ***
13518365-C-T 11362689-C-T ***
5371726-CGT-C 5503685-CGT-C 10×GT***
28585761-G-A 26439614-G-A ***
13590517-G-T 11434841-G-T ***
13478526-G-T 11322850-G-T ***
13508326-A-AGC 11352650-A-AGC ***
13484940-C-T 11329264-C-T ***
13484895-C-G 11329219-C-G ***
13484205-C-T 11328529-C-T ***
13446264-C-T 11290588-C-T ***
13436739-G-C 11281063-G-C ***
3403261-CAAAAAA-C,CAA 3535220-CAAAAAA-C,CAA 30×A***
22164376-CAAA-C,CAA 20002490-CAAA-C,CAA 22×A***
19121920-CT-C,CTT 17010040-CT-C,CTT 17×T***
9327732-T-TTG 9490123-T-TTG 12×TG***
13477196-C-A 11321520-C-A ***
13478527-G-T 11322851-G-T ***
13463917-GAA-G 11308241-GAA-G ***
7240460-T-A 7372419-T-A ***
13241551-C-T 11085875-C-T ***
2861534-CAA-C,CA 2993493-CAA-C,CA 25×A***
6040928-CAA-C 6172887-CAA-C 12×A***
18712393-T-A 16600513-T-A ***
13349771-G-A 11194095-G-A ***
13351353-A-G 11195677-A-G ***
22489902-T-C 20328016-T-C DYZ19 ***
13345169-T-G 11189493-T-G ***
5756916-G-GTA 5888875-G-GTA 8×TA***
7240453-T-A 7372412-T-A ***
13353684-A-G 11198008-A-G ***
5683719-T-C 5815678-T-C ***
8020221-CAA-C,CA 8152180-CAA-C,CA 22×A***
13475405-G-A 11319729-G-A ***
10802091-C-A ***
10802080-C-G ***
9995896-T-A 10158287-T-A ***
13628212-G-A 11472536-G-A ***
13401309-A-C 11245633-A-C ***
13463307-T-C 11307631-T-C ***
56697160-C-T ***
13463922-C-CTT 11308246-C-CTT ***
11021436-C-A ***
24107663-CA-C 21961516-CA-C P3_b1 18×A***
3529572-CTTT-C 3661531-CTTT-C 13×T***
13723047-C-G 11567371-C-G ***
13718094-G-A 11562418-G-A ***
13705675-C-A 11549999-C-A ***
4765550-A-AT 4897509-A-AT 10×T***
13484907-C-A 11329231-C-A ***
22940686-G-GT 20778800-G-GT 10×T***
4067508-CTTT-C 4199467-CTTT-C 29×T***
2827909-CTTTT-C 2959868-CTTTT-C 17×T***
4049605-CTT-C 4181564-CTT-C 11×T***
5035863-G-GA 5167822-G-GA 9×A***
13489738-C-A 11334062-C-A ***
13254032-T-G 11098356-T-G ***
10893614-C-A ***
56862005-G-C ***
19183516-A-ATT 17071636-A-ATT 13×T***
13465985-A-C 11310309-A-C ***
58848176-A-C 56742695-T-G ***
4869617-CT-C 5001576-CT-C 10×T***
13473745-G-A 11318069-G-A ***
13464432-C-T 11308756-C-T ***
15677933-CA-C,CAA 13566053-CA-C,CAA 21×A***
56685665-C-G ***
3466432-AT-A 3598391-AT-A 10×T***
10946624-C-T ***
10776039-C-CAACG ***
22138066-C-CTT 19976180-C-CTT 13×T***
19187385-A-ATT 17075505-A-ATT 28×T***
13472203-CAG-C 11316527-CAG-C ***
13469136-G-A 11313460-G-A ***
18908014-ACG-A 16796134-ACG-A ***
13461069-G-T 11305393-G-T ***
13357129-G-A 11201453-G-A ***
13448744-C-T 11293068-C-T ***
8073153-A-G 8205112-A-G ***
17528877-CA-C,CAA 15416997-CA-C,CAA 12×A***
10776038-T-TG ***
13461104-G-T 11305428-G-T ***
22936288-CTT-C,CT 20774402-CTT-C,CT 25×T***
22490512-G-C 20328626-G-C DYZ19 ***
11021434-C-T ***
14552175-T-TAA 12440376-T-TAA 13×A***
8658407-C-A 8790366-C-A ***
13484949-C-G 11329273-C-G ***
13488813-C-A 11333137-C-A ***
13468048-T-C 11312372-T-C ***
9973280-G-GT 10135671-G-GT 9×T***
22191400-T-TA 20029514-T-TA 9×A***
13583552-T-C 11427876-T-C ***
13347447-C-T 11191771-C-T ***
28793913-G-C 26647766-G-C ***
13479083-C-T 11323407-C-T ***
22235734-CATTCTTGAAGCTAGCAAGACCATGAACCTGCCAGAAGGAAGAAACTCTGGACACATCTGAAGGAACAAACTCTGGACATAATACCTTTA-C 20073848-CATTCTTGAAGCTAGCAAGACCATGAACCTGCCAGAAGGAAGAAACTCTGGACACATCTGAAGGAACAAACTCTGGACATAATACCTTTA-C DYZ19 ***
27482837-ATT-A 25336690-ATT-A P1_Y2 16×T***
58848153-T-C 56742718-A-G ***
13484908-T-A 11329232-T-A ***
13469061-C-T 11313385-C-T ***
13487927-G-A 11332251-G-A ***
22868596-C-CAA 20706710-C-CAA 10×A***
16598677-GAAAA-G 14486797-GAAAA-G 19×A***
17592345-CT-C,CTT 15480465-CT-C,CTT 24×T***
22270475-G-T 20108589-G-T DYZ19 ***
13460590-G-A 11304914-G-A ***
13471557-TCA-T 11315881-TCA-T ***
13699376-G-T 11543700-G-T ***
13699374-T-C 11543698-T-C ***
13473742-C-T 11318066-C-T ***
13473730-C-T 11318054-C-T ***
13464507-T-C 11308831-T-C ***
10965253-G-C ***
10965251-T-C ***
9946276-G-C 10108667-G-C ***
13436740-TTA-T 11281064-TTA-T ***
22238377-ACC-A 20076491-ACC-A DYZ19 ***
13462029-C-A 11306353-C-A ***
13474747-A-G 11319071-A-G ***
13420097-A-G 11264421-A-G ***
56879097-A-C ***
56879095-A-G ***
13442672-G-A 11286996-G-A FT443698 ***
19609552-G-GA 17497672-G-GA P5_Prx 9×A***
8470549-C-CAAA 8602508-C-CAAA 22×A***
13461943-C-T 11306267-C-T ***
13435739-T-A 11280063-T-A ***
13479218-C-T 11323542-C-T ***
13479136-T-G 11323460-T-G ***
13489872-G-C 11334196-G-C ***
22232203-C-T 20070317-C-T DYZ19 ***
13476456-T-C 11320780-T-C ***
13470152-TCC-T 11314476-TCC-T ***
8888375-C-CTT 9020334-C-CTT 25×T***
13489384-G-T 11333708-G-T ***
13469157-ACATCACCTGGGTGATCAGTGCAGAGATATGTCACAATGCCTCCATAGGCAAATCCAAGTTGAGATTCTGTCACCTGTGTGATCAGTGCAGACATATGTGACCATGCCCCCAGTAGGCAGAGCCTAGAGAATAGTCC-A 11313481-ACATCACCTGGGTGATCAGTGCAGAGATATGTCACAATGCCTCCATAGGCAAATCCAAGTTGAGATTCTGTCACCTGTGTGATCAGTGCAGACATATGTGACCATGCCCCCAGTAGGCAGAGCCTAGAGAATAGTCC-A ***
13485517-T-A 11329841-T-A ***
13483899-A-G 11328223-A-G ***
22503071-A-G 20341185-A-G DYZ19 ***
13476682-C-G 11321006-C-G ***
13476623-T-A 11320947-T-A ***
4005057-GTT-G 4137016-GTT-G 13×T***
9933036-C-T 10095427-C-T ***
13618705-T-TA 11463029-T-TA 10×A***
9804888-A-C 9967279-A-C ***
13461916-C-T 11306240-C-T ***
5493431-CTTTT-C,CTTT 5625390-CTTTT-C,CTTT 24×T***
6043970-CTTTT-C,CTTT 6175929-CTTTT-C,CTTT 22×T***
13482083-T-A 11326407-T-A ***
13476656-G-C 11320980-G-C ***
13462563-G-T 11306887-G-T ***
13470444-TCTGC-T 11314768-TCTGC-T ***
13390134-C-T 11234458-C-T ***
9804999-A-T 9967390-A-T ***
13590531-GT-G 11434855-GT-G ***
7139391-A-AAT 7271350-A-AAT ***
9805004-T-A 9967395-T-A ***
19529423-T-C 17417543-T-C ******
19529387-A-G 17417507-A-G ******
18712392-T-A 16600512-T-A ***
17064808-T-G 14952928-T-G ******
5895055-T-C 6027014-T-C ******
22436921-G-T 20275035-G-T FT364042 DYZ19 ***
4555435-T-A 4687394-T-A ******
3460735-T-C 3592694-T-C ******
13480847-C-G 11325171-C-G ***
2729648-CTTTTT-C,CTTT 2861607-CTTTTT-C,CTTT 25×T***
13486017-A-G 11330341-A-G ***
13723015-C-T 11567339-C-T ***
9941579-G-A 10103970-G-A ***
6273852-CCACA-C 6405811-CCACA-C IR3_Dst 12×CA***
13489224-G-T 11333548-G-T ***
22244110-A-C 20082224-A-C DYZ19 ***
11021429-C-CATTCTGT ***
11021427-C-CATT ***
22269010-T-A 20107124-T-A DYZ19 ***
22306888-G-T 20145002-G-T DYZ19 ***
22306889-T-A 20145003-T-A DYZ19 ***
22455981-C-A 20294095-C-A DYZ19 ***
25220278-G-C 23074131-G-C P2_r1 ***
9941576-A-T 10103967-A-T ***
13691419-T-A 11535743-T-A BY88676 ***
15468678-CA-C,CAA 13356798-CA-C,CAA 23×A***
22446008-A-G 20284122-A-G DYZ19 ***
13466545-C-T 11310869-C-T ***
8377909-TACACACACAC-T 8509868-TACACACACAC-T 16×AC***
13484960-C-T 11329284-C-T ***
13476589-A-G 11320913-A-G ***
13474463-G-A 11318787-G-A ***
13474453-T-A 11318777-T-A ***
58884154-A-G 56706717-T-C ***
13729029-G-C 11573353-G-C ***
22512604-G-A 20350718-G-A DYZ19 ***

In the table above, the meaning of the confidence field depends on whether the data comes from an FTDNA kit or an FGC kit. For FTDNA kits, + implies a "PASS" result with just one possible variant, * indicates a "PASS" but with multiple variants, ** indicates "REJECTED" with just a single variant, and *** indicates "REJECTED" with multiple possible variants. 'A*' are heterozygous variants not called by FTDNA, but still pulled from the VCF file. For FGC kits, + indicates over 99% likely genuine (95% for INDELs); * over 95% likely genuine (90% for INDELs); ** about 40% likely genuine; *** about 10% likely genuine. Manual entries read directly from a BAM file will be either + indicating positive, or * indicating that the data show a mixture of possible variants.

For the FTDNA kits, the BED data is encoded in the background color of the cells. Those cells with a white background have coverage, those with a grey background indicate no coverage in the BED file, and those with a pink background indicate the mutation is on the edge of a coverage region. These pink regions often indicate that the individual may be positive for a SNP even if there is no corresponding entry in the vcf file.

The combBED column indicates whether or not the mutation is a SNP and falls in the combBED region defined in Defining a New Rate Constant for Y-Chromosome SNPs based on Full Sequencing Data by Dmitry Adamov, Vladimir Guryanov, Sergey Karzhavin, Vladimir Tagankin, Vadim Urasin.

The McDonald BED column indicates whether or not the mutation is a SNP and falls in the BED region used by Dr. Iain McDonald in the age analysis he does for R-U106 men.

Age Analysis Information (work in progress)

AllMcDonaldYFull
Kit: B699271071495077648837838437
Kit: B699271496970293723498309113
Kit: B699271556822893513298269997
Used in age calculations1496970293723498309113
Counts of SNPs62
Variant counts last updated 2022-06-15 02:41:00.



Big Tree Main Page