Tree Position

R-P312/S116 > Z290 > L21/S145 > S552 > DF13 > DF21/S192 > FGC3213 > ZZ1 > S3058 > S424 > S426 > S190 > FGC3215 > Z36747 > Y16487 > Y16486 > Y16490

Unique Mutations

The mutations unique to this man are summarized in the table below. Those with a '+' or '*' confidence level are considered by FamilyTreeDNA or FullGenomesCorp to be high quality SNPs/INDELs. For completeness, all other mutations of lesser confidence are included as well. These additional mutations may be useful for distinguishing between very closely related men.

Occasionally, some of the mutations listed here will be thought to be shared with other men in which case they might appear in upstream blocks on the tree. When this happens, the 'Blocks' field will indicate what block they appear in. Such a situation might arise with BigY men if the BED data suggests another man may be positive for a SNP, even though it doesn't appear in his VCF data. It might also happen if Chromo2 testing or Sanger sequencing of other men not on the tree show the SNP to be shared.

POS-REF-ALT (hg19) POS-REF-ALT (hg38) Blocks Names Region McDonald BED combBED STRFB38
446784-A
BigY3
446784
FTDNA
446784
BigY2
446784
23884158-T-C 21722272-T-C Y+A++A+
19785343-C-CA 17673463-C-CA P5_Prx 26×AA*
13470535-G-C 11314859-G-C A*
13723147-G-A 11567471-G-A BY211373 A*
10922290-C-T A*
20306056-C-A 18144170-C-A P5_Dst A*
21691491-T-TA 19529605-T-TA 9×AA*
19754846-C-A 17642966-C-A P5_Prx A*
22509944-T-G 20348058-T-G DYZ19 A*
19963184-C-A 17851304-C-A P5_Prx A*
20369909-G-GA 18208023-G-GA P5_Dst 9×AA*
18014284-T-C 15902404-T-C P7_Dst YA*
18318511-C-A 16206631-C-A P6_Prx A*
18323194-T-C 16211314-T-C P6_Prx A*
18336159-G-A 16224279-G-A P6_Prx A*
18471862-C-CCT 16359982-C-CCT P6_Dst A*
18480086-C-A 16368206-C-A P6_Dst A*
19589943-C-A 17478063-C-A P5_Prx YA*
19619329-A-G 17507449-A-G P5_Prx YA*
19636286-G-T 17524406-G-T P5_Prx A*
19646363-C-A 17534483-C-A P5_Prx A*
19647864-G-T 17535984-G-T P5_Prx A*
19675043-C-A 17563163-C-A P5_Prx A*
19675767-C-A 17563887-C-A P5_Prx A*
19676114-T-C 17564234-T-C P5_Prx A*
19678760-G-T 17566880-G-T P5_Prx A*
19681076-G-T 17569196-G-T P5_Prx A*
19692866-C-A 17580986-C-A P5_Prx A*
19693448-C-A 17581568-C-A P5_Prx A*
19710965-G-T 17599085-G-T P5_Prx A*
19731667-C-A 17619787-C-A P5_Prx A*
19747285-G-T 17635405-G-T P5_Prx A*
19754847-T-C 17642967-T-C P5_Prx A*
19770311-C-A 17658431-C-A P5_Prx A*
19791196-C-A 17679316-C-A P5_Prx A*
19950186-G-A 17838306-G-A P5_Prx A*
19995475-C-A 17883595-C-A P5_Prx A*
20007842-C-T 17895962-C-T P5_Prx A*
20101326-G-T 17989446-G-T P5_Dst A*
20305384-T-C 18143498-T-C P5_Dst A*
20330300-G-T 18168414-G-T P5_Dst A*
20362032-T-A 18200146-T-A P5_Dst A*
20461758-G-T 18299872-G-T P5_Dst A*
20467556-G-T 18305670-G-T P5_Dst A*
20562646-G-T 18400760-G-T P5_Dst A*
20704324-C-A 18542438-C-A P4_Prx A*
20720533-C-A 18558647-C-A P4_Prx A*
20755929-C-A 18594043-C-A P4_Prx A*
20882264-T-C 18720378-T-C P4_Dst A*
20947055-A-G 18785169-A-G P4_Dst A*
20983878-T-G 18821992-T-G P4_Dst A*
13448110-C-G 11292434-C-G A*
13372133-G-A 11216457-G-A +
16916501-A-G 14804621-A-G Y70728 YY++++
16175087-T-C 14063207-T-C Y69385 Y++**
8094386-GTA-G 8226345-GTA-G +**
5135676-G-C 5267635-G-C FT83004 ++
13489569-G-A 11333893-G-A *
13267843-CC-AT 11112167-CC-AT *
24812125-C-A 22665978-C-A P3_b2 ****
56843711-G-T **
3046934-G-A 3178893-G-A *
10807293-TTCAACCAGAA-GTCACACATAC *
10893930-TCTCTCCATTCCATTCCATTCTC-CCATTCCATTCCA *
10965565-ATTCCATTCCATTCCATTCCATTCCATTCCATTCCA-AATCCATTGCTTTCCATTCCATTCCATTCCATTCCATTAGATTCCA,TTTCCATTTCATTCCATTCTATTCCATTCCATTCCG *
13447942-GTTCT-ATTCC,GTTCC 11292266-GTTCT-ATTCC,GTTCC *
13448498-CCAG-ACAC 11292822-CCAG-ACAC *
13449067-GCACTT-C,GCACTC 11293391-GCACTT-C,GCACTC *
13449331-CTTCCATTCCATTCCA-ATTACATTCCATTCGT 11293655-CTTCCATTCCATTCCA-ATTACATTCCATTCGT *
13450310-ATTGCATTTA-ATTGCATTTC,TTTCCATTTC 11294634-ATTGCATTTA-ATTGCATTTC,TTTCCATTTC *
13450609-CATTCCA-CATTCTT,TA 11294933-CATTCCA-CATTCTT,TA *
13488561-GTT-ATG,GTG 11332885-GTT-ATG,GTG *
17275757-AA-AAAAGGG,GG 15163877-AA-AAAAGGG,GG *
56824026-TAA-T,TT 11×A*
56827533-TTTCCATTCCATTCCTTTCCAT-AT,ATTCCATTCCATGCGAG *
56829990-CTCCAG-ATCCAT *
56830541-GCTGAATTCCATTGC-ATTGA *
56835364-TCCACTCCACTCCAGTACATTCCA-ACCACTCCACTCCAGTACGTTCCC *
56836980-CC-GT *
20089273-CTGA-GTGC 17977393-CTGA-GTGC P5_Dst *
22236219-CAA-AAA,AAG 20074333-CAA-AAA,AAG DYZ19 *
22483883-GTTCGTGG-GTTCATGG,TTTCATGC 20321997-GTTCGTGG-GTTCATGG,TTTCATGC DYZ19 *
22483940-AA-AG,GG 20322054-AA-AG,GG DYZ19 *
22509918-GCCTT-ACCTC,ACCTT 20348032-GCCTT-ACCTC,ACCTT DYZ19 *
22509940-TACTT-CACTG,CACTT 20348054-TACTT-CACTG,CACTT DYZ19 *
25662111-TA-T,TAA 23515964-TA-T,TAA P1_b3 14×A*
25378987-C-CT 23232840-C-CT P2_r2 26×T**
7947069-C-T 8079028-C-T **
13723588-C-A 11567912-C-A **
13489712-C-G 11334036-C-G **
58980735-C-T 56834588-C-T **
20137624-T-C 18025744-T-C FGC38849 P5_Dst **
13489799-C-A 11334123-C-A F10866 **
25944990-G-T 23798843-G-T P1_Y1 **
21575408-ATT-A 19413522-ATT-A 8×T**
6954762-C-A 7086721-C-A **
14454319-C-A 12333592-C-A **
14324894-C-CT 12204188-C-CT 26×T**
13484329-G-A 11328653-G-A **
13710860-A-T 11555184-A-T **
10764580-CA-C **
22203972-C-A 20042086-C-A **
2738999-G-A 2870958-G-A **
2788766-C-CT 2920725-C-CT 8×T**
3610763-G-T 3742722-G-T **
3659007-G-T 3790966-G-T **
3691948-G-T 3823907-G-T **
3847950-G-T 3979909-G-T **
3923340-G-T 4055299-G-T **
4052828-G-T 4184787-G-T **
4121286-C-A 4253245-C-A **
4239885-G-T 4371844-G-T **
4344265-C-A 4476224-C-A **
4345811-C-A 4477770-C-A **
4452081-G-T 4584040-G-T **
4807567-C-A 4939526-C-A FT156036 **
5277804-G-T 5409763-G-T **
5288792-C-A 5420751-C-A **
5348637-G-T 5480596-G-T **
5558673-G-A 5690632-G-A **
5708500-A-G 5840459-A-G **
5944440-CTTT-C 6076399-CTTT-C **
5956264-G-T 6088223-G-T **
6038786-G-T 6170745-G-T **
6082398-C-A 6214357-C-A **
6488594-G-T 6620553-G-T **
6510730-T-A 6642689-T-A **
6643803-C-A 6775762-C-A **
6671462-A-T 6803421-A-T **
6967957-A-C 7099916-A-C **
6973710-C-A 7105669-C-A **
6979544-CT-C 7111503-CT-C 9×T**
7135165-A-G 7267124-A-G **
7164625-A-T 7296584-A-T **
7249019-C-A 7380978-C-A **
7338817-C-A 7470776-C-A **
7400352-C-A 7532311-C-A Y62005 **
7416500-C-A 7548459-C-A **
7753268-G-T 7885227-G-T **
8180940-A-G 8312899-A-G **
8221281-C-A 8353240-C-A **
8367861-C-A 8499820-C-A **
8605388-C-A 8737347-C-A **
8681427-TCCTCA-T 8813386-TCCTCA-T **
8735064-C-A 8867023-C-A **
8806799-C-A 8938758-C-A **
8866049-G-T 8998008-G-T **
9647491-C-A 9809882-C-A IR3_Prx **
10025003-C-A 10187394-C-A **
10660270-T-G **
10660284-A-T **
10660293-C-CATTACTGATG **
10669619-G-A **
10685736-C-A FT148754FT202876 **
10750888-C-A **
10760401-A-C **
10764562-T-TTCTAC **
10764598-T-A **
10769960-G-A **
10774082-T-A **
10788061-C-A **
10820890-T-A **
10824118-A-T **
10824119-A-C **
10824123-A-T **
10834180-C-T **
10834217-A-T **
10834222-A-C **
10842176-T-C **
10858472-C-T **
10858482-C-G **
10866050-T-C **
10866053-A-T **
10866061-C-G **
10889273-C-T **
10889284-A-AG **
10925561-C-G **
10944843-G-T **
10951083-T-C **
10951091-T-A **
10958379-C-T **
10968298-C-A **
10971932-C-T **
10993183-C-A **
11005460-C-A **
13324319-C-A 11168643-C-A **
13402565-C-T 11246889-C-T **
13448891-CTCCAG-C 11293215-CTCCAG-C **
13448913-C-A 11293237-C-A **
13461140-C-T 11305464-C-T **
13475207-A-G 11319531-A-G **
13477050-C-A 11321374-C-A **
13485648-A-T 11329972-A-T **
13485702-C-T 11330026-C-T **
13485712-G-T 11330036-G-T **
13486845-C-A 11331169-C-A **
13847099-G-T 11726393-G-T **
14102204-C-A 11981498-C-A **
14258838-A-G 12138132-A-G **
14350303-C-A 12229598-C-A **
14425996-A-G 12305271-A-G **
14543936-C-A 12432137-C-A **
14578589-C-A 12466789-C-A **
14686097-C-T 12574163-C-T **
14743725-A-G 12631794-A-G **
14850655-T-C 12738721-T-C **
14949188-G-A 12837262-G-A **
15200256-C-A 13088342-C-A **
15421226-C-T 13309346-C-T FGC23853 **
15451145-C-A 13339265-C-A **
15816688-C-A 13704808-C-A **
16061106-C-A 13949226-C-A **
16316940-CA-C 14205060-CA-C 9×A**
16480640-C-A 14368760-C-A **
16534496-C-A 14422616-C-A **
16861826-C-A 14749946-C-A **
17568211-C-A 15456331-C-A **
17682468-G-T 15570588-G-T **
17860062-CA-C 15748182-CA-C **
18151905-T-C 16040025-T-C **
18384189-C-A 16272309-C-A P6_Gap **
18526783-T-C 16414903-T-C P6_Dst **
18646001-A-T 16534121-A-T **
18886848-C-A 16774968-C-A **
18900993-C-A 16789113-C-A **
18986012-G-A 16874132-G-A **
18986034-CAAGA-C 16874154-CAAGA-C **
19331331-C-A 17219451-C-A **
19353775-G-T 17241895-G-T **
19485206-C-A 17373326-C-A **
19528215-C-A 17416335-C-A **
20810776-C-A 18648890-C-A P4_Gap **
21103079-G-A 18941193-G-A **
21103092-C-A 18941206-C-A **
21453269-C-A 19291383-C-A **
21815044-C-A 19653158-C-A Z40058 **
22691130-G-T 20529244-G-T **
22897965-C-A 20736079-C-A **
23074746-C-A 20912860-C-A **
24013847-CTATATATATATATATATA-C 21867700-CTATATATATATATATATA-C 21×TA**
24465997-C-A 22319850-C-A **
24874958-C-A 22728811-C-A g1 **
24878717-AC-A 22732570-AC-A g1 **
26062918-A-T 23916771-A-T P1_Y1 **
27468074-A-G 25321927-A-G P1_Y2 **
27477669-A-AAT 25331522-A-AAT P1_Y2 **
28111781-C-A 25965634-C-A P1_Y2 **
28240207-C-T 26094060-C-T P1_b4 **
28630389-C-A 26484242-C-A **
28773865-G-A 26627718-G-A **
56826218-C-A **
56826262-C-A **
56828799-C-A **
56828801-T-G **
56834573-C-CACCCG **
28808603-T-A 26662456-T-A **
13716565-T-C 11560889-T-C **
28808648-T-C 26662501-T-C **
14418201-GTGTA-G 12297476-GTGTA-G *****
20927074-C-T 18765188-C-T P4_Dst **
24278023-ATT-A 22131876-ATT-A P3_b1 16×T**
27575352-C-CA 25429205-C-CA P1_Y2 13×A**
4057972-T-C 4189931-T-C **
4983745-A-G 5115704-A-G **
6305394-A-G 6437353-A-G IR3_Dst **
9544150-T-TGA 9706541-T-TGA IR3_Prx **
10069809-T-C 10232200-T-C ****
13279227-T-C 11123551-T-C **
15477438-T-C 13365558-T-C *****
16064606-C-T 13952726-C-T ****
17639461-AG-A 15527581-AG-A ****
20426054-C-CAAA 18264168-C-CAAA P5_Dst 26×A**
21671729-T-C 19509843-T-C *****
23049133-TG-T 20887247-TG-T *****
6114516-C-A 6246475-C-A **
6116128-G-T 6248087-G-T **
6116345-C-A 6248304-C-A **
6116493-G-T 6248452-G-T **
10654383-CTTCCA-ATTCCT **
13716531-GGAATGAAATGT-TGG 11560855-GGAATGAAATGT-TGG **
13723580-T-C 11567904-T-C **
13728404-G-T 11572728-G-T **
13730456-G-T 11574780-G-T **
17126655-C-G 15014775-C-G **
17270042-T-C 15158162-T-C **
21149580-AGGT-TGG 18987694-AGGT-TGG **
28350365-T-C 26204218-T-C P1_gr2 **
19839616-GAA-G 17727736-GAA-G P5_Prx 26×A**
9586856-C-A 9749247-C-A IR3_Prx **
9613546-G-A 9775937-G-A IR3_Prx **
9712628-C-T 9875019-C-T IR3_Prx **
9718525-T-A 9880916-T-A IR3_Prx **
9720008-G-A 9882399-G-A IR3_Prx **
9720018-G-A 9882409-G-A IR3_Prx **
19102543-C-T 16990663-C-T **
19611206-CTTTT-C 17499326-CTTTT-C P5_Prx 26×T**
19727458-TAAATTAAGTTC-AAATTAATTTA 17615578-TAAATTAAGTTC-AAATTAATTTA P5_Prx **
20117131-TACA-CACAT 18005251-TACA-CACAT P5_Dst **
20297077-G-T 18135191-G-T P5_Dst **
20857625-G-T 18695739-G-T P4_Dst **
22322329-A-G 20160443-A-G DYZ19 **
22322345-CC-AA 20160459-CC-AA DYZ19 **
22322354-GTGTCCAGAG-TTCTCCTGAC 20160468-GTGTCCAGAG-TTCTCCTGAC DYZ19 **
22322425-T-C 20160539-T-C DYZ19 **
22322432-C-T 20160546-C-T DYZ19 **
21785346-T-C **
24768028-A-G 22621881-A-G P3_b2 **
25323006-GAACACTT-TAAAAC 23176859-GAACACTT-TAAAAC P2_r1 **
25795389-C-T 23649242-C-T P1_b3 **
27082186-CA-C 24936039-CA-C P1_r4 25×A**
27460607-ATT-A 25314460-ATT-A P1_Y2 15×T**
27466092-C-CT 25319945-C-CT P1_Y2 9×T**
27598008-A-C 25451861-A-C P1_Y2 **
27631681-T-C 25485534-T-C P1_Y2 **
27638147-GC-CCA 25492000-GC-CCA P1_Y2 **
27648148-T-C 25502001-T-C P1_Y2 **
27854679-A-G 25708532-A-G P1_Y2 **
27884340-G-A 25738193-G-A P1_Y2 **
28378692-G-T 26232545-G-T P1_gr2 **
28404314-AT-A 26258167-AT-A P1_gr2 9×T**
22505865-A-T 20343979-A-T DYZ19 ***
20214463-C-CA 18052577-C-CA P5_Dst 10×A***
58978769-G-A 56832622-G-A ***
13142945-G-T 10632431-G-T ***
13652226-TG-T 11496550-TG-T ***
24906869-C-CT 22760722-C-CT g1 16×T***
22453559-C-T 20291673-C-T DYZ19 ***
13720858-G-T 11565182-G-T ***
27793236-CA-C 25647089-CA-C P1_Y2 10×A***
22463897-G-A 20302011-G-A DYZ19 ***
9535155-AT-A 9697546-AT-A IR3_Prx 17×T***
25452458-GT-G 23306311-GT-G P2_r2 13×T***
20081036-G-A 17969156-G-A P5_Dst ***
22459671-T-A 20297785-T-A DYZ19 ***
24924132-C-CT 22777985-C-CT g1 11×T***
22442873-T-G 20280987-T-G DYZ19 ***
13833715-T-A 11713009-T-A ***
13309130-T-C 11153454-T-C ***
22509279-G-C 20347393-G-C FGC73124 DYZ19 ***
27343263-A-G 25197116-A-G P1_g3 ***
22229253-C-A 20067367-C-A DYZ19 ***
4023652-T-C 4155611-T-C ***
22443905-G-T 20282019-G-T FT456734 DYZ19 ***
22479373-G-T 20317487-G-T DYZ19 ***
58998189-T-C 56852042-T-C ***
13253393-TCGG-CCAGTTTTT 11097717-TCGG-CCAGTTTTT ***
13472543-G-A 11316867-G-A ***
21402181-C-CTTT 19240295-C-CTTT 34×T***
13652187-C-A 11496511-C-A BY34707 ***
13479343-C-A 11323667-C-A ***
13810621-AAGGAATG-A 11689915-AAGGAATG-A ***
17841338-CA-C 15729458-CA-C ***
58978771-G-A 56832624-G-A ***
22282060-T-C 20120174-T-C DYZ19 ***
13924970-CAAAA-C 11804264-CAAAA-C 20×A******
22508901-C-A 20347015-C-A DYZ19 ***
22508246-T-C 20346360-T-C DYZ19 ***
7002995-GAGGGTCC-CAGTGTCT 7134954-GAGGGTCC-CAGTGTCT ***
22769283-CTT-C 20607397-CTT-C 14×T***
22254702-C-T 20092816-C-T A17908 DYZ19 ***
28347411-G-A 26201264-G-A P1_gr2 ***
13992191-CA-C,CAA 11871485-CA-C,CAA 22×A***
10845696-C-T ***
16175037-CTTT-C,CTT 14063157-CTTT-C,CTT 14×T***
15352141-TAA-T,TA 13240260-TAA-T,TA 13×A***
2742833-C-A 2874792-C-A ***
3606072-C-A 3738031-C-A ***
4241501-C-A 4373460-C-A ***
4804807-T-C 4936766-T-C ***
5861140-A-G 5993099-A-G ***
5957152-G-A 6089111-G-A ***
6644597-CTTTT-C,CT 6776556-CTTTT-C,CT 15×T***
6663174-C-A 6795133-C-A ***
7079363-C-A 7211322-C-A ***
7152435-C-A 7284394-C-A ***
7201630-CT-C,CTT 7333589-CT-C,CTT 11×T***
7225235-C-A 7357194-C-A ***
7258559-C-A 7390518-C-A FTA400 ***
7266453-C-A 7398412-C-A ***
7288334-T-C 7420293-T-C ***
7387139-C-A 7519098-C-A ***
7535830-T-G 7667789-T-G Y35194 ***
7629091-C-A 7761050-C-A ***
7694963-C-A 7826922-C-A ***
7916812-G-GT 8048771-G-GT 8×T***
8014899-G-T 8146858-G-T ***
8203970-C-A 8335929-C-A Y86091 ***
8315056-TG-T 8447015-TG-T ***
8392070-C-T 8524029-C-T ***
8423802-C-A 8555761-C-A ***
8439220-GTTTT-G,GTTTTT 8571179-GTTTT-G,GTTTTT 14×T***
8522921-T-C 8654880-T-C ***
8587647-C-A 8719606-C-A ***
8738754-C-A 8870713-C-A ***
8778993-T-A 8910952-T-A ***
8787735-C-A 8919694-C-A ***
8840852-T-C 8972811-T-C ***
8853075-C-A 8985034-C-A ***
8866118-G-T 8998077-G-T ***
9025639-C-A 9188030-C-A ***
9029854-G-T 9192245-G-T ***
9074234-C-A 9236625-C-A ***
9474713-G-T 9637104-G-T ***
10008116-C-A 10170507-C-A ***
10037461-C-A 10199852-C-A ***
10794733-A-T ***
10861191-C-A ***
10866024-T-C ***
10892522-C-T ***
10965560-A-ATTCCAATCCATTGCT ***
13319529-CT-C 11163853-CT-C ***
13448877-T-A 11293201-T-A ***
13456179-C-A 11300503-C-A ***
13457746-C-T 11302070-C-T ***
13473639-C-A 11317963-C-A ***
13474342-C-A 11318666-C-A ***
13491319-GTAAAAGAC-G 11335643-GTAAAAGAC-G ***
13605208-G-A 11449532-G-A ***
13643101-A-G 11487425-A-G ***
13867791-G-T 11747085-G-T ***
13940857-AAG-A,AAGAG 11820151-AAG-A,AAGAG 18×AG***
14004449-A-T 11883743-A-T ***
14037032-C-A 11916326-C-A ***
14073570-C-A 11952864-C-A ***
14103328-CTAGCTATGGTAG-C 11982622-CTAGCTATGGTAG-C ***
14139472-C-A 12018766-C-A ***
14141209-A-G 12020503-A-G ***
14310178-C-A 12189472-C-A ***
14313431-ACTG-A 12192725-ACTG-A ***
14377471-T-C 12256767-T-C ***
14396997-C-A 12276293-C-A ***
14481380-C-A 12360649-C-A ***
14537056-C-A 12425257-C-A ***
14556891-TA-T 12445092-TA-T 8×A***
14593197-C-A 12481397-C-A ***
14780818-C-A 12668888-C-A ***
14927712-ATGTT-A 12815777-ATGTT-A ***
14938080-C-A 12826155-C-A ***
14985257-C-A 12873325-C-A ***
15012296-CTTTTT-C 12900384-CTTTTT-C 17×T***
15055571-C-A 12943663-C-A ***
15094363-TC-T 12982451-TC-T ***
15208277-A-G 13096363-A-G ***
15271978-C-A 13160067-C-A ***
15457832-C-A 13345952-C-A ***
15498810-A-T 13386930-A-T ***
15499613-C-A 13387733-C-A ***
15786169-AT-A 13674289-AT-A ***
15799377-CTCTC-C,CTCTG 13687497-CTCTC-C,CTCTG ***
15864754-C-A 13752874-C-A ***
15906526-C-A 13794646-C-A ***
15940302-G-C 13828422-G-C ***
15975189-GA-G 13863309-GA-G ***
16050571-C-A 13938691-C-A ***
16344414-TTCA-T,TTCTTCA 14232534-TTCA-T,TTCTTCA ***
16370809-C-A 14258929-C-A ***
16508370-C-A 14396490-C-A ***
16552783-C-A 14440903-C-A ***
16724450-A-G 14612570-A-G ***
17109028-C-A 14997148-C-A ***
17142312-C-A 15030432-C-A ***
17166847-C-A 15054967-C-A ***
17175205-T-C 15063325-T-C ***
17191328-C-T 15079448-C-T ***
17344657-C-A 15232777-C-A ***
17369565-A-G 15257685-A-G ***
17374710-C-A 15262830-C-A ***
17466329-C-A 15354449-C-A ***
17496365-C-A 15384485-C-A ***
17631221-G-A 15519341-G-A ***
17685929-C-A 15574049-C-A ***
17840839-C-A 15728959-C-A FT353043 ***
17957403-C-A 15845523-C-A ***
18125048-C-A 16013168-C-A ***
18129212-C-A 16017332-C-A ***
18186108-G-T 16074228-G-T ***
18203332-C-A 16091452-C-A ***
18558281-T-A 16446401-T-A ***
18820596-C-A 16708716-C-A ***
18883915-C-A 16772035-C-A ***
18939837-C-A 16827957-C-A ***
18972979-T-C 16861099-T-C ***
19009677-G-A 16897797-G-A ***
19012442-C-A 16900562-C-A ***
19091406-G-GTT 16979526-G-GTT 14×T***
19417268-C-A 17305388-C-A ***
19448062-C-T 17336182-C-T ***
20810696-CTTT-C,CTT 18648810-CTTT-C,CTT P4_Gap 16×T***
21117396-C-A 18955510-C-A ***
21226300-CTTTT-C 19064414-CTTTT-C 13×T***
21228916-C-A 19067030-C-A ***
21306033-C-A 19144147-C-A ***
21340490-C-A 19178604-C-A ***
21521610-C-A 19359724-C-A ***
21566882-C-T 19404996-C-T ***
21927299-C-A 19765413-C-A ***
21973978-C-A 19812092-C-A ***
22060776-C-T 19898890-C-T ***
22068846-CA-C 19906960-CA-C ***
22202703-A-G 20040817-A-G ***
22479378-G-A 20317492-G-A BY31314 DYZ19 ***
22803889-C-A 20642003-C-A ***
22974120-AAAAAAAAAAAAAAAAAAAAATTTAAAAAGTT-A 20812234-AAAAAAAAAAAAAAAAAAAAATTTAAAAAGTT-A ***
23122167-C-A 20960281-C-A ***
23139631-A-T 20977745-A-T ***
23166373-C-A 21004487-C-A ***
23190687-C-A 21028801-C-A ***
23255096-C-A 21093210-C-A ***
23411923-C-A 21250037-C-A ***
23428705-C-A 21266819-C-A ***
23609633-C-A 21447747-C-A ***
23628664-TC-T 21466778-TC-T ***
23821908-C-A 21660022-C-A ***
23985625-G-A 21839478-G-A ***
24071396-G-T 21925249-G-T P3_b1 ***
24433419-G-T 22287272-G-T ***
24465528-AT-A 22319381-AT-A ***
28481090-C-A 26334943-C-A ***
28758929-C-A 26612782-C-A ***
28768918-C-A 26622771-C-A ***
56763536-G-A ***
56833502-CCACTA-T ***
13941693-A-ATT 11820987-A-ATT 15×T***
25466566-A-T 23320419-A-T P2_r2 ***
23831278-TG-G,T 21669392-TG-G,T ***
27456888-CT-C 25310741-CT-C P1_Y2 11×T***
13718250-G-A 11562574-G-A ***
13811184-G-C 11690478-G-C ***
15566817-G-T 13454937-G-T 22×A***
23886722-AT-A 21724836-AT-A 13×T***
13218966-CAAA-C,CAA 11063290-CAAA-C,CAA 21×A***
13323494-CAA-C,CA 11167818-CAA-C,CA 24×A***
22510490-G-T 20348604-G-T DYZ19 ***
20391463-AT-A 18229577-AT-A P5_Dst 10×T***
4799565-A-C 4931524-A-C FGC47851 ***
9652380-G-T 9814771-G-T IR3_Prx ***
17951299-ATTT-A,ATT 15839419-ATTT-A,ATT 25×T***
20548684-C-G 18386798-C-G P5_Dst ***
27412358-G-GA 25266211-G-GA P1_g3 10×A***
56830290-TTCCACTCCACTCCATTCCATG-CT ***
13453204-C-A,G 11297528-C-A,G ***
25251571-G-A 23105424-G-A P2_r1 ***
20478953-C-CAA 18317067-C-CAA P5_Dst 15×A***
6447774-GTTT-G 6579733-GTTT-G 16×T***
14266305-GTATATA-G,GTATA 12145599-GTATATA-G,GTATA 14×TA***
27626573-C-A 25480426-C-A P1_Y2 ***
27082231-A-T 24936084-A-T P1_r4 ***
20329753-A-G 18167867-A-G P5_Dst ***
5945467-CTTTT-C,CTTT 6077426-CTTTT-C,CTTT 25×T***
7501531-A-T 7633490-A-T IR1_L ***
9120876-ATTTT-A,ATTTTT ***
13453203-T-G 11297527-T-G ***
13468371-G-A 11312695-G-A ***
16997010-T-C 14885130-T-C ******
22419689-G-A 20257803-G-A DYZ19 ***
22461094-A-T 20299208-A-T DYZ19 ***
28631173-T-C 26485026-T-C ***
22486908-A-G 20325022-A-G DYZ19 ***
28421647-C-CA 26275500-C-CA P1_gr2 15×A***
8125051-AGAAGAGAAGAG-GAGAAGAG,GAGAAGAGAGAGA 8257010-AGAAGAGAAGAG-GAGAAGAG,GAGAAGAGAGAGA ***
8631383-CTTTT-C,CTT 8763342-CTTTT-C,CTT 26×T***
9125447-CTTT-C,CTT ***
9966033-AG-CA 10128424-AG-CA ***
10070233-GTTCCAAA-TTTTCCAC 10232624-GTTCCAAA-TTTTCCAC ***
10657322-TTCCAT-CACCAC ***
10989139-TTCCATTCCACTCC-CTCCATTCCTCTCA ***
13446532-TTCCATTCCAT-C,CTCCATTCCAT 11290856-TTCCATTCCAT-C,CTCCATTCCAT ***
13472222-CCC-ACA 11316546-CCC-ACA ***
13489012-ATGCCCCT-GCCCCCCC 11333336-ATGCCCCT-GCCCCCCC ***
13489291-CA-AG 11333615-CA-AG ***
13618772-C-CA 11463096-C-CA 9×A***
13700955-A-T 11545279-A-T ***
13930171-CAAAA-C,CAA 11809465-CAAAA-C,CAA 21×A***
14569832-A-T 12458032-A-T ***
12555882-CAA-C,CAAAA 24×A***
15422096-ACCA-GCC 13310216-ACCA-GCC ***
17592345-CTT-C,CT 15480465-CTT-C,CT 24×T***
17702070-G-A 15590190-G-A ***
18094044-A-G 15982164-A-G ***
19412006-G-A,GAGAA 17300126-G-A,GAGAA 14×AGAA***
21922080-CA-C,CAA 19760194-CA-C,CAA 23×A***
56828843-CG-CA,TG ***
56829269-CATTCG-TGTTCA ***
56865860-G-T ***
22236188-TAACA-AAACT 20074302-TAACA-AAACT DYZ19 ***
26523585-CAA-C 24377438-CAA-C P1_Y1 20×A***
24295863-CTT-C 22149716-CTT-C P3_t1 17×T***
27508007-C-G 25361860-C-G P1_Y2 ***
27555807-G-C 25409660-G-C P1_Y2 ***
25650160-TTTTTG-T 23504013-TTTTTG-T P1_b3 4×TTTTG***
7027457-C-T 7159416-C-T ***
6147446-ATT-A,AT 6279405-ATT-A,AT IR3_Dst 19×T***
6603381-CTTTC-A 6735340-CTTTC-A ***
7002943-TGAT-CGAC 7134902-TGAT-CGAC ***
7002980-CCTG-ACTA 7134939-CCTG-ACTA ***
7489650-G-C 7621609-G-C IR1_L ***
9526671-G-A 9689062-G-A ***
9531123-G-T 9693514-G-T IR3_Prx ***
9589216-A-G 9751607-A-G IR3_Prx ***
9658281-C-T 9820672-C-T IR3_Prx ***
9665388-C-T 9827779-C-T IR3_Prx ***
9705609-T-C 9868000-T-C IR3_Prx ***
9707226-T-C 9869617-T-C IR3_Prx ***
16146477-AGAAAAGAAAGAAAG-AGA,GAAAAGAAAGAAAGAAAG 14034597-AGAAAAGAAAGAAAG-AGA,GAAAAGAAAGAAAGAAAG P8_Dst ***
18016120-A-G 15904240-A-G P7_Dst ***
18434245-A-G 16322365-A-G P6_Dst ***
18484584-C-T 16372704-C-T P6_Dst ***
18486064-A-G 16374184-A-G P6_Dst ***
18487640-CAAA-C,CAAAA 16375760-CAAA-C,CAAAA P6_Dst 16×A***
18499698-G-T 16387818-G-T P6_Dst ***
20098724-G-A 17986844-G-A P5_Dst ***
20099307-C-T 17987427-C-T P5_Dst ***
20204128-A-G 18042242-A-G P5_Dst ***
20207190-A-G 18045304-A-G P5_Dst ***
20212580-T-C 18050694-T-C P5_Dst ***
20212586-T-C 18050700-T-C P5_Dst ***
20215192-A-G 18053306-A-G P5_Dst ***
20234124-C-G 18072238-C-G P5_Dst ***
20242479-TGG-T,TG 18080593-TGG-T,TG P5_Dst 12×G***
20252796-C-A,AA 18090910-C-A,AA P5_Dst 24×A***
20341218-C-A 18179332-C-A P5_Dst ***
20372425-C-T 18210539-C-T P5_Dst ***
20388628-G-A 18226742-G-A P5_Dst ***
20414280-T-C 18252394-T-C P5_Dst ***
20422783-G-T 18260897-G-T P5_Dst ***
20443708-A-G 18281822-A-G P5_Dst ***
20491552-T-C 18329666-T-C P5_Dst ***
20499229-A-G 18337343-A-G P5_Dst ***
20500271-T-C 18338385-T-C P5_Dst ***
20532920-C-T 18371034-C-T P5_Dst ***
20548646-C-A 18386760-C-A P5_Dst ***
20570846-A-G 18408960-A-G P5_Dst ***
20592471-G-A 18430585-G-A P5_Dst ***
20601313-A-G 18439427-A-G P5_Dst ***
20607647-A-G 18445761-A-G P5_Dst ***
20851428-G-A 18689542-G-A P4_Dst ***
20871078-T-C 18709192-T-C P4_Dst ***
20893027-G-T 18731141-G-T P4_Dst ***
20917950-C-T 18756064-C-T P4_Dst ***
20955268-T-C 18793382-T-C P4_Dst ***
20989290-T-A 18827404-T-A P4_Dst ***
20992631-A-G 18830745-A-G P4_Dst ***
21004464-A-T 18842578-A-T P4_Dst ***
21014369-T-C 18852483-T-C P4_Dst ***
21580017-C-A 19418131-C-A ***
22254515-ATGA-GTGT 20092629-ATGA-GTGT DYZ19 ***
22358007-TTTG-CTTT 20196121-TTTG-CTTT DYZ19 ***
22435670-TTTG-ATTT 20273784-TTTG-ATTT DYZ19 ***
22458066-T-C 20296180-T-C DYZ19 ***
22459589-CTGCAGAA-GTGCAGAC 20297703-CTGCAGAA-GTGCAGAC DYZ19 ***
22483378-G-A 20321492-G-A DYZ19 ***
22483410-GAAA-TAAG 20321524-GAAA-TAAG DYZ19 ***
22483439-CA-AG 20321553-CA-AG DYZ19 ***
22483865-G-A 20321979-G-A DYZ19 ***
22484074-AGT-TGG 20322188-AGT-TGG DYZ19 ***
22486818-A-T 20324932-A-T DYZ19 ***
22486826-G-T 20324940-G-T DYZ19 ***
22489597-C-T 20327711-C-T DYZ19 ***
22502841-CTTC-GTTT 20340955-CTTC-GTTT DYZ19 ***
21758050-C-A ***
24017706-A-G 21871559-A-G ***
24232093-CAAA-C 22085946-CAAA-C P3_b1 21×A***
24524736-T-C 22378589-T-C P3_t2 ***
24542894-T-C 22396747-T-C P3_t2 ***
24589977-A-T 22443830-A-T P3_t2 ***
24639039-T-C 22492892-T-C P3_t2 ***
24640289-A-G 22494142-A-G P3_t2 ***
24677689-G-A 22531542-G-A P3_b2 ***
24690810-C-T 22544663-C-T P3_b2 ***
24720283-A-G 22574136-A-G P3_b2 ***
24724477-T-C 22578330-T-C P3_b2 ***
25442674-T-C 23296527-T-C P2_r2 ***
25479907-T-C 23333760-T-C P2_r2 ***
25498601-C-T 23352454-C-T P2_r2 ***
25652289-T-C 23506142-T-C P1_b3 ***
25676356-G-T 23530209-G-T P1_b3 ***
26305700-CAA-C 24159553-CAA-C P1_Y1 23×A***
26424314-CAA-AAAA,C 24278167-CAA-AAAA,C P1_Y1 23×A***
27005464-T-A 24859317-T-A P1_r4 ***
27095931-CAA-C,CA 24949784-CAA-C,CA P1_r4 27×A***
27136143-A-G 24989996-A-G P1_g3 ***
27138219-A-G 24992072-A-G P1_g3 ***
27162883-A-G 25016736-A-G P1_g3 ***
27184751-T-C 25038604-T-C P1_g3 ***
27299297-A-G 25153150-A-G P1_g3 ***
27429794-G-A 25283647-G-A P1_g3 ***
27454760-CTTTTT-C 25308613-CTTTTT-C P1_Y2 23×T***
27471637-TCTCT-CCTCG 25325490-TCTCT-CCTCG P1_Y2 ***
27526285-T-A 25380138-T-A P1_Y2 ***
27617120-A-G 25470973-A-G P1_Y2 ***
27617143-G-A 25470996-G-A P1_Y2 ***
27634122-CAC-CAT,TAT 25487975-CAC-CAT,TAT P1_Y2 ***
27655386-T-C 25509239-T-C P1_Y2 ***
27662498-C-T 25516351-C-T P1_Y2 ***
27670079-A-T 25523932-A-T P1_Y2 ***
27672539-C-G 25526392-C-G P1_Y2 ***
27675882-T-G 25529735-T-G P1_Y2 ***
27713087-C-A 25566940-C-A P1_Y2 ***
27718284-G-A 25572137-G-A P1_Y2 ***
27725554-T-C 25579407-T-C P1_Y2 ***
27734719-A-G 25588572-A-G P1_Y2 ***
27735146-A-T 25588999-A-T P1_Y2 ***
27737095-G-A 25590948-G-A P1_Y2 ***
27764153-A-G 25618006-A-G P1_Y2 ***
27826039-C-T 25679892-C-T P1_Y2 ***
27826052-CCTC-TCTT 25679905-CCTC-TCTT P1_Y2 ***
27836258-T-A 25690111-T-A P1_Y2 ***
27852917-A-G 25706770-A-G P1_Y2 ***
27853693-C-A 25707546-C-A P1_Y2 ***
27874921-T-C 25728774-T-C P1_Y2 ***
27880775-T-C 25734628-T-C P1_Y2 ***
27881475-CTT-C,CT 25735328-CTT-C,CT P1_Y2 12×T***
27951087-A-G 25804940-A-G P1_Y2 ***
27954791-T-G 25808644-T-G P1_Y2 ***
27973451-T-C 25827304-T-C P1_Y2 ***
28007928-G-T 25861781-G-T P1_Y2 ***
28020487-G-T 25874340-G-T P1_Y2 ***
28029381-T-C 25883234-T-C P1_Y2 ***
28044861-A-G 25898714-A-G P1_Y2 ***
28047190-T-C 25901043-T-C P1_Y2 ***
28065192-A-G 25919045-A-G P1_Y2 ***
28065198-G-A 25919051-G-A P1_Y2 ***
28074951-T-C 25928804-T-C P1_Y2 ***
28091952-A-G 25945805-A-G P1_Y2 ***
28226105-G-A 26079958-G-A P1_b4 ***
28232850-A-G 26086703-A-G P1_b4 ***
28359975-G-C 26213828-G-C P1_gr2 ***
28367658-G-A 26221511-G-A P1_gr2 ***
28425335-A-G 26279188-A-G P1_gr2 ***
28442556-CAA-C,CA 26296409-CAA-C,CA P1_gr2 16×A***
28443325-C-A 26297178-C-A P1_gr2 ***
28446130-A-G 26299983-A-G P1_gr2 ***
28449163-A-AT 26303016-A-AT P1_gr2 12×T***

In the table above, the meaning of the confidence field depends on whether the data comes from an FTDNA kit or an FGC kit. For FTDNA kits, + implies a "PASS" result with just one possible variant, * indicates a "PASS" but with multiple variants, ** indicates "REJECTED" with just a single variant, and *** indicates "REJECTED" with multiple possible variants. 'A*' are heterozygous variants not called by FTDNA, but still pulled from the VCF file. For FGC kits, + indicates over 99% likely genuine (95% for INDELs); * over 95% likely genuine (90% for INDELs); ** about 40% likely genuine; *** about 10% likely genuine. Manual entries read directly from a BAM file will be either + indicating positive, or * indicating that the data show a mixture of possible variants.

For the FTDNA kits, the BED data is encoded in the background color of the cells. Those cells with a white background have coverage, those with a grey background indicate no coverage in the BED file, and those with a pink background indicate the mutation is on the edge of a coverage region. These pink regions often indicate that the individual may be positive for a SNP even if there is no corresponding entry in the vcf file.

The combBED column indicates whether or not the mutation is a SNP and falls in the combBED region defined in Defining a New Rate Constant for Y-Chromosome SNPs based on Full Sequencing Data by Dmitry Adamov, Vladimir Guryanov, Sergey Karzhavin, Vladimir Tagankin, Vadim Urasin.

The McDonald BED column indicates whether or not the mutation is a SNP and falls in the BED region used by Dr. Iain McDonald in the age analysis he does for R-U106 men.