Tree Position

R-P312/S116 > Z290 > L21/S145 > S552 > DF13 > DF21/S192 > S5488 > FGC11358 > Z17568 > L1336 > FGC11336 > FGC11312

Unique Mutations

The mutations unique to this man are summarized in the table below. Those with a '+' or '*' confidence level are considered by FamilyTreeDNA or FullGenomesCorp to be high quality SNPs/INDELs. For completeness, all other mutations of lesser confidence are included as well. These additional mutations may be useful for distinguishing between very closely related men.

Occasionally, some of the mutations listed here will be thought to be shared with other men in which case they might appear in upstream blocks on the tree. When this happens, the 'Blocks' field will indicate what block they appear in. Such a situation might arise with BigY men if the BED data suggests another man may be positive for a SNP, even though it doesn't appear in his VCF data. It might also happen if Chromo2 testing or Sanger sequencing of other men not on the tree show the SNP to be shared.

POS-REF-ALT (hg19) POS-REF-ALT (hg38) Blocks Names Region McDonald BED combBED STRFGC2
B3BNQ
FGC
11R9D
13127400-C-T 10616886-C-T FGC11325 ++
13921727-A-G 11801021-A-G FGC11326 YY++
14112840-G-A 11992134-G-A FGC11328 Y+*
15369202-C-T 13257322-C-T FGC11332 Y++
15731087-C-A 13619207-C-A FGC11335 Y+*
16528185-A-C 14416305-A-C FGC82879 YY+**
21824415-G-A 19662529-G-A FGC11354 Y++
10986652-A-ACTG +
13713704-ATGAAGTCCAACCAAATTGAATTAAATGGAT-A 11558028-ATGAAGTCCAACCAAATTGAATTAAATGGAT-A *
58974216-A-AATTCCTATCC 56828069-A-AATTCCTATCC *
28808252-C-T 26662105-C-T ZS4484 *
13827168-G-T 11706462-G-T *
58853552-GCATTC-G 56737289-AAATGG-A 5×CATTC*
10025156-C-A 10187547-C-A Y*
28808302-GTGGAT-G 26662155-GTGGAT-G *
9965063-T-TAGG 10127454-T-TAGG *
28817910-C-T 26671763-C-T *
13707163-T-C,G 11551487-T-C,G *
58995123-A-G 56848976-A-G *
59013620-A-G 56867473-A-G *
13266346-C-G 11110670-C-G *
13287959-T-A 11132283-T-A *
13445083-A-G 11289407-A-G *
13445111-T-A 11289435-T-A *
13518424-G-C 11362748-G-C *
13591179-A-T 11435503-A-T *
58979103-T-TTCCAC,TTCCATTCCAC 56832956-T-TTCCAC,TTCCATTCCAC *
13557477-A-G 11401801-A-G *
13690143-C-G 11534467-C-G *
28807171-A-G 26661024-A-G *
58975100-T-G 56828953-T-G 4×CATTC*
59002284-C-T 56856137-C-T *
59022839-G-T 56876692-G-T *
28793913-G-C 26647766-G-C *
58980830-C-T 56834683-C-T *
13711248-T-A 11555572-T-A *
13868959-C-T 11748253-C-T 4×GAATG*
28817647-AGGAATGGAATGGAATGGAATGGAAT-A,AGGAATGGAATGGAATGGAAT 26671500-AGGAATGGAATGGAATGGAATGGAAT-A,AGGAATGGAATGGAATGGAAT 9×GGAAT*
9916031-T-G 10078422-T-G Y*
59024400-G-GCACACA 56878253-G-GCACACA 9×CA*
13461329-C-A 11305653-C-A *
13533289-A-ACT 11377613-A-ACT *
28549301-CAGGGCAGGGCCAAAGGG-C 26403154-CAGGGCAGGGCCAAAGGG-C *
56841422-C-A *
10677181-C-CTCCACTCCT *
13868984-C-T 11748278-C-T FT5087 *
11029476-GTCAC-G *
9108790-A-G *
10893779-T-C *
10990073-T-TTCCCC *
10662472-T-C *
13700690-A-C 11545014-A-C *
13269599-A-C 11113923-A-C *
59030478-AAAAC-A,AAAACAAAC 56884331-AAAAC-A,AAAACAAAC 6×AAAC*
10791102-A-G *
56857404-G-T *
13868945-C-T 11748239-C-T BY91725 *
13868946-G-C 11748240-G-C *
13868948-T-A 11748242-T-A *
13868949-G-T 11748243-G-T FT273844 *
13868951-A-G 11748245-A-G *
13868953-T-A 11748247-T-A *
13868954-G-T 11748248-G-T *
13868956-A-G 11748250-A-G *
13868958-T-A 11748252-T-A *
13868960-G-C 11748254-G-C *
13868963-T-A 11748257-T-A *
13868964-G-T 11748258-G-T *
13868966-A-G 11748260-A-G *
13868968-T-A 11748262-T-A *
13868969-G-T 11748263-G-T *
13868971-A-G 11748265-A-G *
13868973-T-A 11748267-T-A *
13868975-G-T 11748269-G-T *
13868976-A-G 11748270-A-G *
13868978-T-A 11748272-T-A *
13868979-G-T 11748273-G-T *
13868981-A-G 11748275-A-G *
13868983-T-A 11748277-T-A *
13868985-G-C 11748279-G-C *
13868986-A-G 11748280-A-G *
13868989-G-A 11748283-G-A *
56878143-A-C *
13458591-C-G 11302915-C-G *
10662473-T-A *
10691339-CTCTACTCCATTCCATTCCATTCCATTCCAT-C *
10673226-A-G *
10673235-C-T *
13485348-C-A 11329672-C-A *
9108658-G-GTAAA *
9108659-A-T *
9108787-G-GA *
9108789-T-A *
9936675-C-G 10099066-C-G Y*
9945339-G-C 10107730-G-C Y*
10654531-C-CCTA *
10791094-A-G *
10892802-T-C *
10892804-C-T *
13480056-T-C 11324380-T-C *
13533290-T-G 11377614-T-G *
13556901-A-T 11401225-A-T *
13688617-T-C 11532941-T-C *
28585213-T-C 26439066-T-C *
28807176-G-T 26661029-G-T *
28807192-A-T 26661045-A-T *
28807218-A-T 26661071-A-T *
28810031-A-G 26663884-A-G *
9980641-T-C 10143032-T-C Y*
10836850-C-T *
10836857-C-G *
13439700-G-T 11284024-G-T *
13573608-T-C 11417932-T-C *
13711875-A-C 11556199-A-C *
13711877-T-G 11556201-T-G *
13245065-G-GTCTTGCTC 11089389-G-GTCTTGCTC *
56861812-CAAAAAAAAA-C,CAAAAAAA 26×A*
13694815-G-A,T 11539139-G-A,T *
10679229-T-TTCCAC *
10884836-GCTTTCCATTC-G *
13705999-G-C 11550323-G-C *
10624834-G-C *
10777182-C-T *
10787521-TC-T *
10787523-A-T *
13450773-T-TTCCACTCCACTGCAC,TTCCACTCCACTGCACTCCAC 11295097-T-TTCCACTCCACTGCAC,TTCCACTCCACTGCACTCCAC *
13573601-CCA-C 11417925-CCA-C *
13591357-T-G 11435681-T-G *
13591366-A-G 11435690-A-G *
13725866-T-A,C 11570190-T-A,C *
28785463-G-T 26639316-G-T *
13545332-GAAGGAAGGAAAGAAAGA-G 11389656-GAAGGAAGGAAAGAAAGA-G *
13694856-G-T 11539180-G-T *
56875781-G-GT,GTTTT 9×T*
10692434-T-TTACAA *
9943692-T-C 10106083-T-C Y*
10894242-ATTCCG-A *
56842820-G-A *
56860670-GAAAA-G 9×A*
22505037-G-T 20343151-G-T DYZ19 **
22281897-C-T 20120011-C-T DYZ19 **
22281898-T-C 20120012-T-C DYZ19 **
7554786-AACAC-A,AA 7686745-AACAC-A,AA 22×AC**
13423091-A-T 11267415-A-T **
10067037-A-G 10229428-A-G **
22332781-G-A 20170895-G-A DYZ19 **
9734616-A-C 9897007-A-C IR3_Prx *****
6591373-GA-G 6723332-GA-G **
9429667-C-CAAAA 9592058-C-CAAAA 25×A**
19293770-C-CAAAAAAA 17181890-C-CAAAAAAA 29×A**
19937284-G-GCCCC 17825404-G-GCCCC P5_Prx 13×C**
28545016-C-CAAAAAAAAA 26398869-C-CAAAAAAAAA 22×A**
58874773-CCATTCCATTACTTTG-C 56716076-CGGAATGCAAAGTAAT-C **
22504690-C-A 20342804-C-A DYZ19 **
22282035-C-T 20120149-C-T DYZ19 **
13139325-C-T 10628811-C-T **
13739794-A-T 11584118-A-T **
22311673-T-A 20149787-T-A DYZ19 **
22367158-G-C 20205272-G-C DYZ19 **
36905-T-G **
14972-C-T **
36957-G-C **
36995-G-T **
36939-C-G **
14873-A-T **
14874-G-A **
14875-T-G **
22259765-A-T 20097879-A-T DYZ19 **
22259683-T-G 20097797-T-G DYZ19 **
36975-C-T **
25781-T-C **
36949-T-C **
22259676-C-A 20097790-C-A DYZ19 **
22259775-C-G 20097889-C-G DYZ19 **
4818137-G-A 4950096-G-A **
11023244-C-A **
22259766-G-A 20097880-G-A DYZ19 **
56690930-A-T **
28814691-AG-A,GA 26668544-AG-A,GA ***
28785967-G-A 26639820-G-A ***
13868787-A-T 11748081-A-T ***
58972725-G-C 56826578-G-C ***
22280101-A-G 20118215-A-G DYZ19 ***
28807052-C-G 26660905-C-G BY29079 ***
22238328-C-T 20076442-C-T DYZ19 ***
13748326-G-C 11592650-G-C ***
22366310-C-G 20204424-C-G DYZ19 ***
22479484-A-C 20317598-A-C DYZ19 ***
13810752-G-T 11690046-G-T ***
13688247-A-G 11532571-A-G ***
59021876-G-T 56875729-G-T ***
21477220-C-A,CTTA 19315334-C-A,CTTA 8×TTCTTA***
13480021-T-C 11324345-T-C ***
13706510-G-C 11550834-G-C BY1009 ***
7211969-A-C 7343928-A-C FTA9643 ***
13480543-C-A 11324867-C-A ***
22241568-C-A 20079682-C-A DYZ19 ***
9940641-C-T 10103032-C-T ***
13465253-A-T 11309577-A-T ***
22509871-C-T 20347985-C-T DYZ19 ***
58876814-G-C 56714057-C-G ***
10026093-A-C 10188484-A-C ***
13477061-A-G 11321385-A-G ***
13692659-A-G 11536983-A-G ***
13706502-C-G 11550826-C-G BY25125 ***
13706508-T-G 11550832-T-G BY25126 ***
28807630-T-C 26661483-T-C BY27886 ***
28814079-T-G 26667932-T-G ***
13686912-C-A 11531236-C-A 10×GAATG***
58974891-C-A 56828744-C-A ***
13449987-T-G 11294311-T-G ***
28810131-G-T 26663984-G-T ***
13448906-C-T 11293230-C-T ***
22297464-A-G 20135578-A-G DYZ19 ***
22503103-G-T 20341217-G-T DYZ19 ***
13827420-T-A 11706714-T-A ***
25709386-G-GTTTT 23563239-G-GTTTT P1_b3 31×T***
13694535-T-A 11538859-T-A BY88874 ***
13846547-C-T 11725841-C-T ***
13846620-G-C 11725914-G-C ***
13290336-G-A 11134660-G-A ***
13695597-G-A 11539921-G-A ***
28806633-G-A 26660486-G-A ***
9936740-G-C 10099131-G-C ***
13827171-A-T 11706465-A-T ***
13138492-T-C 10627978-T-C ***
13138496-A-C 10627982-A-C ***
13138519-A-T 10628005-A-T ***
13522998-T-A 11367322-T-A ***
13450144-T-C 11294468-T-C ***
13278724-A-T 11123048-A-T ***
28802841-TTGG-GCGA 26656694-TTGG-GCGA ***
13290894-A-G 11135218-A-G ***
9952814-G-T 10115205-G-T FT373446 ***
19937585-G-A 17825705-G-A P5_Prx ***
10022156-T-C 10184547-T-C FGC19274 ***
19646325-G-T 17534445-G-T P5_Prx ***
19656572-C-T 17544692-C-T P5_Prx ***
19656617-C-A 17544737-C-A P5_Prx ***
22236522-G-A 20074636-G-A DYZ19 ***
22250224-G-A 20088338-G-A DYZ19 ***
22257049-C-G 20095163-C-G DYZ19 ***
22268290-C-A 20106404-C-A DYZ19 ***
22360301-A-T 20198415-A-T DYZ19 ***
22364630-A-T 20202744-A-T DYZ19 ***
22366532-T-A 20204646-T-A DYZ19 ***
22421582-T-C 20259696-T-C DYZ19 ***
24836794-A-G 22690647-A-G P3_b2 ***
58847905-G-C 56742966-C-G ***
58848367-G-C 56742504-C-G ***
58848499-G-A 56742372-C-T ***
58848519-G-A 56742352-C-T ***
58877063-G-T 56713808-C-A ***
19656534-TG-CA 17544654-TG-CA P5_Prx ***
19656560-CTTCTTA-GTCATTG 17544680-CTTCTTA-GTCATTG P5_Prx ***
9956830-T-C 10119221-T-C ***
58877153-C-T 56713718-G-A ***
22297705-A-G 20135819-A-G DYZ19 ***
58829075-G-A 56761796-C-T ***
58916669-G-T 56674202-C-A ***
13287177-A-G 11131501-A-G ***
13476019-G-A 11320343-G-A ***
6565771-T-C 6697730-T-C ***
5905918-G-A 6037877-G-A FT166836 ***
7211965-A-C 7343924-A-C ***
18001442-C-G 15889562-C-G P7_Gap ***
3968965-G-A 4100924-G-A FGC3523 Y4424 ***
13258139-G-A 11102463-G-A BY210088 ***
22268380-T-A 20106494-T-A DYZ19 ***
22304360-G-T 20142474-G-T DYZ19 ***
10067069-C-T 10229460-C-T ***
22297684-T-A 20135798-T-A DYZ19 ***
3930620-A-C 4062579-A-C 8×AC***
24207822-T-C 22061675-T-C P3_b1 ***
22297573-A-T 20135687-A-T DYZ19 ***
13110090-C-G 10599576-C-G ***
22297497-A-T 20135611-A-T DYZ19 ***
22256954-G-C 20095068-G-C DYZ19 ***
13110105-T-A 10599591-T-A ***
58863982-C-G 56726889-G-C ***
13133004-G-C 10622490-G-C ***
13476035-A-T 11320359-A-T ***
13476008-G-A 11320332-G-A ***
22297578-T-A 20135692-T-A DYZ19 ***
10029616-G-T 10192007-G-T ***
13133002-G-A 10622488-G-A ***
13132993-G-A 10622479-G-A ***
13567082-C-T 11411406-C-T ******
13392947-T-C 11237271-T-C ***
58819939-A-G 56770932-T-C ***
2903236-T-C 3035195-T-C FGC65269 ***
3930606-C-T 4062565-C-T ***
3930624-C-A 4062583-C-A ***
4201090-G-T 4333049-G-T ***
4226795-A-C 4358754-A-C ***
4236126-T-C 4368085-T-C ***
4289913-A-C 4421872-A-C ***
4783675-G-C 4915634-G-C ***
5221843-A-T 5353802-A-T ***
5792829-T-G 5924788-T-G ***
5949099-A-G 6081058-A-G ***
5949106-G-C 6081065-G-C ***
5949116-T-C 6081075-T-C ***
6142524-T-C 6274483-T-C IR3_Dst ***
6392559-T-C 6524518-T-C ***
6498160-T-C 6630119-T-C ***
6681973-T-C 6813932-T-C ***
7077430-G-A 7209389-G-A ***
7107222-A-T 7239181-A-T ***
7536070-A-G 7668029-A-G ***
7632857-T-C 7764816-T-C ***
7898502-C-T 8030461-C-T ***
7984784-G-A 8116743-G-A ***
8004285-A-G 8136244-A-G ***
8061862-G-A 8193821-G-A ***
8825584-A-G 8957543-A-G ***
9201809-C-T 9364200-C-T ***
9303954-C-T 9466345-C-T ***
9473679-A-T 9636070-A-T ***
9544115-C-T 9706506-C-T IR3_Prx ***
9544147-G-A 9706538-G-A IR3_Prx ***
9657615-T-G 9820006-T-G IR3_Prx ***
9657636-G-C 9820027-G-C IR3_Prx ***
9657645-A-C 9820036-A-C IR3_Prx ***
9657646-A-T 9820037-A-T IR3_Prx ***
9669393-A-C 9831784-A-C IR3_Prx ***
9669406-A-C 9831797-A-C IR3_Prx ***
9669409-A-C 9831800-A-C IR3_Prx ***
9936818-A-T 10099209-A-T ******
9945614-T-G 10108005-T-G ***
10025643-C-A 10188034-C-A A14811 ***
10059897-T-C 10222288-T-C ***
10059912-G-T 10222303-G-T ***
10090302-C-G 10252693-C-G ***
10090303-T-G 10252694-T-G ***
10090306-G-C 10252697-G-C ***
10090314-T-G 10252705-T-G ***
10090658-T-C 10253049-T-C ***
10090675-G-T 10253066-G-T ***
10090697-A-C 10253088-A-C ***
10090704-C-A 10253095-C-A ***
10090705-C-G 10253096-C-G ***
10090725-A-T 10253116-A-T ***
10091408-T-A 10253799-T-A ***
10091409-C-T 10253800-C-T ***
10091410-C-T 10253801-C-T ***
10091412-G-T 10253803-G-T ***
10091413-G-C 10253804-G-C ***
10091418-A-T 10253809-A-T ***
13109918-A-T 10599404-A-T ***
13109955-A-T 10599441-A-T ***
13109983-T-A 10599469-T-A ***
13110799-G-A 10600285-G-A ***
13110880-G-T 10600366-G-T ***
13121669-A-C 10611155-A-C ***
13132994-G-T 10622480-G-T ***
13133003-G-T 10622489-G-T ***
13222389-G-A 11066713-G-A A3340 ***
13253822-G-C 11098146-G-C ***
13253824-G-T 11098148-G-T ***
13253826-T-C 11098150-T-C ***
13253834-T-G 11098158-T-G ***
13287142-G-T 11131466-G-T ***
13328814-G-A 11173138-G-A ***
13465335-T-A 11309659-T-A ***
13465355-T-G 11309679-T-G ***
13484502-G-A 11328826-G-A ***
13484514-C-G 11328838-C-G ***
13484515-A-C 11328839-A-C ***
13484521-A-C 11328845-A-C ***
13484523-T-C 11328847-T-C ***
13486883-T-C 11331207-T-C ***
13567070-G-C 11411394-G-C ******
13700533-T-A 11544857-T-A ***
13716391-T-G 11560715-T-G ***
13716394-G-A 11560718-G-A ***
13716426-A-T 11560750-A-T ***
13716432-A-G 11560756-A-G ***
13716437-A-G 11560761-A-G ***
13734079-A-G 11578403-A-G ***
13735710-G-C 11580034-G-C ***
13740731-T-A 11585055-T-A ***
13740788-G-T 11585112-G-T ***
14666742-A-T 12554808-A-T ***
14727302-G-A 12615370-G-A ***
14727306-C-T 12615374-C-T ***
14727314-G-A 12615382-G-A ***
14911004-G-T 12799071-G-T ***
15245934-G-T 13134020-G-T ***
15520665-C-T 13408785-C-T ***
15520675-A-T 13408795-A-T ***
15520678-C-G 13408798-C-G ***
15618562-T-C 13506682-T-C ***
15637191-A-G 13525311-A-G ***
16785733-A-G 14673853-A-G ***
17035318-C-T 14923438-C-T ***
17999468-A-T 15887588-A-T P7_Gap ***
18270297-C-T 16158417-C-T ***
18333481-A-T 16221601-A-T P6_Prx ***
18333709-G-T 16221829-G-T P6_Prx ***
18333746-A-T 16221866-A-T P6_Prx ***
18333761-G-T 16221881-G-T P6_Prx ***
18333778-A-T 16221898-A-T P6_Prx ***
18343873-G-T 16231993-G-T P6_Prx ***
18440396-G-A 16328516-G-A P6_Dst ***
18440425-C-G 16328545-C-G P6_Dst ***
18440439-C-A 16328559-C-A P6_Dst ***
18483073-A-C 16371193-A-C P6_Dst ***
18483082-C-T 16371202-C-T P6_Dst ***
18483099-C-T 16371219-C-T P6_Dst ***
18511226-G-A 16399346-G-A P6_Dst ***
19027594-A-C 16915714-A-C ***
19027697-C-T 16915817-C-T ***
19098286-A-T 16986406-A-T ***
19210282-C-A 17098402-C-A ***
19656534-T-C 17544654-T-C P5_Prx ***
19656535-G-A 17544655-G-A P5_Prx ***
19656560-C-G 17544680-C-G P5_Prx ***
19656562-T-C 17544682-T-C P5_Prx ***
19656563-C-A 17544683-C-A P5_Prx ***
19656566-A-G 17544686-A-G P5_Prx ***
19656586-G-T 17544706-G-T P5_Prx ***
19656658-A-C 17544778-A-C P5_Prx ***
19656666-G-C 17544786-G-C P5_Prx ***
19656670-A-C 17544790-A-C P5_Prx ***
19656671-A-T 17544791-A-T P5_Prx ***
19656678-C-T 17544798-C-T P5_Prx ***
19656697-G-C 17544817-G-C P5_Prx ***
19656702-G-A 17544822-G-A P5_Prx ***
19656707-T-C 17544827-T-C P5_Prx ***
19656730-G-T 17544850-G-T P5_Prx ***
19656731-A-T 17544851-A-T P5_Prx ***
19656732-C-T 17544852-C-T P5_Prx ***
19656733-A-T 17544853-A-T P5_Prx ***
19656739-G-T 17544859-G-T P5_Prx ***
19656741-A-T 17544861-A-T P5_Prx ***
19656762-T-C 17544882-T-C P5_Prx ***
19656781-G-A 17544901-G-A P5_Prx ***
19784917-A-T 17673037-A-T P5_Prx ***
19784919-C-A 17673039-C-A P5_Prx ***
19784920-C-A 17673040-C-A P5_Prx ***
19784922-G-A 17673042-G-A P5_Prx ***
19784925-T-A 17673045-T-A P5_Prx ***
19784926-G-A 17673046-G-A P5_Prx ***
19784927-G-A 17673047-G-A P5_Prx ***
19784929-G-A 17673049-G-A P5_Prx ***
19784930-T-A 17673050-T-A P5_Prx ***
19784932-C-A 17673052-C-A P5_Prx ***
19784934-G-A 17673054-G-A P5_Prx ***
19784935-T-A 17673055-T-A P5_Prx ***
19784938-T-A 17673058-T-A P5_Prx ***
19784939-G-A 17673059-G-A P5_Prx ***
19784940-C-A 17673060-C-A P5_Prx ***
19784952-C-A 17673072-C-A P5_Prx ***
19784954-C-A 17673074-C-A P5_Prx ***
19784955-T-A 17673075-T-A P5_Prx ***
19784956-G-A 17673076-G-A P5_Prx ***
19784957-C-A 17673077-C-A P5_Prx ***
19784961-C-A 17673081-C-A P5_Prx ***
19814934-A-T 17703054-A-T P5_Prx ***
19814952-T-A 17703072-T-A P5_Prx ***
19931039-A-T 17819159-A-T P5_Prx ***
19931043-G-A 17819163-G-A P5_Prx ***
19931046-G-A 17819166-G-A P5_Prx ***
19931047-T-A 17819167-T-A P5_Prx ***
19931050-C-A 17819170-C-A P5_Prx ***
19931052-C-G 17819172-C-G P5_Prx ***
19931077-T-A 17819197-T-A P5_Prx ***
19931082-T-A 17819202-T-A P5_Prx ***
19931084-T-C 17819204-T-C P5_Prx ***
19931086-G-C 17819206-G-C P5_Prx ***
19937302-G-C 17825422-G-C P5_Prx ***
19966727-G-A 17854847-G-A P5_Prx ***
20045341-A-G 17933461-A-G P5_Prx ***
20353477-T-A 18191591-T-A P5_Dst ***
20374087-A-G 18212201-A-G P5_Dst ***
20374096-C-G 18212210-C-G P5_Dst ***
20374114-A-T 18212228-A-T P5_Dst ***
20374116-A-G 18212230-A-G P5_Dst ***
20374120-A-T 18212234-A-T P5_Dst ***
20374127-A-C 18212241-A-C P5_Dst ***
20522734-G-C 18360848-G-C P5_Dst ***
20522747-C-T 18360861-C-T P5_Dst ***
20522768-C-T 18360882-C-T P5_Dst ***
20522775-C-T 18360889-C-T P5_Dst ***
20522788-C-T 18360902-C-T P5_Dst ***
20522789-A-C 18360903-A-C P5_Dst ***
20522800-T-G 18360914-T-G P5_Dst ***
20522818-A-G 18360932-A-G P5_Dst ***
20522825-G-T 18360939-G-T P5_Dst ***
20522845-A-C 18360959-A-C P5_Dst ***
20522848-G-T 18360962-G-T P5_Dst ***
20522853-A-C 18360967-A-C P5_Dst ***
20531449-A-G 18369563-A-G P5_Dst ***
20531450-G-T 18369564-G-T P5_Dst ***
20531457-C-A 18369571-C-A P5_Dst ***
20531469-A-G 18369583-A-G P5_Dst ***
20531483-G-C 18369597-G-C P5_Dst ***
20531486-G-A 18369600-G-A P5_Dst ***
20531502-A-T 18369616-A-T P5_Dst ***
20531503-T-C 18369617-T-C P5_Dst ***
20531511-G-A 18369625-G-A P5_Dst ***
20531531-T-C 18369645-T-C P5_Dst ***
20531661-G-A 18369775-G-A P5_Dst ***
20531664-T-G 18369778-T-G P5_Dst ***
20531667-C-T 18369781-C-T P5_Dst ***
20531675-T-C 18369789-T-C P5_Dst ***
20531676-G-C 18369790-G-C P5_Dst ***
20531677-C-A 18369791-C-A P5_Dst ***
20531681-A-C 18369795-A-C P5_Dst ***
20531695-C-T 18369809-C-T P5_Dst ***
20531698-A-C 18369812-A-C P5_Dst ***
20531707-G-A 18369821-G-A P5_Dst ***
20531723-G-A 18369837-G-A P5_Dst ***
20544893-G-A 18383007-G-A P5_Dst ***
20544901-T-G 18383015-T-G P5_Dst ***
20544933-A-T 18383047-A-T P5_Dst ***
20545154-A-T 18383268-A-T P5_Dst ***
20970899-C-T 18809013-C-T P4_Dst ***
20979723-G-A 18817837-G-A P4_Dst ***
21061615-G-A 18899729-G-A ***
21539738-A-G 19377852-A-G ***
21575337-G-C 19413451-G-C ***
22031913-A-G 19870027-A-G ***
22227755-T-A 20065869-T-A DYZ19 ***
22232071-T-A 20070185-T-A DYZ19 ***
22232092-G-A 20070206-G-A DYZ19 ***
22232096-C-A 20070210-C-A DYZ19 ***
22232111-C-G 20070225-C-G DYZ19 ***
22235093-G-T 20073207-G-T DYZ19 ***
22236511-C-A 20074625-C-A DYZ19 ***
22248333-A-G 20086447-A-G DYZ19 ***
22248457-G-C 20086571-G-C DYZ19 ***
22248516-A-C 20086630-A-C DYZ19 ***
22263792-A-T 20101906-A-T DYZ19 ***
22263796-C-T 20101910-C-T DYZ19 ***
22268297-G-T 20106411-G-T DYZ19 ***
22268301-C-G 20106415-C-G DYZ19 ***
22268318-T-G 20106432-T-G DYZ19 ***
22281996-G-A 20120110-G-A DYZ19 ***
22282202-C-T 20120316-C-T DYZ19 ***
22297348-G-T 20135462-G-T DYZ19 ***
22297453-T-A 20135567-T-A DYZ19 ***
22297459-T-A 20135573-T-A DYZ19 ***
22297476-T-G 20135590-T-G DYZ19 ***
22297481-G-A 20135595-G-A DYZ19 ***
22297489-T-A 20135603-T-A DYZ19 ***
22297551-C-T 20135665-C-T DYZ19 ***
22297678-A-G 20135792-A-G DYZ19 ***
22304384-G-A 20142498-G-A DYZ19 ***
22309880-T-G 20147994-T-G DYZ19 ***
22332806-G-A 20170920-G-A DYZ19 ***
22332808-T-A 20170922-T-A DYZ19 ***
22332813-C-A 20170927-C-A DYZ19 ***
22332835-A-T 20170949-A-T DYZ19 ***
22332851-T-A 20170965-T-A DYZ19 ***
22337437-A-C 20175551-A-C DYZ19 ***
22337441-A-G 20175555-A-G DYZ19 ***
22342542-G-T 20180656-G-T DYZ19 ***
22342583-A-T 20180697-A-T DYZ19 ***
22342588-T-G 20180702-T-G DYZ19 ***
22342877-G-T 20180991-G-T DYZ19 ***
22342938-G-C 20181052-G-C DYZ19 ***
22344040-G-T 20182154-G-T DYZ19 ***
22344085-T-A 20182199-T-A DYZ19 ***
22344123-A-G 20182237-A-G DYZ19 ***
22344154-C-A 20182268-C-A DYZ19 ***
22344157-A-T 20182271-A-T DYZ19 ***
22344334-G-C 20182448-G-C DYZ19 ***
22344387-G-A 20182501-G-A DYZ19 ***
22344390-G-A 20182504-G-A DYZ19 ***
22349359-A-T 20187473-A-T DYZ19 ***
22349394-C-T 20187508-C-T DYZ19 ***
22349423-T-C 20187537-T-C DYZ19 ***
22352648-A-T 20190762-A-T DYZ19 ***
22352653-C-A 20190767-C-A DYZ19 ***
22355069-G-A 20193183-G-A DYZ19 ***
22355102-A-G 20193216-A-G DYZ19 ***
22360029-A-T 20198143-A-T DYZ19 ***
22360035-T-C 20198149-T-C DYZ19 ***
22360043-T-G 20198157-T-G DYZ19 ***
22360052-G-A 20198166-G-A DYZ19 ***
22360303-A-C 20198417-A-C DYZ19 ***
22361353-T-A 20199467-T-A DYZ19 ***
22364637-G-T 20202751-G-T DYZ19 ***
22364682-G-A 20202796-G-A DYZ19 ***
22365984-G-T 20204098-G-T DYZ19 ***
22365985-C-A 20204099-C-A DYZ19 ***
22365986-A-G 20204100-A-G DYZ19 ***
22421003-G-T 20259117-G-T DYZ19 ***
22421004-A-T 20259118-A-T DYZ19 ***
22421010-T-C 20259124-T-C DYZ19 ***
22421013-C-T 20259127-C-T DYZ19 ***
22421584-T-G 20259698-T-G DYZ19 ***
22421685-C-G 20259799-C-G DYZ19 ***
22421857-G-T 20259971-G-T DYZ19 ***
22435950-C-T 20274064-C-T DYZ19 ***
22439658-T-A 20277772-T-A DYZ19 ***
22481215-G-C 20319329-G-C DYZ19 ***
22481253-T-G 20319367-T-G DYZ19 ***
22481691-G-T 20319805-G-T DYZ19 ***
22481801-G-C 20319915-G-C DYZ19 ***
22496026-C-A 20334140-C-A DYZ19 ***
22502206-G-A 20340320-G-A DYZ19 ***
22503061-C-A 20341175-C-A DYZ19 ***
22503065-A-T 20341179-A-T DYZ19 ***
22504649-T-A 20342763-T-A DYZ19 ***
22694171-G-T 20532285-G-T ***
24107374-G-A 21961227-G-A P3_b1 12×A***
24259989-C-T 22113842-C-T P3_b1 ***
24259993-A-C 22113846-A-C P3_b1 ***
24260010-C-T 22113863-C-T P3_b1 ***
24260015-C-T 22113868-C-T P3_b1 ***
24260026-C-A 22113879-C-A P3_b1 ***
24260027-A-G 22113880-A-G P3_b1 ***
24260030-C-G 22113883-C-G P3_b1 ***
24528147-A-C 22382000-A-C P3_t2 ***
24528149-A-T 22382002-A-T P3_t2 ***
24528150-A-C 22382003-A-C P3_t2 ***
24528151-A-T 22382004-A-T P3_t2 ***
24528154-A-C 22382007-A-C P3_t2 ***
24528156-A-C 22382009-A-C P3_t2 ***
24528168-A-C 22382021-A-C P3_t2 ***
24528182-T-C 22382035-T-C P3_t2 ***
24528183-T-C 22382036-T-C P3_t2 ***
24528201-A-G 22382054-A-G P3_t2 ***
24907781-T-A 22761634-T-A g1 22×A***
25029480-C-A 22883333-C-A g1 ***
25207802-G-A 23061655-G-A P2_r1 ***
25207817-C-T 23061670-C-T P2_r1 ***
25680647-C-T 23534500-C-T P1_b3 ***
25680648-C-T 23534501-C-T P1_b3 ***
25680653-A-G 23534506-A-G P1_b3 ***
25680673-G-C 23534526-G-C P1_b3 ***
25805046-C-A 23658899-C-A P1_b3 ***
25805047-G-A 23658900-G-A P1_b3 ***
25805048-C-A 23658901-C-A P1_b3 ***
25805049-G-A 23658902-G-A P1_b3 ***
25805063-G-A 23658916-G-A P1_b3 ***
25805070-C-A 23658923-C-A P1_b3 ***
25856697-C-G 23710550-C-G P1_Y1 ***
25856698-C-A 23710551-C-A P1_Y1 ***
25856704-A-T 23710557-A-T P1_Y1 ***
25856739-T-G 23710592-T-G P1_Y1 ***
25856740-A-G 23710593-A-G P1_Y1 ***
25856744-A-G 23710597-A-G P1_Y1 ***
25871141-T-A 23724994-T-A P1_Y1 ***
25871169-C-T 23725022-C-T P1_Y1 ***
26101197-C-A 23955050-C-A P1_Y1 ***
26209274-T-A 24063127-T-A P1_Y1 ***
26209278-A-G 24063131-A-G P1_Y1 ***
26209297-G-A 24063150-G-A P1_Y1 ***
26209300-G-A 24063153-G-A P1_Y1 ***
26209303-C-A 24063156-C-A P1_Y1 ***
26209312-C-T 24063165-C-T P1_Y1 ***
26345581-A-G 24199434-A-G P1_Y1 ***
27385064-T-G 25238917-T-G P1_g3 ***
27385074-C-T 25238927-C-T P1_g3 ***
27385079-G-A 25238932-G-A P1_g3 ***
27385105-T-C 25238958-T-C P1_g3 ***
27423533-A-T 25277386-A-T P1_g3 ***
27423550-T-A 25277403-T-A P1_g3 ***
27462488-T-A 25316341-T-A P1_Y2 15×AC***
27637426-A-G 25491279-A-G P1_Y2 ***
27691964-A-T 25545817-A-T P1_Y2 ***
27780410-T-A 25634263-T-A P1_Y2 ***
27780415-C-A 25634268-C-A P1_Y2 ***
27780424-C-A 25634277-C-A P1_Y2 ***
27780435-G-A 25634288-G-A P1_Y2 ***
27780437-G-A 25634290-G-A P1_Y2 ***
27780476-G-A 25634329-G-A P1_Y2 ***
27896927-C-A 25750780-C-A P1_Y2 ***
27896937-C-G 25750790-C-G P1_Y2 ***
27896949-A-G 25750802-A-G P1_Y2 ***
28091411-G-A 25945264-G-A P1_Y2 ***
28091431-C-A 25945284-C-A P1_Y2 ***
28091433-G-A 25945286-G-A P1_Y2 ***
28091444-T-A 25945297-T-A P1_Y2 ***
28091455-A-T 25945308-A-T P1_Y2 10×AC***
28374453-A-T 26228306-A-T P1_gr2 ***
28387833-A-G 26241686-A-G P1_gr2 ***
28387835-T-C 26241688-T-C P1_gr2 ***
28387849-A-C 26241702-A-C P1_gr2 ***
28387860-T-A 26241713-T-A P1_gr2 ***
28387863-G-T 26241716-G-T P1_gr2 ***
28387869-C-A 26241722-C-A P1_gr2 ***
28387877-C-T 26241730-C-T P1_gr2 ***
28434131-G-A 26287984-G-A P1_gr2 ***
28489793-C-A 26343646-C-A ***
28491427-A-T 26345280-A-T ***
28681913-T-C 26535766-T-C ***
28722436-T-A 26576289-T-A 13×A***
58819922-A-T 56770949-T-A ***
58827119-C-A 56763752-G-T ***
58829066-T-A 56761805-A-T ***
58833766-T-A 56757105-A-T ***
58839127-A-T 56751744-T-A ***
58840515-G-C 56750356-C-G ***
58840568-T-C 56750303-A-G ***
58840611-C-A 56750260-G-T ***
58843141-T-G 56747730-A-C ***
58843145-G-C 56747726-C-G ***
58843212-G-C 56747659-C-G ***
58843447-T-C 56747424-A-G ***
58843711-A-G 56747160-T-C ***
58843721-G-A 56747150-C-T ***
58843734-T-C 56747137-A-G ***
58843749-T-A 56747122-A-T ***
58843791-T-A 56747080-A-T ***
58844242-A-C 56746629-T-G ***
58844628-T-C 56746243-A-G ***
58846274-C-T 56744597-G-A ***
58846289-G-C 56744582-C-G ***
58847307-T-G 56743564-A-C ***
58847316-T-A 56743555-A-T ***
58847324-T-G 56743547-A-C ***
58847325-A-C 56743546-T-G ***
58847785-C-A 56743086-G-T ***
58847797-C-T 56743074-G-A ***
58847920-A-C 56742951-T-G ***
58847937-T-C 56742934-A-G ***
58847988-G-T 56742883-C-A ***
58852260-C-G 56738611-G-C ***
58856239-T-C 56734632-A-G ***
58856247-T-A 56734624-A-T ***
58861518-T-A 56729353-A-T ***
58862115-A-T 56728756-T-A ***
58862475-A-T 56728396-T-A ***
58865739-A-T 56725132-T-A ***
58865755-C-T 56725116-G-A ***
58865760-T-A 56725111-A-T ***
58865761-A-T 56725110-T-A ***
58865765-T-G 56725106-A-C ***
58868284-T-A 56722587-A-T ***
58868293-G-A 56722578-C-T ***
58868314-T-A 56722557-A-T ***
58870580-G-A 56720291-C-T ***
58870613-A-T 56720258-T-A ***
58872626-G-C 56718245-C-G ***
58874506-A-T 56716365-T-A ***
58874513-C-A 56716358-G-T ***
58876985-G-C 56713886-C-G ***
58877000-A-C 56713871-T-G ***
58877002-T-C 56713869-A-G ***
58877004-C-A 56713867-G-T ***
58877016-A-C 56713855-T-G ***
58877034-C-G 56713837-G-C ***
58877042-C-T 56713829-G-A ***
58877057-T-C 56713814-A-G ***
58877061-C-G 56713810-G-C ***
58877065-C-G 56713806-G-C ***
58877134-T-C 56713737-A-G ***
58877142-T-A 56713729-A-T ***
58877144-T-C 56713727-A-G ***
58879674-G-C 56711197-C-G ***
58881937-C-G 56708934-G-C ***
58903949-T-A 56686922-A-T ***
58906560-A-T 56684311-T-A ***
58908644-T-C 56682227-A-G ***
58908655-T-C 56682216-A-G ***
58908656-C-G 56682215-G-C ***
58908671-T-A 56682200-A-T ***
58908683-G-T 56682188-C-A ***
58908690-G-A 56682181-C-T ***
58910674-C-A 56680197-G-T ***
58910676-T-G 56680195-A-C ***
58913057-G-C 56677814-C-G ***
58913075-G-A 56677796-C-T ***
58916643-G-C 56674228-C-G ***
58916649-T-C 56674222-A-G ***
58916653-C-A 56674218-G-T ***
13254790-CGA-GGC 11099114-CGA-GGC ***
7270276-C-CTTT 7402235-C-CTTT 25×T***
15262458-C-CAA 13150542-C-CAA 30×A***
5130497-GT-G 5262456-GT-G 24×T***
15658118-G-GTA 13546238-G-GTA ***
22297624-TT-CA 20135738-TT-CA DYZ19 ***
2729648-C-CTTTT 2861607-C-CTTTT 25×T***
3550573-TC-AA 3682532-TC-AA ***
4336695-A-ATTTTTTT 4468654-A-ATTTTTTT 30×T***
5399016-A-ATTTTT 5530975-A-ATTTTT 18×T***
5869966-G-GTTTTTTTTTT 6001925-G-GTTTTTTTTTT 15×T***
9303933-CGACAATG-C 9466324-CGACAATG-C ***
9930204-AGGAAGCC-GGGGAGCG 10092595-AGGAAGCC-GGGGAGCG ***
10013106-GGGA-TGGC 10175497-GGGA-TGGC ***
10067032-T-TTCTG 10229423-T-TTCTG ***
13129621-GCAC-ACAT 10619107-GCAC-ACAT ***
13253822-GTGCT-CTTCC 11098146-GTGCT-CTTCC ***
13312196-CAC-TGT 11156520-CAC-TGT ***
13467783-AA-TT 11312107-AA-TT ***
13470854-TT-CC 11315178-TT-CC ***
13475916-ATAA-GTAG 11320240-ATAA-GTAG ***
13481362-CCGTG-AAGTT 11325686-CCGTG-AAGTT ***
13489029-TGCGC-CACGT 11333353-TGCGC-CACGT ***
14331131-C-CTTTT 12210425-C-CTTTT 25×T***
14658026-CTTTTT-C 12546091-CTTTTT-C 16×T***
17926534-C-CAAAAAAAAA 15814654-C-CAAAAAAAAA 25×A***
18001466-GCAAC-ACAAT 15889586-GCAAC-ACAAT P7_Gap ***
18270302-GTTTG-TTTTT 16158422-GTTTG-TTTTT ***
19006136-C-CAA 16894256-C-CAA 21×A***
19656732-CA-TT 17544852-CA-TT P5_Prx ***
19656739-GGA-TGT 17544859-GGA-TGT P5_Prx ***
19937290-C-CCCCCA 17825410-C-CCCCCA P5_Prx ***
20531449-AG-GT 18369563-AG-GT P5_Dst ***
20531483-GCTG-CCTA 18369597-GCTG-CCTA P5_Dst ***
20531502-AT-TC 18369616-AT-TC P5_Dst ***
22262643-C-CT 20100757-C-CT DYZ19 ***
22262664-AC-A 20100778-AC-A DYZ19 ***
22263752-CAATACA-TACTTCC 20101866-CAATACA-TACTTCC DYZ19 ***
22268290-CTTAGTGGTGACC-ATTGGTGTTGAGT 20106404-CTTAGTGGTGACC-ATTGGTGTTGAGT DYZ19 ***
22297453-TGAGCGT-AGAGTGA 20135567-TGAGCGT-AGAGTGA DYZ19 ***
22297487-AGT-TGA 20135601-AGT-TGA DYZ19 ***
22297597-AGG-TGT 20135711-AGG-TGT DYZ19 ***
22297631-GTG-ATC 20135745-GTG-ATC DYZ19 ***
22297702-TGAATGT-AGAGTGA 20135816-TGAATGT-AGAGTGA DYZ19 ***
22297714-TACA-CACT 20135828-TACA-CACT DYZ19 ***
22322617-TGTCT-CGATC 20160731-TGTCT-CGATC DYZ19 ***
22342573-TA-T 20180687-TA-T DYZ19 ***
22360387-TC-T 20198501-TC-T DYZ19 ***
22366725-AGTAT-TGTGA 20204839-AGTAT-TGTGA DYZ19 ***
22421536-CAG-TAA 20259650-CAG-TAA DYZ19 ***
22450002-TTA-CAT 20288116-TTA-CAT DYZ19 ***
22496169-TTTT-CTTA 20334283-TTTT-CTTA DYZ19 ***
23196176-GTTTTTT-G 21034290-GTTTTTT-G 20×T***
25472022-TCTTC-T 23325875-TCTTC-T P2_r2 ***
27466713-G-GTTAAAA 25320566-G-GTTAAAA P1_Y2 21×A***
27546140-TC-T 25399993-TC-T FGC389 P1_Y2 ***
28478036-T-TAGAG 26331889-T-TAGAG ***
28478036-TAT-GAGAGAG 26331889-TAT-GAGAGAG ***
28814439-AA-TG 26668292-AA-TG ***
58876993-TC-T 56713875-AG-A ***
58884224-ATTTGATGCCATTCCG-A 56706620-GATGGCATCAAACGGA-G ***
58894067-CTC-TTG 56696802-GAG-CAA ***
13475556-G-A 11319880-G-A ***
28812334-G-A 26666187-G-A ***
13567025-A-G 11411349-A-G ***
13705939-G-A 11550263-G-A FT462886 ***
13827414-A-G 11706708-A-G FT328566 ***
58823178-A-T 56767693-T-A ***
6586785-AC-CCTT 6718744-AC-CCTT ***
13129690-TCAAATCTGTCAGT-AAAACTCTATGAGA 10619176-TCAAATCTGTCAGT-AAAACTCTATGAGA ***
19937601-TA-G 17825721-TA-G P5_Prx ***
22495769-CTCATC-TCACTT 20333883-CTCATC-TCACTT DYZ19 ***
13140074-GAG-CAC 10629560-GAG-CAC ***
58821131-GATTCTCT-CATTTTC 56769733-AGAGAATC-GAAAATG ***
9303945-ACCTGGC-G 9466336-ACCTGGC-G ***
22297573-AGT-TAC 20135687-AGT-TAC DYZ19 ***
13482006-AGTTA-CGT 11326330-AGTTA-CGT ***
22297662-T-GG 20135776-T-GG DYZ19 ***
13469933-AC-CA 11314257-AC-CA ***
20531468-CA-G 18369582-CA-G P5_Dst ***
13340628-A-G 11184952-A-G ***
13473607-G-A 11317931-G-A ***
13461618-T-A 11305942-T-A ***
13256545-C-G 11100869-C-G ***
13485025-T-G 11329349-T-G ***
13473565-G-C 11317889-G-C ***
13468766-T-G 11313090-T-G BY40454 ***
13480117-C-A 11324441-C-A ***
13489867-C-A 11334191-C-A ***
13253040-C-A 11097364-C-A ***
13473447-C-A 11317771-C-A ***
13694432-G-T 11538756-G-T BY49943 ***
13461332-A-C 11305656-A-C ***
22502688-G-A 20340802-G-A DYZ19 ***
22502691-C-G 20340805-C-G DYZ19 ***
58823124-T-C 56767747-A-G ***
13830092-C-T 11709386-C-T ***
13717397-A-T 11561721-A-T ***
22503236-C-T 20341350-C-T DYZ19 ***
13480009-A-G 11324333-A-G ***
13810748-C-T 11690042-C-T ***
13473929-C-T 11318253-C-T BY85926 ***
13454852-C-T 11299176-C-T BY31564 ***
13710303-T-A 11554627-T-A ***
13473510-A-G 11317834-A-G ***
10061632-C-A 10224023-C-A ***
22422834-A-C 20260948-A-C DYZ19 ***
10061618-G-T 10224009-G-T ***
10061650-C-T 10224041-C-T ***
10061674-C-T 10224065-C-T ***
13345271-A-G 11189595-A-G ***
28802898-A-G 26656751-A-G ***
9951570-A-C 10113961-A-C ***
13512468-T-A 11356792-T-A ***
58914500-C-T 56676371-G-A ***
13476297-G-A 11320621-G-A ***
13485254-C-T 11329578-C-T ***
13428727-A-C 11273051-A-C ***
13428740-A-T 11273064-A-T ***
13428747-G-A 11273071-G-A ***
13846573-T-A 11725867-T-A ***
13846598-T-A 11725892-T-A ***
13846627-A-G 11725921-A-G ***
13846636-A-C 11725930-A-C ***
13846652-A-G 11725946-A-G ***
13846654-G-A 11725948-G-A ***
13846672-G-A 11725966-G-A ***
13846675-G-C 11725969-G-C ***
13846688-T-A 11725982-T-A ***
13846689-C-T 11725983-C-T ***
13473556-T-C 11317880-T-C ***
13469249-C-A 11313573-C-A ***
22367046-T-G 20205160-T-G DYZ19 ***
22278704-A-G 20116818-A-G DYZ19 ***
13567075-T-G 11411399-T-G ***
13304052-A-C 11148376-A-C ***
13304066-T-C 11148390-T-C ***
28808505-G-A 26662358-G-A BY27888 ***
28808512-A-G 26662365-A-G ***
13283394-G-T 11127718-G-T ***
13273844-G-C 11118168-G-C ***
13281348-G-A 11125672-G-A ***
58884221-T-C 56706650-A-G ***
22282084-C-A 20120198-C-A DYZ19 ***
22282105-C-T 20120219-C-T DYZ19 ***
2759997-T-C 2891956-T-C A18079 ***
2760000-A-G 2891959-A-G A18080 ***
3166913-G-A 3298872-G-A ***
3271120-T-C 3403079-T-C ***
3413894-C-A 3545853-C-A FTA35176 ***
3541033-C-A 3672992-C-A ***
3570900-G-A 3702859-G-A ***
4416011-T-C 4547970-T-C ***
5637843-C-A 5769802-C-A ***
6503431-T-A 6635390-T-A ***
9972291-T-A 10134682-T-A ***
9979021-T-G 10141412-T-G ***
9979038-A-G 10141429-A-G ***
9979047-T-C 10141438-T-C ***
13242337-C-T 11086661-C-T ***
13253111-G-A 11097435-G-A ***
13263609-C-T 11107933-C-T ***
13263834-G-A 11108158-G-A ***
13265088-C-T 11109412-C-T ***
13265152-G-A 11109476-G-A ***
13269070-G-A 11113394-G-A ***
13273416-G-A 11117740-G-A FT442188 ***
13275788-G-A 11120112-G-A ***
13276504-G-A 11120828-G-A ***
13279495-C-G 11123819-C-G ***
13279675-A-G 11123999-A-G ***
13284153-A-G 11128477-A-G ***
13287961-T-A 11132285-T-A ***
13291461-G-A 11135785-G-A ***
13291559-A-G 11135883-A-G ***
13303894-T-G 11148218-T-G ***
13306982-G-T 11151306-G-T ***
13349184-T-C 11193508-T-C ***
13368344-G-C 11212668-G-C ***
13423792-G-A 11268116-G-A ***
13440270-C-A 11284594-C-A ***
13443133-T-G 11287457-T-G ***
13473868-G-C 11318192-G-C ***
13494545-C-T 11338869-C-T ***
13494607-A-G 11338931-A-G ***
13494626-A-C 11338950-A-C ***
13501688-A-G 11346012-A-G ***
13507536-A-C 11351860-A-C ***
13507721-A-G 11352045-A-G ***
13507808-A-G 11352132-A-G ***
13509957-G-A 11354281-G-A ***
13509965-G-A 11354289-G-A ***
13509983-A-G 11354307-A-G ***
13517501-G-A 11361825-G-A ***
13517505-T-C 11361829-T-C ***
13518490-G-C 11362814-G-C FGC281 Y133723 ***
13520293-G-A 11364617-G-A ***
13534584-A-T 11378908-A-T ***
13538350-C-A 11382674-C-A ***
13538367-A-G 11382691-A-G ***
13545116-G-C 11389440-G-C ***
13566974-C-T 11411298-C-T 9×AT***
13567214-A-C 11411538-A-C ***
13567313-A-T 11411637-A-T ***
13570876-C-T 11415200-C-T ***
13571106-C-T 11415430-C-T ***
13571109-A-C 11415433-A-C ***
13637461-A-G 11481785-A-G ***
13637477-G-C 11481801-G-C ***
13689095-G-A 11533419-G-A F18219 ***
13701372-T-A 11545696-T-A ***
13855576-G-C 11734870-G-C ***
20985099-C-T 18823213-C-T P4_Dst ***
21620489-G-A 19458603-G-A ***
21965774-CAA-C 19803888-CAA-C 19×A***
22253161-C-A 20091275-C-A DYZ19 ***
24895365-G-C 22749218-G-C g1 ***
28588044-C-G 26441897-C-G ***
28795224-G-A 26649077-G-A ***
28800409-T-A 26654262-T-A ***
28805599-A-G 26659452-A-G ***
28819152-A-G 26673005-A-G ***
28819166-A-C 26673019-A-C ***
58880723-A-C 56710148-T-G ***
58894932-C-T 56695939-G-A ***
58906775-A-G 56684096-T-C ***
59030915-T-A 56884768-T-A ***
59030975-G-T 56884828-G-T ***
28814074-G-T 26667927-G-T ***
22364444-T-A 20202558-T-A DYZ19 ***
22364698-A-C 20202812-A-C DYZ19 ***
22364710-C-G 20202824-C-G DYZ19 ***
13468606-G-A 11312930-G-A ***
22502727-T-A 20340841-T-A DYZ19 ***
22280168-T-G 20118282-T-G A4026 DYZ19 ***
9997152-T-C 10159543-T-C ***
13482582-G-T 11326906-G-T ***
59025397-T-A 56879250-T-A ***
13556170-C-T 11400494-C-T ***
13701395-A-C 11545719-A-C ***
13701409-G-A 11545733-G-A BY89033 ***
4548441-C-T 4680400-C-T FT320990 ***
9936804-G-A 10099195-G-A ***
10022163-G-A 10184554-G-A ***
10041793-C-A 10204184-C-A ***
13262589-G-A 11106913-G-A ***
13265530-G-T 11109854-G-T ***
13266634-A-T 11110958-A-T ***
13267505-C-T 11111829-C-T ***
13268231-T-A 11112555-T-A ***
13272881-G-C 11117205-G-C ***
13285803-C-T 11130127-C-T ***
13323880-G-A 11168204-G-A ***
13354036-A-G 11198360-A-G ***
13375726-G-T 11220050-G-T ***
13375756-G-A 11220080-G-A ***
13415712-C-T 11260036-C-T ***
13432987-A-G 11277311-A-G ***
13432989-G-T 11277313-G-T ***
13445157-C-G 11289481-C-G ***
13489385-G-A 11333709-G-A ***
13489395-C-T 11333719-C-T ***
13512535-C-A 11356859-C-A ***
13512537-A-C 11356861-A-C ***
13529319-C-G 11373643-C-G ***
13530058-T-G 11374382-T-G ***
13530059-T-G 11374383-T-G ***
13536672-A-G 11380996-A-G ***
13537669-C-A 11381993-C-A ***
13537686-A-C 11382010-A-C ***
13545559-T-C 11389883-T-C ***
13557684-A-G 11402008-A-G ***
13563885-A-G 11408209-A-G ***
13565368-G-C 11409692-G-C ***
13566116-G-T 11410440-G-T ***
13577929-A-C 11422253-A-C ***
13690118-T-C 11534442-T-C ***
13694502-G-A 11538826-G-A FT448870 ***
13712521-T-C 11556845-T-C ***
22278729-T-G 20116843-T-G PF1118 DYZ19 ***
22288153-G-T 20126267-G-T JFS0228 DYZ19 ***
24388405-G-A 22242258-G-A ***
24388414-C-CTA 22242267-C-CTA ***
28807201-G-A 26661054-G-A BY29012 ***
28808344-C-G 26662197-C-G ZS5558 ***
58891241-C-T 56699630-G-A ***
58916367-C-T 56674504-G-A ***
58970395-A-G 56824248-A-G ***
58970482-G-A 56824335-G-A ***
58999844-C-A 56853697-C-A ***
59000402-C-T 56854255-C-T ***
59003608-G-T 56857461-G-T ***
59010148-G-A 56864001-G-A ***
59012590-T-G 56866443-T-G ***
59012859-C-G 56866712-C-G ***
59013760-A-G 56867613-A-G ***
59013761-G-T 56867614-G-T ***
59013762-T-A 56867615-T-A ***
59014382-A-C 56868235-A-C ***
59018248-G-A 56872101-G-A ***
59018652-C-T 56872505-C-T ***
59019460-G-A 56873313-G-A ***
59021744-A-C 56875597-A-C ***
59026118-G-A 56879971-G-A ***
59026125-G-A 56879978-G-A ***
59026971-A-T 56880824-A-T ***
59032788-C-G 56886641-C-G ***
13206784-C-A 11051108-C-A 14×A***
59013631-T-A 56867484-T-A ***
28794113-G-T 26647966-G-T BY184423 ***
13868786-G-A 11748080-G-A ***
28793951-G-T 26647804-G-T ***
9952643-C-T 10115034-C-T ***
9940967-T-C 10103358-T-C ***
13705971-A-G 11550295-A-G ***
22503322-G-A 20341436-G-A DYZ19 ***
9995229-A-C 10157620-A-C ***
13466157-C-A 11310481-C-A ***
13705935-A-G 11550259-A-G ***
13866569-G-A 11745863-G-A ***
13245451-C-T 11089775-C-T ***
28816328-C-A 26670181-C-A ***
13489483-C-T 11333807-C-T ***
13868523-C-T 11747817-C-T ***
13488547-G-C 11332871-G-C ***
13488557-G-A 11332881-G-A ***
58916340-T-C 56674531-A-G ***
58869801-C-G 56721070-G-C ***
13252795-A-G 11097119-A-G ***
13252779-C-T 11097103-C-T ***
10025135-G-A 10187526-G-A ***
13461369-G-A 11305693-G-A ***
13486386-A-G 11330710-A-G ***
3145129-C-G 3277088-C-G A3158 ***
58824517-T-C 56766354-A-G ***
13246431-C-T 11090755-C-T ***
9909146-T-C 10071537-T-C ***
59002122-G-A 56855975-G-A ***
13466712-G-T 11311036-G-T ***
58842970-G-C 56747901-C-G ***
13470495-G-A 11314819-G-A ***
22504660-A-C 20342774-A-C DYZ19 ***
58876842-C-A 56714029-G-T ***
22366094-G-A 20204208-G-A DYZ19 ***
58905821-G-T 56685050-C-A ***
13711088-T-C 11555412-T-C ***
22509779-G-C 20347893-G-C BY225580 DYZ19 ***
28806739-G-A 26660592-G-A BY151851 ***
9958747-T-G 10121138-T-G ***
13447147-C-T 11291471-C-T ***
22364637-G-C 20202751-G-C DYZ19 ***
22282129-T-C 20120243-T-C DYZ19 ***
13483089-C-T 11327413-C-T FGC46958FGC46952 ***
58853562-C-T 56737309-G-A ***
58844472-A-G 56746399-T-C ***
13199164-C-A 11043488-C-A 18×A***
18003191-T-G 15891311-T-G P7_Gap ***
58833419-G-T 56757452-C-A ***
58916381-C-T 56674490-G-A ***
28796824-G-T 26650677-G-T ***
9958755-A-T 10121146-A-T ***
9924597-A-G 10086988-A-G ***
9916009-G-A 10078400-G-A ***
22249335-A-T 20087449-A-T DYZ19 ***
13465743-T-G 11310067-T-G BY85729 ***
9924454-G-A 10086845-G-A ***
58859848-C-T 56731023-G-A ***
13467926-T-G 11312250-T-G ***
22511115-T-G 20349229-T-G DYZ19 ***
13711449-G-A 11555773-G-A ***
13704446-A-G 11548770-A-G ***
13448716-C-G 11293040-C-G ***
13448744-C-G 11293068-C-G ***
13480786-T-G 11325110-T-G ***
58824554-C-G 56766317-G-C ***
13348902-C-T 11193226-C-T ***
13726401-A-G 11570725-A-G ***
13456056-T-C 11300380-T-C ***
22359469-G-C 20197583-G-C BY50560 DYZ19 ***
2760012-G-A 2891971-G-A ***
9941788-A-T 10104179-A-T ***
58914503-T-C 56676368-A-G ***
13446099-A-T 11290423-A-T ***
13465130-A-C 11309454-A-C A18082 FT36991 ***
22249357-T-A 20087471-T-A DYZ19 ***
58971460-G-C 56825313-G-C ***
13332857-T-A 11177181-T-A ***
13468990-A-G 11313314-A-G ***
13466762-C-A 11311086-C-A ***
13518488-G-T 11362812-G-T ***
13518489-A-C 11362813-A-C ***
13562981-G-C 11407305-G-C ***
24490594-G-A 22344447-G-A FGC28012 ***
58860490-C-G 56730381-G-C ***
13249643-T-C 11093967-T-C ***
13611806-T-C 11456130-T-C ***
13504498-C-CAAAA 11348822-C-CAAAA 12×A***
10069762-C-A 10232153-C-A ***
28807536-C-G 26661389-C-G BY28205 ***
13520001-A-C 11364325-A-C FGC82677 ***
9909196-T-C 10071587-T-C ***
9916021-T-A 10078412-T-A ***
28806789-A-G 26660642-A-G ***
13478341-C-T 11322665-C-T ***
13478342-T-C 11322666-T-C ***
13478343-G-C 11322667-G-C ***
58857375-T-A 56733496-A-T ***
13260009-T-G 11104333-T-G ***
59013625-T-A 56867478-T-A ***
13489361-G-T 11333685-G-T ***
13728999-G-A 11573323-G-A ***
28800378-G-A 26654231-G-A ***
28800418-A-G 26654271-A-G ***
28800419-C-T 26654272-C-T ***
28800421-C-A 26654274-C-A ***
28800436-G-T 26654289-G-T ***
3528378-A-T 3660337-A-T ***
13474581-C-T 11318905-C-T ***
22288157-G-C 20126271-G-C DYZ19 ***
22288158-A-G 20126272-A-G DYZ19 ***
22311667-T-A 20149781-T-A DYZ19 ***
3477887-C-T 3609846-C-T ***
58856701-C-T 56734170-G-A ***
13868197-A-T 11747491-A-T ***
13868192-A-C 11747486-A-C ***
13448673-C-T 11292997-C-T ***
9940951-C-T 10103342-C-T A18569 ***
58914514-A-G 56676357-T-C ***
13511130-T-G 11355454-T-G ***
13853650-A-G 11732944-A-G ***
13853676-T-G 11732970-T-G ***
28787516-A-G 26641369-A-G ***
58900019-A-C 56690852-T-G ***
58900009-A-T 56690862-T-A ***
13500887-T-G 11345211-T-G ***
58853533-C-T 56737338-G-A ***
13465205-C-A 11309529-C-A ***
11025298-C-A ***
11025333-G-T ***
11025365-C-T ***
10666529-C-A ***
10666557-C-A ***
10804737-A-T ***
10958256-C-T ***
10780607-T-C ***
13448833-C-T 11293157-C-T ***
13448835-A-T 11293159-A-T ***
10776775-T-C ***
10972255-A-T ***
10764684-C-G ***
10926596-C-A ***
13447084-C-T 11291408-C-T ***
11029442-A-C ***
11029455-C-A ***
11029460-A-G ***
11029474-C-G ***
13269513-A-G 11113837-A-G ***
10841869-T-C ***
10763227-C-T ***
10763232-G-A ***
8970842-G-A 9133233-G-A 16×A***
10683605-G-C ***
10678974-C-A ***
10747003-C-T ***
10802180-T-C ***
13469058-G-A 11313382-G-A ***
13480479-G-A 11324803-G-A ***
10652062-T-C ***
11031331-T-C ***
56850916-A-G ***
10683144-A-G ***
28800456-A-G 26654309-A-G ***
10895288-A-T ***
9945975-A-T 10108366-A-T ***
13531566-C-T 11375890-C-T ***
13725584-T-G 11569908-T-G ***
13726217-A-G 11570541-A-G ***
13483705-C-A 11328029-C-A ***
11676825-T-A ***
10841890-T-A ***
10841897-A-T ***
10666878-G-C ***
9945960-G-T 10108351-G-T ***
10780793-T-A ***
10673899-A-T ***
11000023-C-T ***
11000036-T-C ***
10994065-T-C ***
13475611-G-T 11319935-G-T ***
13482394-G-T 11326718-G-T ***
10841900-A-T ***
28585607-G-T 26439460-G-T ***
13473956-T-A 11318280-T-A ***
11025350-G-T ***
10061668-T-A 10224059-T-A ***
10061669-A-T 10224060-A-T ***
10061670-C-G 10224061-C-G ***
10666851-C-T ***
13461365-C-G 11305689-C-G ***
56857500-A-T ***
10884981-T-C ***
10771544-C-T ***
11023205-C-G ***
23041253-C-A 20879367-C-A ***
10984341-A-G ***
10780794-G-T ***
11025312-G-A ***
11025337-C-G FT439995 ***
11025345-G-C ***
11018784-C-T ***
13475606-C-A 11319930-C-A ***
22427549-T-A 20265663-T-A DYZ19 ***
13474736-G-A 11319060-G-A ***
13550759-C-A 11395083-C-A ***
10826748-G-C ***
13725838-T-A 11570162-T-A ***
13725858-A-T 11570182-A-T ***
10747171-A-G ***
10747174-G-C ***
10747179-G-C ***
13567202-A-G 11411526-A-G ***
10676629-C-T ***
10676630-A-G ***
13611124-C-T 11455448-C-T ***
10947359-A-T ***
6402024-C-T 6533983-C-T ***
11676555-G-T ***
10679004-G-C ***
56827769-C-T ***
10841841-C-G ***
10841853-A-T ***
10841868-T-A ***
10841870-A-C ***
10841887-G-C ***
10841893-C-T ***
10841902-T-C ***
10841910-T-A ***
10678996-C-G ***
13725644-G-A 11569968-G-A ***
10771838-G-T ***
13712337-G-A 11556661-G-A ***
13725879-C-G 11570203-C-G ***
13706033-A-G 11550357-A-G 10×GAATG***
12372519-A-T ***
10996575-C-A ***
10937772-T-C ***
13468572-T-C 11312896-T-C ***
10672963-C-T ***
13688238-A-C 11532562-A-C ***
10645863-C-T ***
10900663-T-A ***
13710647-G-A 11554971-G-A ***
13447126-C-G 11291450-C-G ***
13700588-T-A 11544912-T-A ***
10894349-A-T ***
10894350-A-C ***
10947459-C-T ***
13489070-A-T 11333394-A-T ***
13489071-G-T 11333395-G-T ***
11014727-G-C ***
11014759-T-A ***
11014755-G-T ***
10987448-C-A ***
56858433-G-A ***
28817710-T-A 26671563-T-A ***
10069824-G-T 10232215-G-T ***
13249584-T-C 11093908-T-C ***
9924486-A-T 10086877-A-T ***
11029456-T-A ***
10678942-C-T ***
11649030-G-A FT450099 ***
10746994-A-T ***
10826736-C-A ***
10663684-T-G ***
10747157-T-A ***
5653401-G-A 5785360-G-A FT254338 ***
6402790-A-G 6534749-A-G ***
6402796-G-A 6534755-G-A FT88960 ***
6403274-C-T 6535233-C-T ***
22361586-C-A 20199700-C-A DYZ19 ***
22511199-T-A 20349313-T-A DYZ19 ***
13475488-A-T 11319812-A-T ***
22510093-T-C 20348207-T-C DYZ19 ***
28805917-G-A 26659770-G-A ***
28815860-G-A 26669713-G-A ***
13262836-C-A 11107160-C-A ***
11001970-C-A ***
10910866-G-C ***
13689320-G-C 11533644-G-C ***
13689325-C-T 11533649-C-T ***
6402775-C-T 6534734-C-T FT133262 ***
13448661-T-C 11292985-T-C ***
13722909-A-C 11567233-A-C ***
58876784-C-A 56714087-G-T ***
13480137-C-A 11324461-C-A ***
28802871-G-C 26656724-G-C ***
9915979-A-G 10078370-A-G ***
13709476-T-A 11553800-T-A ***
10762687-A-G ***
28588184-C-A 26442037-C-A FTB18389 ***
11649029-C-G ***
10651976-C-T FGCLR1057 ***
4378776-T-G 4510735-T-G ***
13449892-T-A 11294216-T-A ***
11001972-C-A ***
10749389-A-T ***
56878705-G-A ***
13489726-C-A 11334050-C-A ***
10624544-C-A ***
10957867-T-G ***
13445880-C-T 11290204-C-T ***
13466535-C-A 11310859-C-A ***
10682802-T-A ***
28814092-C-G 26667945-C-G ***
28814100-T-C 26667953-T-C ***
22509183-G-T 20347297-G-T DYZ19 ***
28806791-G-A 26660644-G-A ***
5930530-T-C 6062489-T-C FT69490 ***
6402782-C-T 6534741-C-T FT136971 ***
6403276-A-C 6535235-A-C ***
13268112-A-G 11112436-A-G ***
13281317-T-C 11125641-T-C ***
28817993-A-T 26671846-A-T ***
28817996-G-T 26671849-G-T ***
58905142-A-T 56685729-T-A ***
13488516-G-A 11332840-G-A ***
56861291-T-A ***
56861298-T-A ***
10798347-A-T ***
10805801-T-A ***
10938570-T-A ***
13483731-A-G 11328055-A-G ***
10749377-A-C ***
18970320-C-A 16858440-C-A 28×A***
10961592-C-T ***
22715143-C-A 20553257-C-A ***
13472033-G-A 11316357-G-A ***
28810144-C-G 26663997-C-G FT462556 ***
28810149-G-A 26664002-G-A ***
28810158-G-A 26664011-G-A ***
10673290-C-G ***
10936789-A-C ***
13718932-A-G 11563256-A-G ***
13711269-C-A 11555593-C-A ***
22364743-G-A 20202857-G-A DYZ19 ***
56721406-G-T ***
56737302-T-A ***
11023206-C-T ***
56676334-G-A ***
10831985-C-A ***
28816263-T-A 26670116-T-A ***
10682833-T-C ***
13531656-C-A 11375980-C-A ***
13249574-A-G 11093898-A-G ***
13438321-G-T 11282645-G-T ***
13638357-T-C 11482681-T-C ***
13638507-T-C 11482831-T-C ***
28816441-T-C 26670294-T-C ***
20603788-A-T 18441902-A-T P5_Dst ***
10996564-A-G ***
13470474-G-C 11314798-G-C ***
28810070-T-A 26663923-T-A ***
28810073-A-G 26663926-A-G ***
28810076-G-T 26663929-G-T ***
28810079-A-G 26663932-A-G ***
28810097-C-T 26663950-C-T ***
10862716-C-T ***
14413210-C-A 12292507-C-A 23×A***
28817852-G-T 26671705-G-T ***
10986730-C-T ***
28793503-A-C 26647356-A-C ***
28790874-T-G 26644727-T-G ***
28790899-G-C 26644752-G-C ***
28806426-G-T 26660279-G-T ***
10884847-C-T ***
13483280-A-T 11327604-A-T ***
13558743-G-A 11403067-G-A ***
28785566-G-C 26639419-G-C ***
10965531-C-A ***
10771912-A-G ***
9964215-A-G 10126606-A-G ***
10826775-T-A ***
10627962-T-C ***
10069733-C-A 10232124-C-A ***
10069751-C-A 10232142-C-A ***
10069755-A-C 10232146-A-C ***
10069760-G-C 10232151-G-C ***
10069766-T-C 10232157-T-C ***
10069769-C-T 10232160-C-T ***
10069800-A-T 10232191-A-T ***
10069808-T-A 10232199-T-A ***
10069813-C-A 10232204-C-A ***
10069821-G-A 10232212-G-A ***
10069826-A-T 10232217-A-T ***
10069829-T-G 10232220-T-G ***
10069830-G-C 10232221-G-C ***
10069831-G-T 10232222-G-T ***
10069844-A-T 10232235-A-T ***
10069848-G-A 10232239-G-A ***
10069851-G-T 10232242-G-T FGC25981 ***
10069858-A-C 10232249-A-C ***
10069862-C-A 10232253-C-A ***
11023200-C-A ***
10624492-T-C ***
10947439-C-A ***
10880258-G-A ***
10862714-T-C ***
13543452-G-A 11387776-G-A ***
9935929-T-A 10098320-T-A ***
28808315-G-A 26662168-G-A ***
10666585-T-C ***
10025660-C-T 10188051-C-T FGC34113 ***
13481853-A-C 11326177-A-C ***
13481864-T-A 11326188-T-A ***
28816338-G-C 26670191-G-C ***
10771900-C-A ***
10692439-A-G ***
13467920-T-A 11312244-T-A ***
12372622-T-C ***
13490793-G-T 11335117-G-T FT444252 ***
10069316-G-C 10231707-G-C ***
13466214-G-C 11310538-G-C ***
13481835-T-C 11326159-T-C ***
28790919-A-C 26644772-A-C ***
9924455-T-A 10086846-T-A ***
9936695-T-C 10099086-T-C ***
9945360-G-A 10107751-G-A FTA6486 ***
9951552-A-G 10113943-A-G ***
10626905-C-G ***
10753146-T-C ***
10771899-A-C ***
10798728-T-A ***
10798734-T-C ***
10798746-C-G ***
10882331-C-T ***
10882332-T-C ***
10882336-A-G ***
10987080-A-G ***
11002127-G-C ***
13375755-C-G 11220079-C-G ***
13435604-T-A 11279928-T-A ***
13439676-G-C 11284000-G-C ***
13442777-G-A 11287101-G-A ***
13445142-A-G 11289466-A-G ***
13445770-C-A 11290094-C-A ***
13465342-T-A 11309666-T-A ***
13466560-A-T 11310884-A-T ***
13473925-A-T 11318249-A-T ***
13474277-C-A 11318601-C-A ***
13474304-C-T 11318628-C-T ***
13474343-C-G 11318667-C-G ***
13475304-T-C 11319628-T-C ***
13475599-G-C 11319923-G-C ***
13480038-G-C 11324362-G-C ***
13480065-A-G 11324389-A-G ***
13480073-T-A 11324397-T-A ***
13481201-C-G 11325525-C-G ***
13482530-A-G 11326854-A-G ***
13485349-C-T 11329673-C-T ***
13489717-C-G 11334041-C-G ***
13489776-C-A 11334100-C-A ***
13489799-C-G 11334123-C-G ***
13498814-T-C 11343138-T-C ***
13504123-A-G 11348447-A-G ***
13504926-T-G 11349250-T-G ***
13505361-T-C 11349685-T-C ***
13505936-A-G 11350260-A-G ***
13512551-A-G 11356875-A-G ***
13512559-G-A 11356883-G-A ***
13512567-T-A 11356891-T-A ***
13534069-C-T 11378393-C-T ***
13534070-T-C 11378394-T-C ***
13543556-T-G 11387880-T-G ***
13543575-C-G 11387899-C-G ***
13546343-A-G 11390667-A-G ***
13551380-C-T 11395704-C-T ***
13552295-G-T 11396619-G-T ***
13558165-G-C 11402489-G-C ***
13559944-A-C 11404268-A-C ***
13560186-G-T 11404510-G-T ***
13560196-A-C 11404520-A-C ***
13564754-C-T 11409078-C-T ***
13573846-T-A 11418170-T-A ***
13573941-A-G 11418265-A-G ***
13573986-A-G 11418310-A-G ***
13578047-A-G 11422371-A-G ***
13611120-A-C 11455444-A-C ***
13692512-A-C 11536836-A-C ***
13706265-A-G 11550589-A-G ***
13810757-T-C 11690051-T-C ***
13827247-T-A 11706541-T-A ***
13827308-G-T 11706602-G-T ***
13830058-T-G 11709352-T-G ***
13830085-A-T 11709379-A-T ***
13867050-G-A 11746344-G-A ***
28584244-T-G 26438097-T-G ***
28785193-T-C 26639046-T-C ***
28786900-A-G 26640753-A-G ***
28786917-T-A 26640770-T-A ***
28788970-T-A 26642823-T-A ***
28790857-T-A 26644710-T-A ***
28790866-A-G 26644719-A-G ***
28790878-A-G 26644731-A-G ***
28790907-G-C 26644760-G-C ***
28790914-C-A 26644767-C-A ***
28790962-C-T 26644815-C-T ***
28792807-T-C 26646660-T-C ***
28792829-A-C 26646682-A-C ***
28793460-G-C 26647313-G-C ***
28793464-T-A 26647317-T-A ***
28793877-T-A 26647730-T-A ***
28805309-A-C 26659162-A-C ***
28807034-A-G 26660887-A-G ***
28807058-C-A 26660911-C-A ***
28807102-A-C 26660955-A-C ***
28807159-T-C 26661012-T-C FT462430 ***
28807233-C-A 26661086-C-A ***
28808248-G-T 26662101-G-T ***
28808250-C-G 26662103-C-G ***
28808255-G-T 26662108-G-T ***
28808258-C-T 26662111-C-T ***
28808346-A-C 26662199-A-C ***
28809587-G-A 26663440-G-A ***
28809636-C-A 26663489-C-A ***
28810017-A-T 26663870-A-T ***
28810025-A-C 26663878-A-C ***
28810045-A-G 26663898-A-G ***
28812484-A-G 26666337-A-G ***
28814294-G-C 26668147-G-C ***
28814300-T-A 26668153-T-A ***
28814318-A-C 26668171-A-C ***
28814563-A-G,T 26668416-A-G,T ***
28816291-G-A 26670144-G-A ***
28816457-C-T 26670310-C-T ***
28816464-G-C 26670317-G-C ***
28816471-C-T 26670324-C-T ***
28816479-C-G 26670332-C-G ***
28817614-C-G 26671467-C-G ***
56685753-A-G ***
9914492-T-A 10076883-T-A ***
9915970-C-A 10078361-C-A ***
9916106-T-A 10078497-T-A ***
9972236-G-C 10134627-G-C ***
9972255-C-A 10134646-C-A ***
10039718-G-T 10202109-G-T ***
10039721-C-G 10202112-C-G ***
10054039-T-C 10216430-T-C ***
10624530-G-C ***
10654431-C-G ***
10682801-C-A ***
10682804-T-G ***
10692548-A-T ***
10787774-G-T ***
10894251-C-T ***
10947454-T-C ***
13241943-G-A 11086267-G-A ***
13242063-G-A 11086387-G-A ***
13245130-G-T 11089454-G-T ***
13245441-G-A 11089765-G-A ***
13252978-G-A 11097302-G-A ***
13253002-T-A 11097326-T-A ***
13253057-C-T 11097381-C-T ***
13375468-T-A 11219792-T-A ***
13375484-G-A 11219808-G-A ***
13375486-T-A 11219810-T-A ***
13375804-A-G 11220128-A-G ***
13439749-C-A 11284073-C-A ***
13474544-G-A 11318868-G-A ***
13476084-C-T 11320408-C-T ***
13476293-G-A 11320617-G-A ***
13476294-A-G 11320618-A-G ***
13482830-A-G 11327154-A-G ***
13482831-G-A 11327155-G-A ***
13482852-C-T 11327176-C-T BY210382 ***
13489338-C-G 11333662-C-G ***
13499203-C-T 11343527-C-T ***
13506614-A-T 11350938-A-T ***
13514338-C-T 11358662-C-T ***
13516291-C-A 11360615-C-A ***
13519972-G-A 11364296-G-A ***
13523973-C-T 11368297-C-T ***
13528329-C-G 11372653-C-G ***
13531525-T-C 11375849-T-C ***
13534073-C-A 11378397-C-A ***
13539590-G-T 11383914-G-T ***
13543341-G-A 11387665-G-A ***
13556996-T-A 11401320-T-A ***
13598437-A-T 11442761-A-T ***
13694120-T-G 11538444-T-G ***
13694136-A-G 11538460-A-G ***
13705116-G-T 11549440-G-T ***
13709195-A-G 11553519-A-G BY211246 8×GAATG***
22279202-C-A 20117316-C-A DYZ19 ***
22288134-A-G 20126248-A-G DYZ19 ***
22359390-T-C 20197504-T-C DYZ19 ***
28585388-G-A 26439241-G-A ***
28790954-G-T 26644807-G-T ***
28807259-A-T 26661112-A-T ***
28810255-A-G 26664108-A-G ***
56875564-A-G ***
56881291-G-T ***
13482758-T-A 11327082-T-A ***
13482806-A-C 11327130-A-C ***
28810199-G-T 26664052-G-T ***
28810264-G-C 26664117-G-C ***
13466742-C-A 11311066-C-A ***
13481907-T-C 11326231-T-C ***
13532890-A-G 11377214-A-G ***
13556051-G-T 11400375-G-T ***
9940583-T-A 10102974-T-A ***
10826512-C-T ***
10940018-A-T ***
11029507-G-A FT440141 ***
11029508-T-C ***
13482496-G-C 11326820-G-C ***
13482502-A-T 11326826-A-T ***
13482550-T-A 11326874-T-A ***
13482555-A-C 11326879-A-C ***
13482566-A-G 11326890-A-G ***
13543634-A-G 11387958-A-G ***
13846242-A-G 11725536-A-G ***
28810277-T-A 26664130-T-A ***
56885518-G-A ***
13481382-A-G 11325706-A-G ***
13518182-C-T 11362506-C-T FT444670 ***
13483827-C-A 11328151-C-A ***
16642623-G-T 14530743-G-T ***
16642624-G-C 14530744-G-C ***
22366132-A-C 20204246-A-C DYZ19 ***
13335889-A-G 11180213-A-G FGC81667 ***
9946013-C-G 10108404-C-G ***
9964242-A-G 10126633-A-G ***
10061648-T-C 10224039-T-C ***
10061651-C-G 10224042-C-G ***
10061653-G-C 10224044-G-C ***
10803285-T-G ***
10803293-T-G ***
10803296-C-G ***
10830686-A-G ***
10830698-T-G ***
10872243-T-A ***
11029523-T-G ***
13247379-C-T 11091703-C-T ***
13466421-A-C 11310745-A-C ***
13513146-C-A 11357470-C-A ***
13540678-C-T 11385002-C-T FT258200 ***
13564984-C-A 11409308-C-A ***
13591085-C-T 11435409-C-T ***
13591086-T-G 11435410-T-G ***
13608957-C-T 11453281-C-T ***
12372657-C-A ***
22294693-G-C 20132807-G-C DYZ19 ***
22294694-C-T 20132808-C-T FT455339 DYZ19 ***
13436002-G-C 11280326-G-C ***
13468344-T-A 11312668-T-A ***
28549179-G-A 26403032-G-A ***
13559043-C-T 11403367-C-T A19675FT258152 ***
9960784-G-A 10123175-G-A ***
10791121-T-C ***
13404738-G-A 11249062-G-A ***
10791124-A-T ***
10802080-C-G ***
10802091-C-A ***
13396438-G-A 11240762-G-A ***
13440024-C-A 11284348-C-A ***
13446133-T-A 11290457-T-A ***
13480023-T-C 11324347-T-C ***
13480053-A-T 11324377-A-T ***
13480090-C-T 11324414-C-T ***
13493133-A-C 11337457-A-C ***
13509024-C-A 11353348-C-A ***
13711806-A-T 11556130-A-T ***
13375810-C-A 11220134-C-A ***
56837222-C-T ***
13470574-A-C 11314898-A-C ***
10025444-G-C 10187835-G-C ***
13465116-C-A 11309440-C-A ***
13422989-T-G 11267313-T-G ***
13468827-G-T 11313151-G-T ***
56707471-A-C ***
10624565-G-T ***
13473673-C-A 11317997-C-A ***
13535178-T-G 11379502-T-G ***
9958828-G-A 10121219-G-A ***
9960621-T-G 10123012-T-G ***
9972929-G-T 10135320-G-T ***
13413226-G-C 11257550-G-C ***
13492646-C-T 11336970-C-T ***
13500860-G-A 11345184-G-A ***
28549172-C-G 26403025-C-G ***
9972279-G-T 10134670-G-T ***
9972343-A-C 10134734-A-C ***
13251368-A-T 11095692-A-T ***
13607516-T-C 11451840-T-C ***
28585988-C-CA 26439841-C-CA ***
24490535-C-T 22344388-C-T ***
9951436-C-G 10113827-C-G ***
13827328-A-T 11706622-A-T ***
13827389-A-G 11706683-A-G ***
13846538-T-A 11725832-T-A ***
9924393-T-G 10086784-T-G ***
10780782-G-A ***
13477999-G-C 11322323-G-C ***
9936734-G-A 10099125-G-A ***
13249655-T-G 11093979-T-G ***
13534912-T-C 11379236-T-C ***
13543601-G-C 11387925-G-C ***
13517323-C-A 11361647-C-A ***
5348831-T-C 5480790-T-C ***
13252936-C-T 11097260-C-T ***
22509008-T-A 20347122-T-A DYZ19 ***
10788286-C-T FTB68221 ***
13535164-C-A 11379488-C-A ***
13535167-T-C 11379491-T-C ***
13638223-T-A 11482547-T-A ***
13705984-C-T 11550308-C-T ***
22508927-G-T 20347041-G-T DYZ19 ***
10855733-A-G ***
10659397-T-C ***
10659400-C-A ***
13827263-T-A 11706557-T-A ***
13827353-G-A 11706647-G-A BY90764 ***
13827354-A-G 11706648-A-G ***
13827381-C-G 11706675-C-G ***
3345364-G-T 3477323-G-T ***
5647831-T-G 5779790-T-G ***
6145516-A-T 6277475-A-T IR3_Dst ***
6145866-G-A 6277825-G-A IR3_Dst ***
8173988-T-G 8305947-T-G ***
9188252-G-A 9350643-G-A ***
9923952-A-T 10086343-A-T ***
9940588-A-T 10102979-A-T ***
9972850-C-T 10135241-C-T ***
9972858-C-T 10135249-C-T ***
9972859-A-G 10135250-A-G ***
9972873-A-G 10135264-A-G ***
9972882-T-G 10135273-T-G ***
9977723-C-T 10140114-C-T ***
9977809-T-A 10140200-T-A ***
9995179-G-A 10157570-G-A ***
10025443-G-T 10187834-G-T ***
10025447-C-T 10187838-C-T FT376463 ***
10069264-T-C 10231655-T-C ***
10069272-G-C 10231663-G-C ***
10069299-C-A 10231690-C-A ***
10069324-A-T 10231715-A-T ***
10069328-C-A 10231719-C-A ***
10069358-C-G 10231749-C-G ***
10624493-G-A ***
10624497-A-G ***
10624507-T-C ***
10624518-A-G ***
10624523-T-C ***
10624527-A-G ***
10624528-G-A ***
10624529-A-G ***
10624541-G-C ***
10624548-T-C ***
10625273-T-G ***
10625275-A-C ***
10625306-A-T ***
10631175-C-T ***
10631203-T-G ***
10666590-C-T ***
10678034-T-C ***
10754800-C-T ***
10754814-G-T ***
10754843-G-C ***
10776766-A-G ***
10789171-A-G ***
10798337-A-G ***
10798357-A-T ***
10799180-T-G ***
10805797-T-C ***
10826783-C-T ***
10842087-T-G ***
10864194-T-C ***
10880267-C-G ***
10910835-C-A ***
10935171-C-T ***
10940036-C-G ***
10983887-T-C ***
11018770-T-C ***
11018788-A-T ***
11018793-A-T ***
11029601-T-A ***
13241986-G-A 11086310-G-A ***
13246024-T-C 11090348-T-C ***
13246025-G-A 11090349-G-A ***
13262715-G-C 11107039-G-C ***
13283402-T-C 11127726-T-C ***
13348830-A-G 11193154-A-G ***
13404857-A-G 11249181-A-G ***
13405543-G-A 11249867-G-A ***
13405600-C-A 11249924-C-A ***
13435912-A-T 11280236-A-T ***
13436037-A-G 11280361-A-G ***
13436144-T-A 11280468-T-A ***
13443502-A-T 11287826-A-T ***
13444505-G-A 11288829-G-A ***
13444614-T-A 11288938-T-A ***
13444623-G-A 11288947-G-A ***
13445143-C-G 11289467-C-G ***
13460635-G-T 11304959-G-T ***
13465338-T-A 11309662-T-A ***
13469709-T-A 11314033-T-A ***
13473728-C-T 11318052-C-T ***
13475226-A-T 11319550-A-T ***
13475232-C-T 11319556-C-T ***
13479402-C-T 11323726-C-T ***
13479403-A-G 11323727-A-G ***
13479465-T-C 11323789-T-C ***
13480158-C-A 11324482-C-A ***
13481280-A-T 11325604-A-T ***
13482379-G-A 11326703-G-A ***
13482610-T-G 11326934-T-G ***
13482618-T-A 11326942-T-A ***
13483139-A-C 11327463-A-C ***
13484154-C-A 11328478-C-A ***
13484433-G-A 11328757-G-A ***
13485485-C-T 11329809-C-T ***
13486404-A-T 11330728-A-T ***
13486406-C-T 11330730-C-T ***
13494577-G-C 11338901-G-C ***
13501657-A-T 11345981-A-T ***
13502529-A-T 11346853-A-T ***
13506468-T-A 11350792-T-A ***
13507457-C-A 11351781-C-A ***
13514211-A-C 11358535-A-C ***
13527830-A-T 11372154-A-T ***
13531518-CA-C 11375842-CA-C ***
13533372-C-A 11377696-C-A ***
13537901-G-T 11382225-G-T ***
13558975-A-G 11403299-A-G ***
13559055-G-A 11403379-G-A ***
13559064-A-C 11403388-A-C ***
13559069-C-A 11403393-C-A ***
13559094-G-A 11403418-G-A FT445375 ***
13560225-T-G 11404549-T-G ***
13560237-C-T 11404561-C-T ***
13560282-A-G 11404606-A-G ***
13562324-T-C 11406648-T-C ***
13563971-G-T 11408295-G-T FT358467 ***
13564164-A-T 11408488-A-T ***
13569737-C-A 11414061-C-A ***
13591336-A-G 11435660-A-G ***
13607490-T-C 11451814-T-C ***
13607493-C-T 11451817-C-T ***
13610809-A-G 11455133-A-G ***
13688970-G-A 11533294-G-A ***
13689305-G-T 11533629-G-T ***
13690745-C-G 11535069-C-G ***
13692931-A-C 11537255-A-C ***
13711845-A-T 11556169-A-T ***
13715037-G-C 11559361-G-C ***
13718326-G-C 11562650-G-C ***
11649022-T-A ***
11649049-G-T ***
11649064-A-G ***
11676829-C-T ***
13827297-T-A 11706591-T-A ***
13827301-A-C 11706595-A-C ***
13827319-G-A 11706613-G-A ***
13827320-G-A 11706614-G-A ***
13827322-C-G 11706616-C-G ***
13827384-C-G 11706678-C-G ***
13827422-T-A 11706716-T-A ***
13842797-T-A 11722091-T-A ***
13846240-G-C 11725534-G-C ***
13846255-G-C 11725549-G-C ***
13846275-G-C 11725569-G-C ***
13846483-T-C 11725777-T-C ***
13846508-T-A 11725802-T-A ***
13846619-G-A 11725913-G-A ***
13853692-G-A 11732986-G-A ***
13853713-G-C 11733007-G-C ***
13867037-A-G 11746331-A-G ***
13868961-A-G 11748255-A-G ***
12372513-C-T ***
12372647-T-C ***
12372661-A-T ***
15928448-G-T 13816568-G-T ***
20984564-C-T 18822678-C-T P4_Dst ***
21922015-A-T 19760129-A-T ***
22280110-T-G 20118224-T-G DYZ19 ***
22288136-G-T 20126250-G-T DYZ19 ***
22288137-T-A 20126251-T-A DYZ19 ***
22317793-G-T 20155907-G-T DYZ19 ***
22325830-T-C 20163944-T-C DYZ19 ***
22364738-T-A 20202852-T-A DYZ19 ***
22367132-A-C 20205246-A-C DYZ19 ***
22438036-C-T 20276150-C-T DYZ19 ***
22486265-G-C 20324379-G-C DYZ19 ***
22490576-G-T 20328690-G-T DYZ19 ***
22510533-G-T 20348647-G-T DYZ19 ***
22510565-C-G 20348679-C-G DYZ19 ***
24388381-G-A 22242234-G-A ***
24388397-C-T 22242250-C-T ***
24490553-G-A 22344406-G-A ***
24490557-T-C 22344410-T-C ***
24490558-G-A 22344411-G-A ***
24490559-G-T 22344412-G-T ***
26495816-T-A 24349669-T-A P1_Y1 ***
27507473-T-G 25361326-T-G P1_Y2 ***
27586012-C-A 25439865-C-A P1_Y2 ***
28585976-C-CT 26439829-C-CT ***
28785894-T-A 26639747-T-A ***
28785900-G-A 26639753-G-A ***
28794085-A-G 26647938-A-G ***
28794116-T-A 26647969-T-A ***
28795818-G-T 26649671-G-T ***
28805922-G-A 26659775-G-A ***
28806247-T-C 26660100-T-C ***
28810143-G-A 26663996-G-A ***
28810163-G-C 26664016-G-C ***
28810168-G-A 26664021-G-A ***
28812618-G-C 26666471-G-C ***
28814553-T-G 26668406-T-G ***
28814889-G-C 26668742-G-C ***
28818904-A-C 26672757-A-C ***
56676422-T-C ***
56735528-G-T ***
56736157-T-C ***
56737109-G-C ***
56851502-T-C ***
56855373-C-T ***
56878180-A-T ***
28543-T-C ***
28551-G-T ***

In the table above, the meaning of the confidence field depends on whether the data comes from an FTDNA kit or an FGC kit. For FTDNA kits, + implies a "PASS" result with just one possible variant, * indicates a "PASS" but with multiple variants, ** indicates "REJECTED" with just a single variant, and *** indicates "REJECTED" with multiple possible variants. 'A*' are heterozygous variants not called by FTDNA, but still pulled from the VCF file. For FGC kits, + indicates over 99% likely genuine (95% for INDELs); * over 95% likely genuine (90% for INDELs); ** about 40% likely genuine; *** about 10% likely genuine. Manual entries read directly from a BAM file will be either + indicating positive, or * indicating that the data show a mixture of possible variants.

For the FTDNA kits, the BED data is encoded in the background color of the cells. Those cells with a white background have coverage, those with a grey background indicate no coverage in the BED file, and those with a pink background indicate the mutation is on the edge of a coverage region. These pink regions often indicate that the individual may be positive for a SNP even if there is no corresponding entry in the vcf file.

The combBED column indicates whether or not the mutation is a SNP and falls in the combBED region defined in Defining a New Rate Constant for Y-Chromosome SNPs based on Full Sequencing Data by Dmitry Adamov, Vladimir Guryanov, Sergey Karzhavin, Vladimir Tagankin, Vadim Urasin.

The McDonald BED column indicates whether or not the mutation is a SNP and falls in the BED region used by Dr. Iain McDonald in the age analysis he does for R-U106 men.

Mutation Notes:

Kit POSITION-REF-ALT (hg19) POSITION-REF-ALT (hg38) Note
11R9D22425775-C-A20263889-C-AI'm not sure how many ambiguous positions are involved, but at least some of them show the C to A mutation.
11R9D25353250-TTTTG-T23207103-TTTTG-TFound in BAM file. Looks like 26 of 98 reads have this mutation. It is found in red palindromic region with a total of 4 ambiguous positions.
11R9D22284969-T-G20123083-T-GChecked BAM file. There are 693 reads which cover this position. There are 4 with an A and 3 with a C, non of which look like they belong there. 124 reads with a G. 562 with a T.