Tree Position

R-P312/S116 > Z290 > L21/S145 > DF13 > ZZ10 > Z253 > ZZ6 > FGC3249 > FGC3236 > FGC3251 > FGC3263 > L430

Unique Mutations

The mutations unique to this man are summarized in the table below. Those with a '+' or '*' confidence level are considered by FamilyTreeDNA or FullGenomesCorp to be high quality SNPs/INDELs. For completeness, all other mutations of lesser confidence are included as well. These additional mutations may be useful for distinguishing between very closely related men.

Occasionally, some of the mutations listed here will be thought to be shared with other men in which case they might appear in upstream blocks on the tree. When this happens, the 'Blocks' field will indicate what block they appear in. Such a situation might arise with BigY men if the BED data suggests another man may be positive for a SNP, even though it doesn't appear in his VCF data. It might also happen if Chromo2 testing or Sanger sequencing of other men not on the tree show the SNP to be shared.

POS-REF-ALT (hg19) POS-REF-ALT (hg38) Blocks Names Region McDonald BED combBED STRFTDNA
99512
BigY2
99512
FGC
PY5HU
26010993-G-C 23864846-G-C P1_Y1 ***A*
23512827-T-G 21350941-T-G FGC3266 Y+
24478742-C-A 22332595-C-A FGC3267 Y+++
13946653-G-A 11825947-G-A FGC3241 Y14634 YY+++
16210460-C-A 14098580-C-A FGC3219 Z14282 Y+
6081837-A-T 6213796-A-T **
5609470-G-A 5741429-G-A **
5755871-G-T 5887830-G-T **
9946118-T-G 10108509-T-G **
5688472-T-A 5820431-T-A **
5449892-A-T 5581851-A-T **
5603908-C-A 5735867-C-A **
10043231-A-G 10205622-A-G **
5448791-T-C 5580750-T-C **
5292252-C-A 5424211-C-A **
5275425-T-C 5407384-T-C **
5242855-C-A 5374814-C-A **
9942475-G-C 10104866-G-C **
13469478-A-C 11313802-A-C *****
5785350-C-A 5917309-C-A **
6971774-C-A 7103733-C-A **
5976871-G-A 6108830-G-A **
6654500-C-A 6786459-C-A **
6930708-C-G 7062667-C-G **
6915949-C-T 7047908-C-T **
6868936-C-A 7000895-C-A **
6828418-T-A 6960377-T-A **
58844021-CTTCCATTTCCATTCGA-C 56746826-GAATGGAATCGAATGGA-G **
6784337-C-A 6916296-C-A **
6663124-G-A 6795083-G-A **
6654002-A-G 6785961-A-G **
5167164-T-C 5299123-T-C **
6619616-A-G 6751575-A-G **
6530652-C-A 6662611-C-A **
6486809-C-A 6618768-C-A **
6486789-C-A 6618748-C-A **
6228209-A-AAAAACAC 6360168-A-AAAAACAC IR3_Dst **
6092447-C-A 6224406-C-A **
6010173-C-A 6142132-C-A **
13432553-C-T 11276877-C-T **
4937191-C-A 5069150-C-A **
5035555-G-T 5167514-G-T **
3445440-T-A 3577399-T-A **
3591730-A-G 3723689-A-G **
3576857-G-T 3708816-G-T **
3514351-C-A 3646310-C-A **
3448552-G-T 3580511-G-T **
3445528-A-T 3577487-A-T **
3445446-T-G 3577405-T-G **
3389576-C-A 3521535-C-A **
3839041-T-C 3971000-T-C **
3267377-T-G 3399336-T-G **
3178227-A-C 3310186-A-C **
3175797-G-A 3307756-G-A **
3122347-T-A 3254306-T-A **
3105357-G-T 3237316-G-T **
3051458-T-G 3183417-T-G **
3821578-T-C 3953537-T-C **
3847411-C-A 3979370-C-A **
4957619-A-G 5089578-A-G **
4540221-A-C 4672180-A-C **
58840797-TTTCCATTCTCTTCGATTCCATTTCTTTATATTCCATGCCATTCGA-T 56750019-TAGAATGGAATCGAATGGCATGGAATATAAAGAAATGGAATCGAAG-T **
4919354-T-A 5051313-T-A **
4672258-C-A 4804217-C-A **
4626292-T-G 4758251-T-G **
4568424-G-T 4700383-G-T **
4540656-C-A 4672615-C-A **
4495552-G-A 4627511-G-A **
4100672-C-A 4232631-C-A **
4495462-G-A 4627421-G-A **
4388098-A-C 4520057-A-C **
4388014-A-G 4519973-A-G **
4222745-CA-C 4354704-CA-C 9×A**
4214943-C-A 4346902-C-A **
4108228-A-G 4240187-A-G **
6953403-G-T 7085362-G-T **
7080206-C-A 7212165-C-A **
7061021-C-G 7192980-C-G **
9859112-G-A 10021503-G-A **
10060716-C-A 10223107-C-A **
10037635-C-A 10200026-C-A **
10028262-A-G 10190653-A-G **
9961306-C-A 10123697-C-A **
9946060-A-G 10108451-A-G **
9926813-G-A 10089204-G-A **
9852760-C-A 10015151-C-A **
10671215-C-A **
9605326-T-TAGTG 9767717-T-TAGTG IR3_Prx **
9471738-G-T 9634129-G-T **
9140239-G-T 9302630-G-T **
8906946-C-A 9038905-C-A **
8850756-T-A 8982715-T-A **
8790142-C-A 8922101-C-A **
8713165-G-A 8845124-G-A **
10669691-C-G **
10756224-GTCCACTCCACTCCACTCTCCTCAACTACAT-G **
8699412-A-G 8831371-A-G **
10860262-A-T **
10940282-T-G **
10940276-A-G **
10940273-C-A **
10918107-G-T **
10915721-GT-G **
10876617-A-T **
10813315-G-T **
10759942-C-A **
10787949-T-C **
10787661-C-A **
10787188-C-A **
10786213-C-A **
10778959-T-A **
10767971-C-G **
20326007-C-CTTTTTTT 18164121-C-CTTTTTTT P5_Dst 29×T**
8709865-GC-G 8841824-GC-G **
8677986-C-A 8809945-C-A **
2959541-T-G 3091500-T-G **
7186157-C-A 7318116-C-A **
7248524-C-A 7380483-C-A **
7243850-C-A 7375809-C-A **
7197434-G-A 7329393-G-A **
7197330-C-A 7329289-C-A **
7186785-C-A 7318744-C-A **
56858047-G-T **
7185349-C-A 7317308-C-A **
7313719-C-A 7445678-C-A **
7152998-C-A 7284957-C-A **
7134702-C-A 7266661-C-A **
7132172-G-T 7264131-G-T **
7115535-G-T 7247494-G-T **
7099302-C-A 7231261-C-A **
7083762-C-A 7215721-C-A **
7081293-A-T 7213252-A-T **
7270303-A-TT 7402262-A-TT **
7333873-C-A 7465832-C-A **
8673920-C-A 8805879-C-A **
7643119-C-A 7775078-C-A **
8154166-T-C 8286125-T-C **
8043134-C-A 8175093-C-A **
7717824-G-T 7849783-G-T **
7699435-T-A 7831394-T-A **
7699409-C-G 7831368-C-G **
7699400-C-A 7831359-C-A **
7633189-C-A 7765148-C-A **
7353117-C-A 7485076-C-A **
7621186-C-A 7753145-C-A **
7501288-T-C 7633247-T-C IR1_L **
7418665-C-T 7550624-C-T **
7409538-C-A 7541497-C-A **
7385609-C-A 7517568-C-A **
7362120-C-A 7494079-C-A **
7359827-GA-G 7491786-GA-G **
2959601-T-A 3091560-T-A **
2767809-A-G 2899768-A-G **
2948977-A-G 3080936-A-G **
11022013-T-C **
13871961-C-A 11751255-C-A **
27417818-G-T 25271671-G-T P1_g3 **
10822675-C-A **
14605855-C-A 12494057-C-A **
19235197-C-CT 17123317-C-CT 9×T**
10895831-C-G **
10994131-A-T **
26046021-G-T 23899874-G-T P1_Y1 **
14570755-CATTTTT-C 12458955-CATTTTT-C **
56827764-C-T **
10895870-C-A **
5449902-G-T 5581861-G-T **
6634257-A-T 6766216-A-T **
14977296-CTTT-C 12865371-CTTT-C 15×T**
11025409-T-C **
20645886-G-T 18484000-G-T P4_Prx **
13435837-G-A 11280161-G-A **
8389597-GAC-G 8521556-GAC-G **
10984459-A-C **
18858626-T-A 16746746-T-A **
16860748-GC-A 14748868-GC-A **
10995800-A-T **
4374796-C-A 4506755-C-A **
10925626-T-TTTCTC **
7270306-C-A 7402265-C-A **
21426964-C-A 19265078-C-A **
19023207-C-A 16911327-C-A **
13480403-T-A 11324727-T-A **
5189693-C-A 5321652-C-A **
25995485-C-T 23849338-C-T P1_Y1 **
26415665-C-A 24269518-C-A P1_Y1 **
26010371-A-T 23864224-A-T P1_Y1 **
27417823-G-C 25271676-G-C P1_g3 **
5275492-G-T 5407451-G-T **
15755236-C-A 13643356-C-A **
18354140-G-T 16242260-G-T P6_Prx **
26834849-G-A 24688702-G-A P1_g2 **
58882412-ACATTCGATTTCTTGT-A 56708434-GAATCGAATGACAAGA-G **
21363027-T-A 19201141-T-A **
22739716-C-CAAAAA 20577830-C-CAAAAA 24×A**
7490451-G-A 7622410-G-A IR1_L **
9605319-T-A 9767710-T-A IR3_Prx **
7270327-A-C 7402286-A-C **
3256138-ATTT-A 3388097-ATTT-A 15×T**
19765809-CTTTTTTTTTT-C 17653929-CTTTTTTTTTT-C P5_Prx 22×T**
15863150-C-A 13751270-C-A PF2355 **
13941041-T-C 11820335-T-C Y23313 **
21426991-C-A 19265105-C-A 12×A**
24643260-C-T 22497113-C-T P3_t2 **
20645876-A-T 18483990-A-T P4_Prx **
59006232-A-G 56860085-A-G **
15604354-CAAAAAA-C 13492474-CAAAAAA-C 20×A**
27585944-A-G 25439797-A-G P1_Y2 **
9957215-C-T 10119606-C-T **
19604809-CAAA-C 17492929-CAAA-C P5_Prx 19×A**
10965522-T-C **
10799655-C-T **
3340689-C-A 3472648-C-A **
16181296-C-A 14069416-C-A **
4959359-C-A 5091318-C-A **
24895672-T-A 22749525-T-A g1 **
4840743-C-A 4972702-C-A **
6978237-C-A 7110196-C-A **
13447109-T-C 11291433-T-C **
13469487-A-G 11313811-A-G **
58882393-A-C 56708478-T-G **
9964942-C-T 10127333-C-T **
20242459-CTG-C 18080573-CTG-C P5_Dst **
19520828-C-A 17408948-C-A **
21132671-A-T 18970785-A-T **
10667134-C-A **
18688310-C-A 16576430-C-A FGC64203 **
2795658-C-A 2927617-C-A **
13428067-C-T 11272391-C-T **
4063211-C-A 4195170-C-A **
9063226-C-A 9225617-C-A **
23098803-T-A 20936917-T-A **
27417813-G-C 25271666-G-C P1_g3 **
10825235-C-A **
13428072-A-T 11272396-A-T **
15860270-C-A 13748390-C-A **
10940288-C-T **
14845520-T-C 12733586-T-C **
17703234-T-C 15591354-T-C **
3389934-C-A 3521893-C-A **
18855431-G-T 16743551-G-T **
20689816-T-TA 18527930-T-TA P4_Prx **
23881908-T-A 21720022-T-A **
10940338-C-T **
10925654-C-A **
2860292-C-A 2992251-C-A **
25872066-C-A 23725919-C-A P1_Y1 **
2773724-T-G 2905683-T-G **
10958708-C-T **
2767775-C-A 2899734-C-A **
2745216-C-G 2877175-C-G **
5247345-C-A 5379304-C-A **
6001444-C-A 6133403-C-A **
21367690-A-T 19205804-A-T 14×T**
21323492-C-A 19161606-C-A **
5443904-C-A 5575863-C-A **
13945231-C-A 11824525-C-A **
22846006-C-A 20684120-C-A **
17605076-C-A 15493196-C-A **
24290683-TAA-T 22144536-TAA-T P3_t1 11×A**
58867167-TTTCCATTCCATTTCA-T 56723679-AGGAATGGAATGAAAT-A **
13973153-C-A 11852447-C-A **
21189667-T-A 19027781-T-A **
7154818-AC-A 7286777-AC-A **
17090875-C-T 14978995-C-T **
10825295-C-AGGTTA **
15495307-C-A 13383427-C-A **
28802763-G-T 26656616-G-T **
4616734-C-A 4748693-C-A **
20850616-GT-G 18688730-GT-G P4_Dst **
2906740-C-A 3038699-C-A **
13457776-C-A 11302100-C-A **
9967301-C-A 10129692-C-A **
9931363-GT-G 10093754-GT-G 9×T**
10916099-G-T **
20440398-G-GTTT 18278512-G-GTTT P5_Dst **
2847185-C-A 2979144-C-A **
10940318-T-A **
11671221-C-A **
10940320-C-A **
27647719-C-A 25501572-C-A P1_Y2 **
16220923-C-A 14109043-C-A **
7252408-C-A 7384367-C-A **
17199520-C-A 15087640-C-A **
10979583-C-A **
8058598-C-A 8190557-C-A **
6177446-A-T 6309405-A-T IR3_Dst **
14236008-C-A 12115302-C-A **
19520825-G-A 17408945-G-A **
15712328-C-A 13600448-C-A **
13939171-C-A 11818465-C-A **
7039842-G-T 7171801-G-T **
10809516-G-T **
10940326-C-T **
8154164-G-T 8286123-G-T **
19520834-T-C 17408954-T-C **
28612148-C-A 26466001-C-A **
20332000-G-A 18170114-G-A P5_Dst **
18855425-A-G 16743545-A-G **
59024001-CAAAAA-C 56877854-CAAAAA-C 18×A**
10940295-C-G **
7042767-C-A 7174726-C-A **
10971050-C-T **
19156120-C-A 17044240-C-A **
19312259-C-A 17200379-C-A **
24643277-C-T 22497130-C-T P3_t2 **
19296874-T-C 17184994-T-C **
19253059-GC-G 17141179-GC-G **
19235211-T-A 17123331-T-A **
19216378-C-A 17104498-C-A **
19121843-C-A 17009963-C-A **
19785344-A-AG 17673464-A-AG P5_Prx **
19091560-C-A 16979680-C-A **
19088459-C-A 16976579-C-A **
19052227-T-C 16940347-T-C **
19048041-GTATA-G 16936161-GTATA-G **
19030448-C-A 16918568-C-A **
19013250-A-T 16901370-A-T **
19539758-C-A 17427878-C-A **
19844976-G-A 17733096-G-A P5_Prx **
16701905-G-T 14590025-G-T **
20809580-A-T 18647694-A-T P4_Gap **
21334570-C-A 19172684-C-A Y56556 **
21296584-C-A 19134698-C-A **
21263563-C-G 19101677-C-G **
21225078-C-A 19063192-C-A **
21158995-G-A 18997109-G-A **
20989203-G-T 18827317-G-T P4_Dst **
58884397-T-A 56706474-A-T **
19847678-G-A 17735798-G-A P5_Prx **
20641629-G-A 18479743-G-A P4_Prx **
20612197-G-T 18450311-G-T P4_Prx **
20433810-G-T 18271924-G-T P5_Dst **
20387278-A-AT 18225392-A-AT P5_Dst **
20352189-C-T 18190303-C-T P5_Dst **
20332008-C-A 18170122-C-A P5_Dst **
20126671-A-C 18014791-A-C P5_Dst **
19007713-C-A 16895833-C-A **
17201821-C-T 15089941-C-T V63 **
21367688-C-T 19205802-C-T **
18239038-T-C 16127158-T-C **
18625424-T-A 16513544-T-A **
18443428-C-T 16331548-C-T P6_Dst **
13435815-G-C 11280139-G-C **
18340498-AC-A 16228618-AC-A P6_Prx **
18288711-C-A 16176831-C-A P6_Prx **
18284513-C-A 16172633-C-A P6_Prx **
18190610-T-C 16078730-T-C **
18685473-C-G 16573593-C-G **
18153794-T-C 16041914-T-C **
18127997-C-A 16016117-C-A **
18022228-A-C 15910348-A-C **
17923636-G-T 15811756-G-T **
13400956-T-G 11245280-T-G **
17922472-T-A 15810592-T-A **
17876375-C-T 15764495-C-T **
18625942-C-A 16514062-C-A **
18710190-C-A 16598310-C-A **
18980500-C-A 16868620-C-A **
18855419-A-T 16743539-A-T **
18928971-A-T 16817091-A-T **
23401471-C-T 21239585-C-T CTS11979 PF3878 **
18928633-T-G 16816753-T-G **
18924926-C-A 16813046-C-A **
18858634-T-C 16746754-T-C **
18855612-G-A 16743732-G-A **
18848519-A-T 16736639-A-T **
13405635-C-G 11249959-C-G Z7994 **
18848369-G-A 16736489-G-A **
18847739-T-C 16735859-T-C **
18790584-C-A 16678704-C-A **
18779272-C-T 16667392-C-T **
58843970-G-C 56746901-C-G **
18768540-C-A 16656660-C-A **
58967719-A-G 56821572-A-G **
10972378-C-A **
21367714-G-T 19205828-G-T **
9939530-T-G 10101921-T-G **
27417831-G-C 25271684-G-C P1_g3 **
13139020-T-G 10628506-T-G **
28469539-G-T 26323392-G-T **
27916366-T-A 25770219-T-A P1_Y2 **
24643271-G-T 22497124-G-T P3_t2 **
27791745-T-C 25645598-T-C P1_Y2 **
27607711-G-T 25461564-G-T P1_Y2 **
26777224-C-A 24631077-C-A P1_g2 **
28469566-T-C 26323419-T-C **
26463141-T-C 24316994-T-C P1_Y1 **
26358850-C-A 24212703-C-A P1_Y1 **
25885894-G-GA 23739747-G-GA P1_Y1 **
24929531-C-A 22783384-C-A g1 **
24929520-T-A 22783373-T-A g1 **
22360892-C-G 20199006-C-G DYZ19 **
13457783-A-T 11302107-A-T **
28497063-C-A 26350916-C-A **
24634053-T-C 22487906-T-C P3_t2 **
56842301-A-C **
56858043-C-T **
56850410-G-A **
56850374-TC-T **
56850372-A-AT **
56844040-C-A **
56842322-T-G **
56827470-T-G **
28537134-G-A 26390987-G-A **
56695293-T-C **
28650023-C-T 26503876-C-T **
28612250-G-C 26466103-G-C **
28610115-C-A 26463968-C-A **
28598960-C-A 26452813-C-A **
28548553-A-T 26402406-A-T **
28542430-A-G 26396283-A-G **
24878256-G-T 22732109-G-T g1 **
24512910-G-T 22366763-G-T **
21368786-A-T 19206900-A-T **
22309855-A-T 20147969-A-T DYZ19 **
22775457-T-A 20613571-T-A **
22774605-C-A 20612719-C-A **
22611377-C-A 20449491-C-A **
22602018-A-C 20440132-A-C **
22489656-T-A 20327770-T-A DYZ19 **
22325291-T-A 20163405-T-A DYZ19 **
22164513-A-G 20002627-A-G **
22901958-A-C 20740072-A-C **
22125651-A-C 19963765-A-C **
22091373-C-A 19929487-C-A **
22027641-C-A 19865755-C-A **
21935103-T-C 19773217-T-C **
21614664-C-A 19452778-C-A **
13484955-G-C 11329279-G-C BY210388 **
21457486-G-A 19295600-G-A **
22367063-G-T 20205177-G-T DYZ19 **
22991267-C-A 20829381-C-A **
24458759-TC-T 22312612-TC-T **
21751750-A-G **
24445522-C-T 22299375-C-T **
24416924-C-A 22270777-C-A **
24223349-C-A 22077202-C-A P3_b1 **
24071619-A-G 21925472-A-G P3_b1 **
23954203-G-A 21808056-G-A **
13453194-CACTCGGGTTCACTCA-C 11297518-CACTCGGGTTCACTCA-C **
23773453-G-T 21611567-G-T **
22995398-G-GT 20833512-G-GT **
23569171-T-C 21407285-T-C **
23196308-T-C 21034422-T-C **
23142929-G-A 20981043-G-A **
23126215-TA-T 20964329-TA-T **
23036800-C-A 20874914-C-A **
22995408-T-C 20833522-T-C **
22995404-G-C 20833518-G-C **
17813506-A-G 15701626-A-G **
21360339-C-A 19198453-C-A **
17730455-C-A 15618575-C-A **
14347862-T-C 12227157-T-C **
13896987-T-G 11776281-T-G **
13929155-C-T 11808449-C-T **
13936048-C-A 11815342-C-A **
13949641-G-T 11828935-G-T **
13963296-C-A 11842590-C-A **
13987267-C-A 11866561-C-A **
13987291-T-G 11866585-T-G **
14236021-T-A 12115315-T-A **
14236026-C-A 12115320-C-A 16×A**
14270004-T-C 12149298-T-C **
14273430-T-C 12152724-T-C **
14287006-C-A 12166300-C-A Y37744BY3487 **
14296254-C-A 12175548-C-A **
14311690-C-A 12190984-C-A **
14350085-C-T 12229380-C-T **
13865715-C-A 11745009-C-A BY26349 **
14448011-C-A 12327284-C-A **
14908260-C-T 12796327-C-T **
14845545-A-G 12733611-A-G **
14718182-G-T 12606250-G-T **
14609794-C-A 12497996-C-A **
14609789-G-A 12497991-G-A **
14609786-C-A 12497988-C-A **
14447990-C-A 12327263-C-A **
14354380-G-T 12233675-G-T **
22337470-T-C 20175584-T-C FGC7994 DYZ19 **
14443052-C-A 12322325-C-A **
14385462-A-T 12264758-A-T **
14385395-A-T 12264691-A-T **
14369159-G-T 12248455-G-T **
14361829-C-A 12241124-C-A **
13882759-G-T 11762053-G-T **
13859760-T-C 11739054-T-C **
14992906-C-A 12880991-C-A **
13227750-C-A 11072074-C-A **
10972459-C-A **
10972645-C-A **
10979559-A-G **
10980561-C-A **
10985724-C-A **
10986661-N-A **
10994130-C-T **
10994140-C-CTCTCA **
10999284-A-G **
11007075-G-A **
11019514-C-A **
11022021-C-T **
17571874-A-G 15459994-A-G **
11031648-T-C **
13255188-C-A 11099512-C-A **
13838673-A-G 11717967-A-G **
13483812-C-A 11328136-C-A **
11655373-A-T **
11652450-G-T **
11643649-G-T **
13606471-C-A 11450795-C-A **
13597442-C-A 11441766-C-A **
13507059-C-A 11351383-C-A **
13480406-T-C 11324730-T-C **
13267634-C-A 11111958-C-A **
13469488-A-T 11313812-A-T **
13434690-C-A 11279014-C-A **
13394793-A-G 11239117-A-G **
13329183-G-T 11173507-G-T **
13294206-C-A 11138530-C-A **
13280145-C-A 11124469-C-A **
14910788-C-G 12798855-C-G **
11022023-C-CTTGAT **
14994021-C-A 12882106-C-A **
13432725-G-A 11277049-G-A **
15648613-C-A 13536733-C-A **
15650622-C-A 13538742-C-A **
15671242-C-A 13559362-C-A **
15858398-G-A 13746518-G-A **
15870504-C-A 13758624-C-A **
16921437-T-C 14809557-T-C **
15871540-C-A 13759660-C-A **
17492430-T-C 15380550-T-C **
15901327-G-T 13789447-G-T **
15921922-C-A 13810042-C-A **
17444834-C-A 15332954-C-A **
16921338-C-A 14809458-C-A **
15942966-C-A 13831086-C-A **
16745306-C-A 14633426-C-A **
15503303-C-A 13391423-C-A **
13432706-C-T 11277030-C-T **
16719618-C-A 14607738-C-A **
17425117-C-G 15313237-C-G **
9951888-T-C 10114279-T-C **
15969779-C-A 13857899-C-A **
16180293-G-A 14068413-G-A **
16216704-C-A 14104824-C-A **
16220932-C-A 14109052-C-A **
9933972-G-A 10096363-G-A **
16245486-C-A 14133606-C-A **
16269371-C-A 14157491-C-A **
16427184-G-A 14315304-G-A **
16686049-C-A 14574169-C-A **
16464724-A-C 14352844-A-C **
16539784-G-T 14427904-G-T **
15542643-T-A 13430763-T-A **
16620002-C-A 14508122-C-A **
17175317-G-T 15063437-G-T **
15092313-C-A 12980402-C-A **
15157556-A-T 13045643-A-T **
15157768-T-C 13045855-T-C **
17402489-CT-C 15290609-CT-C **
15157772-G-A 13045859-G-A **
15157778-C-T 13045865-C-T **
15193409-C-A 13081495-C-A Y93232 **
15424639-GAA-G 13312759-GAA-G 10×A**
17199539-G-A 15087659-G-A **
17513908-C-T 15402028-C-T **
15221920-C-G 13110006-C-G **
17159007-C-T 15047127-C-T **
15374511-C-A 13262631-C-A **
16942159-T-C 14830279-T-C **
15424469-G-A 13312589-G-A **
15392510-G-T 13280630-G-T **
17032672-C-A 14920792-C-A **
15366548-A-G 13254668-A-G **
17059830-C-A 14947950-C-A **
19775300-G-T 17663420-G-T P5_Prx ***
13480760-G-T 11325084-G-T ***
20522277-T-C 18360391-T-C P5_Dst ***
13726528-T-C 11570852-T-C ***
13733917-G-T 11578241-G-T ***
17716176-T-C 15604296-T-C ***
3850009-C-A 3981968-C-A ***
20522328-A-T 18360442-A-T P5_Dst ***
20522556-G-C 18360670-G-C P5_Dst ***
18398155-G-A 16286275-G-A P6_Gap ***
19769971-G-T 17658091-G-T P5_Prx ***
20522263-A-G 18360377-A-G P5_Dst ***
20522550-T-C 18360664-T-C P5_Dst ***
19012969-A-C 16901089-A-C ***
20522307-G-A 18360421-G-A P5_Dst ***
22499068-G-T 20337182-G-T DYZ19 ***
22265940-T-A 20104054-T-A DYZ19 ***
58831558-A-T 56759313-T-A ***
21717648-A-ATG 19555762-A-ATG 17×TG***
58913189-A-T 56677682-T-A ***
58911185-A-C 56679686-T-G ***
58910818-A-C 56680053-T-G ***
58898565-A-G 56692306-T-C ***
58893211-T-C 56697660-A-G ***
58876310-C-T 56714561-G-A ***
58868572-G-C 56722299-C-G ***
58844948-T-C 56745923-A-G ***
58843642-G-T 56747229-C-A ***
58840427-G-T 56750444-C-A ***
58840426-A-G 56750445-T-C ***
28237966-T-G 26091819-T-G P1_b4 ***
22265965-T-A 20104079-T-A DYZ19 ***
28006408-C-A 25860261-C-A P1_Y2 ***
26721883-G-T 24575736-G-T FGC48695 P1_g2 ***
26507832-G-A 24361685-G-A P1_Y1 ***
24487402-G-C 22341255-G-C ***
10850586-A-T ***
22504105-G-T 20342219-G-T DYZ19 ***
22502012-G-A 20340126-G-A DYZ19 ***
13480045-G-C 11324369-G-C ***
22421000-C-A 20259114-C-A DYZ19 ***
22355187-T-A 20193301-T-A DYZ19 ***
22352516-T-G 20190630-T-G DYZ19 ***
22335978-T-A 20174092-T-A DYZ19 ***
22276528-T-G 20114642-T-G DYZ19 ***
13480726-G-A 11325050-G-A ***
58882530-GTCCATTCCGTTCGAT-G 56708307-GGGAATCGAACGGAAT-G ***
13479871-G-T 11324195-G-T ***
24207516-A-C 22061369-A-C FGC38958 P3_b1 ***
22360566-C-T 20198680-C-T DYZ19 ***
9871665-TAC-T 10034056-TAC-T 8×AC***
13484331-A-G 11328655-A-G ***
22496008-C-G 20334122-C-G DYZ19 ***
22421464-C-T 20259578-C-T DYZ19 ***
13701968-T-A 11546292-T-A ***
3274403-C-A 3406362-C-A ***
19183814-C-CTTTTT 17071934-C-CTTTTT 28×T***
13252783-GT-G 11097107-GT-G 11×T***
22360576-G-T 20198690-G-T DYZ19 ***
14101423-ATTC-A 11980717-ATTC-A ***
58846526-T-C 56744345-A-G ***
59013637-TA-T 56867490-TA-T ***
10956570-A-G ***
58895649-C-A 56695222-G-T ***
19478117-T-G 17366237-T-G ***
18723887-C-T 16612007-C-T 19×T***
13253111-G-A 11097435-G-A ***
13467653-AGAAT-GCAAG 11311977-AGAAT-GCAAG ***
22342832-T-A 20180946-T-A DYZ19 ***
14025624-GAAA-G 11904918-GAAA-G ***
14530900-GTA-G 12419101-GTA-G ***
13476385-A-T 11320709-A-T ***
13480091-C-T 11324415-C-T ***
13473420-T-A 11317744-T-A ***
13467614-A-T 11311938-A-T ***
28621222-C-A 26475075-C-A ***
13363961-C-A 11208285-C-A ***
13245451-C-T 11089775-C-T ***
10025210-C-T 10187601-C-T ***
9680117-C-T 9842508-C-T IR3_Prx ***
9194845-C-T 9357236-C-T ***
4913977-T-A 5045936-T-A ***
13469483-T-C 11313807-T-C ***
56834444-ATTCCCTTCCATTCCA-A,ATTCCCTTCCATTCCATTCCATTCCC ***
13467524-A-G 11311848-A-G ***
13479873-G-A 11324197-G-A ***
10868959-C-A ***
13489012-AT-GC 11333336-AT-GC ***
22481719-G-T 20319833-G-T DYZ19 ***
3350514-CA-C 3482473-CA-C 15×A***
13482882-CT-AA 11327206-CT-AA ***
28658368-G-T 26512221-G-T ***
17403747-C-A 15291867-C-A ***
10889294-A-T ***
13479881-TTCT-CCCC 11324205-TTCT-CCCC ***
3046471-C-A 3178430-C-A ***
3544894-G-GA 3676853-G-GA ***
13437414-C-A 11281738-C-A ***
10776062-T-C,G ***
23833024-C-A 21671138-C-A ***
7131901-G-A 7263860-G-A ***
14774283-TC-T 12662352-TC-T ***
10747023-C-T ***
5186735-C-A 5318694-C-A ***
24502900-C-A 22356753-C-A ***
13585537-C-A 11429861-C-A ***
13463557-C-A 11307881-C-A ***
8119050-C-T 8251009-C-T ***
13932752-G-A 11812046-G-A ***
13447111-C-G 11291435-C-G ***
58979474-A-C 56833327-A-C ***
13805365-A-AGGATT,T 11684659-A-AGGATT,T ***
13139239-TCATTC-CCATTC,T 10628725-TCATTC-CCATTC,T 10×CATTC***
13856402-T-A,G 11735696-T-A,G ***
13483325-T-G 11327649-T-G A13791 ***
18218796-TG-T 16106916-TG-T ***
58893212-TTCCC-CTCAG 56697655-GGGAA-CTGAG ***
58840789-TCCCTTTGTTTCCATTCTCTTCGATTCCATTTCTTTATATTCCATG-T 56750034-TGGCATGGAATATAAAGAAATGGAATCGAAGAGAATGGAAACAAAG-T ***
28819330-AGATTGGATTGGAG-CAAATGGTTTTGAA 26673183-AGATTGGATTGGAG-CAAATGGTTTTGAA ***
8654027-A-T 8785986-A-T ***
11672576-C-A ***
27035480-CTT-C 24889333-CTT-C P1_r4 16×T***
14444611-AGAGTAATAATAGTAGACAAATGATGAAAAATATG-A 12323884-AGAGTAATAATAGTAGACAAATGATGAAAAATATG-A ***
13142443-GCCAGTC-TG 10631929-GCCAGTC-TG ***
15126702-C-A 13014789-C-A ***
14847004-C-A 12735070-C-A 20×A***
21146260-A-T 18984374-A-T ***
7991279-C-A 8123238-C-A ***
21162662-C-A 19000776-C-A ***
14716727-C-A 12604795-C-A ***
16905867-T-A 14793987-T-A ***
15258492-C-A 13146576-C-A ***
19351063-T-C 17239183-T-C ***
15320599-G-T 13208705-G-T ***
28808606-A-C,G 26662459-A-C,G ***
10776074-C-CCAATG ***
21531424-T-C 19369538-T-C ***
21993870-C-T 19831984-C-T ***
15423436-C-T 13311556-C-T ***
9100129-C-T 9262520-C-T ***
22102507-T-A 19940621-T-A ***
22435744-TGA-AGC 20273858-TGA-AGC DYZ19 ***
10673880-CTCCAT-C ***
14108530-C-A 11987824-C-A ***
14061366-ATTT-A,ATTTTT 11940660-ATTT-A,ATTTTT 17×T***
27862535-T-AGAGA 25716388-T-AGAGA P1_Y2 22×GA***
25709386-G-GTTTTTTTT 23563239-G-GTTTTTTTT P1_b3 31×T***
3628709-G-GAA 3760668-G-GAA 26×A***
13267597-C-CAAAAAAAAA 11111921-C-CAAAAAAAAA 11×A***
13847209-A-AAATGGAATGG 11726503-A-AAATGGAATGG 4×AATGG***
13661297-A-AATGGG 11505621-A-AATGGG ***
13611988-G-GTTTTTTT 11456312-G-GTTTTTTT 19×T***
13489569-GG-CA 11333893-GG-CA ***
13488556-GGCGCGTT-AGCGCGTG 11332880-GGCGCGTT-AGCGCGTG ***
13478256-CGA-TGC 11322580-CGA-TGC ***
13469487-AA-GT 11313811-AA-GT ***
13465322-TT-CC 11309646-TT-CC ***
13465305-ACCCC-TCTCA 11309629-ACCCC-TCTCA ***
13199164-C-CAAAA 11043488-C-CAAAA 18×A***
6980126-G-A 7112085-G-A SK2356 ***
10846973-C-T ***
9983930-TT-AC 10146321-TT-AC ***
9945416-TCTG-CCTA 10107807-TCTG-CCTA ***
9522586-CTGAT-TTGAG 9684977-CTGAT-TTGAG ***
9522577-GAC-CAA 9684968-GAC-CAA ***
9403521-G-GTTTTTTT 9565912-G-GTTTTTTT 21×T***
9342737-CA-AG 9505128-CA-AG ***
8826708-CAG-AAA 8958667-CAG-AAA ***
6858592-C-CTTTT 6990551-C-CTTTT 25×T***
6089764-G-GTTTTTTTTTT 6221723-G-GTTTTTTTTTT 31×T***
13940857-A-AAGAGAG 11820151-A-AAGAGAG 18×AG***
15733879-C-CAAAA 13621999-C-CAAAA 25×A***
25675611-AG-TC 23529464-AG-TC P1_b3 ***
22234944-AG-TA 20073058-AG-TA DYZ19 ***
25080053-C-CAA 22933906-C-CAA g1 20×A***
23389531-C-CTTTTTTT 21227645-C-CTTTTTTT 18×T***
22504694-TAAACGT-CAAAGGC 20342808-TAAACGT-CAAAGGC DYZ19 ***
22420876-CAAAA-AGGAG 20258990-CAAAA-AGGAG DYZ19 ***
22420862-CATTCT-ACTTCA 20258976-CATTCT-ACTTCA DYZ19 ***
22420853-TAGT-GAGA 20258967-TAGT-GAGA DYZ19 ***
22289476-CTG-TTT 20127590-CTG-TTT DYZ19 ***
22289469-TTTA-CTT 20127583-TTTA-CTT DYZ19 ***
22273539-CTT-C 20111653-CTT-C DYZ19 ***
22265972-GTGTCC-TTGCAT 20104086-GTGTCC-TTGCAT DYZ19 ***
22227893-AC-TA 20066007-AC-TA DYZ19 ***
17802166-T-TAAAAA 15690286-T-TAAAAA 30×A***
21409460-C-CAAAAAA 19247574-C-CAAAAAA 30×A***
20700730-A-AT 18538844-A-AT P4_Prx 9×T***
20522562-GTTTT-TTTCC 18360676-GTTTT-TTTCC P5_Dst ***
20522538-CA-GG 18360652-CA-GG P5_Dst ***
20522238-ATA-TTG 18360352-ATA-TTG P5_Dst ***
20023980-A-AGATG 17912100-A-AGATG P5_Prx ***
10801700-T-TTGAATCCATA ***
19006136-C-CAAAAAA 16894256-C-CAAAAAA 21×A***
18804474-A-AGAG 16692594-A-AGAG 26×AG***
18035665-C-CTTTTT 15923785-C-CTTTTT 30×T***
22289463-A-G 20127577-A-G DYZ19 ***
27232111-T-TTTTCTTTCTTTC 25085964-T-TTTTCTTTCTTTC P1_g3 18×TTTC***
27462492-C-A 25316345-C-A P1_Y2 ***
22457200-C-G 20295314-C-G DYZ19 ***
22503396-A-C 20341510-A-C DYZ19 ***
22502509-G-A 20340623-G-A DYZ19 ***
22496172-T-A 20334286-T-A DYZ19 ***
22496111-T-A 20334225-T-A DYZ19 ***
22496079-G-T 20334193-G-T DYZ19 ***
22491548-T-C 20329662-T-C DYZ19 ***
22481674-T-A 20319788-T-A DYZ19 ***
22480740-G-A 20318854-G-A DYZ19 ***
22421942-T-G 20260056-T-G DYZ19 ***
58823200-A-C 56767671-T-G ***
22421801-A-G 20259915-A-G DYZ19 ***
22421751-C-G 20259865-C-G DYZ19 ***
22421742-G-A 20259856-G-A DYZ19 ***
22366759-A-T 20204873-A-T DYZ19 ***
22366743-T-G 20204857-T-G DYZ19 ***
22366728-A-G 20204842-A-G DYZ19 ***
22366714-A-T 20204828-A-T DYZ19 ***
22366688-G-T 20204802-G-T DYZ19 ***
58820351-T-C 56770520-A-G ***
58826761-T-A 56764110-A-T ***
22361221-G-T 20199335-G-T DYZ19 ***
58874543-C-A 56716328-G-T ***
22346808-TACC-CAGT 20184922-TACC-CAGT DYZ19 ***
13203943-TGA-GGT 11048267-TGA-GGT ***
13203908-CACGGCGATG-AATGGTGATA 11048232-CACGGCGATG-AATGGTGATA ***
58914440-T-C 56676431-A-G ***
58914235-T-G 56676636-A-C ***
58890316-C-A 56700555-G-T ***
58885346-C-T 56705525-G-A ***
58874574-C-G 56716297-G-C ***
58873046-T-C 56717825-A-G ***
58838379-G-C 56752492-C-G ***
58872625-T-C 56718246-A-G ***
58850667-T-A 56740204-A-T ***
58843794-T-C 56747077-A-G ***
58843530-G-C 56747341-C-G ***
58843494-C-T 56747377-G-A ***
58843467-G-C 56747404-C-G ***
58841230-G-C 56749641-C-G ***
58841096-T-C 56749775-A-G ***
58841073-C-T 56749798-G-A ***
22361234-C-A 20199348-C-A DYZ19 ***
22361213-A-C 20199327-A-C DYZ19 ***
58986788-GGC-AGT 56840641-GGC-AGT ***
22252698-T-C 20090812-T-C DYZ19 ***
22257269-C-G 20095383-C-G DYZ19 ***
22257240-C-A 20095354-C-A DYZ19 ***
22257175-C-G 20095289-C-G DYZ19 ***
22256989-C-A 20095103-C-A DYZ19 ***
22252852-G-T 20090966-G-T DYZ19 ***
22252723-T-A 20090837-T-A DYZ19 ***
22252713-G-T 20090827-G-T BY6573 DYZ19 ***
22252712-G-T 20090826-G-T DYZ19 ***
22251566-A-C 20089680-A-C DYZ19 ***
22282084-C-T 20120198-C-T DYZ19 ***
22251553-G-A 20089667-G-A FGC80266 DYZ19 ***
22249462-T-C 20087576-T-C DYZ19 ***
22236671-T-G 20074785-T-G DYZ19 ***
22236520-T-A 20074634-T-A Z3458 DYZ19 ***
22234674-C-G 20072788-C-G DYZ19 ***
22234656-C-T 20072770-C-T DYZ19 ***
22234625-C-A 20072739-C-A DYZ19 ***
22234614-G-A 20072728-G-A DYZ19 ***
22268293-A-G 20106407-A-G DYZ19 ***
22289661-G-A 20127775-G-A DYZ19 ***
22360864-A-T 20198978-A-T DYZ19 ***
22342674-G-A 20180788-G-A DYZ19 ***
22360862-T-C 20198976-T-C DYZ19 ***
22360669-G-T 20198783-G-T DYZ19 ***
22360398-C-T 20198512-C-T FGC80542 DYZ19 ***
22360117-T-G 20198231-T-G DYZ19 ***
22358530-G-A 20196644-G-A DYZ19 ***
22353445-A-G 20191559-A-G DYZ19 ***
22353416-G-T 20191530-G-T DYZ19 ***
22342822-T-G 20180936-T-G DYZ19 ***
22342669-G-A 20180783-G-A DYZ19 ***
22289732-G-A 20127846-G-A DYZ19 ***
22342662-C-T 20180776-C-T DYZ19 ***
22337480-C-T 20175594-C-T DYZ19 ***
22335655-G-C 20173769-G-C DYZ19 ***
22300978-A-G 20139092-A-G DYZ19 ***
22300959-T-G 20139073-T-G DYZ19 ***
22300957-G-A 20139071-G-A DYZ19 ***
22292945-G-A 20131059-G-A DYZ19 ***
22292936-G-C 20131050-G-C DYZ19 ***
22292886-C-G 20131000-C-G DYZ19 ***
22346872-GG-AA 20184986-GG-AA DYZ19 ***
22352949-CC-GT 20191063-CC-GT DYZ19 ***
22232180-A-G 20070294-A-G DYZ19 ***
22337544-TACGG-CACGC 20175658-TACGG-CACGC DYZ19 ***
22364589-CCG-TCT 20202703-CCG-TCT DYZ19 ***
22360862-TGA-CAT 20198976-TGA-CAT DYZ19 ***
22360592-GTGT-CTGG 20198706-GTGT-CTGG DYZ19 ***
22341764-CATGG-AATGC 20179878-CATGG-AATGC DYZ19 ***
22341613-ACAGA-CCAGT 20179727-ACAGA-CCAGT DYZ19 ***
22341394-ACTTC-TCTTG 20179508-ACTTC-TCTTG DYZ19 ***
22337576-GTCC-TTCG 20175690-GTCC-TTCG DYZ19 ***
22337567-AGG-TGT 20175681-AGG-TGT DYZ19 ***
22337437-ACTTA-CCTTG 20175551-ACTTA-CCTTG DYZ19 ***
22365948-CT-AG 20204062-CT-AG DYZ19 ***
22337234-GG-AA 20175348-GG-AA DYZ19 ***
22337200-CATGTCC-TATTTCG 20175314-CATGTCC-TATTTCG DYZ19 ***
22335999-TT-GG 20174113-TT-GG DYZ19 ***
22297122-ATCT-TTCA 20135236-ATCT-TTCA DYZ19 ***
22289530-GAGA-CAGG 20127644-GAGA-CAGG DYZ19 ***
22281901-AAT-GAG 20120015-AAT-GAG DYZ19 ***
22268371-GC-G 20106485-GC-G DYZ19 ***
22263699-GTCC-TTCG 20101813-GTCC-TTCG DYZ19 ***
22365859-GCA-TAG 20203973-GCA-TAG DYZ19 ***
22365977-GGTGG-TGTCA 20204091-GGTGG-TGTCA DYZ19 ***
22257222-AGT-GGA 20095336-AGT-GGA DYZ19 ***
22488489-GGTTTCTGT-AGTGTCTTC 20326603-GGTTTCTGT-AGTGTCTTC DYZ19 ***
58843446-GT-AC 56747424-AC-GT ***
58840728-CTG-TTC 56750141-CAG-GAA ***
28819315-GG-TT 26673168-GG-TT ***
28814922-GA-CT 26668775-GA-CT ***
22502435-GCAGT-ACAGC 20340549-GCAGT-ACAGC DYZ19 ***
22502169-CCG-TCT 20340283-CCG-TCT DYZ19 ***
22496075-TTTAG-GTTAT 20334189-TTTAG-GTTAT DYZ19 ***
22495737-AGTG-TGTT 20333851-AGTG-TGTT DYZ19 ***
22480883-TTTCG-GTTCA 20318997-TTTCG-GTTCA DYZ19 ***
22366039-GT-TC 20204153-GT-TC DYZ19 ***
22480776-ATCTT-TTCAC 20318890-ATCTT-TTCAC DYZ19 ***
22480694-ATTAAAGT-CTTAAAGG 20318808-ATTAAAGT-CTTAAAGG DYZ19 ***
22457249-CTTT-TTTA 20295363-CTTT-TTTA DYZ19 ***
22366755-AGAGA-GGAGT 20204869-AGAGA-GGAGT DYZ19 ***
22366714-ACT-TCG 20204828-ACT-TCG DYZ19 ***
22366697-TTT-AAG 20204811-TTT-AAG DYZ19 ***
22366649-ATT-GTG 20204763-ATT-GTG DYZ19 ***
22366638-ATCCTT-TTTCTG 20204752-ATCCTT-TTTCTG DYZ19 ***
22366506-CAA-GAG 20204620-CAA-GAG DYZ19 ***
22257238-AAC-CAA 20095352-AAC-CAA DYZ19 ***
22257146-GAGTT-AAGTG 20095260-GAGTT-AAGTG DYZ19 ***
22480847-TC-AA 20318961-TC-AA DYZ19 ***
10011673-GATAG-AATAA 10174064-GATAG-AATAA ***
13140033-TA-T 10629519-TA-T ***
13140029-CA-C 10629515-CA-C ***
13140018-GAGTG-CATT 10629504-GAGTG-CATT ***
13140009-CG-C 10629495-CG-C ***
13140001-CG-C 10629487-CG-C ***
13139992-CA-C 10629478-CA-C ***
13129671-ATTTA-GCCCT 10619157-ATTTA-GCCCT ***
13129659-AT-A 10619145-AT-A ***
9940615-TC-CA 10103006-TC-CA ***
13488988-AGGGT-GGGGC 11333312-AGGGT-GGGGC ***
22341741-CAGTTTA-GATTTTC 20179855-CAGTTTA-GATTTTC DYZ19 ***
22263730-CG-AT 20101844-CG-AT DYZ19 ***
22256943-GTATGTCCAGAG-ATTTCTCCTGAC 20095057-GTATGTCCAGAG-ATTTCTCCTGAC DYZ19 ***
22295948-AGT-TAC 20134062-AGT-TAC DYZ19 ***
22268405-AC-GA 20106519-AC-GA DYZ19 ***
22263754-ATA-CTT 20101868-ATA-CTT DYZ19 ***
22480908-AT-GC 20319022-AT-GC DYZ19 ***
22480871-TC-GT 20318985-TC-GT DYZ19 ***
22480877-TT-CG 20318991-TT-CG DYZ19 ***
13203922-CGGCATTG-TGGTATTA 11048246-CGGCATTG-TGGTATTA ***
13688265-CGGA-TGGG 11532589-CGGA-TGGG ***
22256931-GTGGTCC-TTGTTAA 20095045-GTGGTCC-TTGTTAA DYZ19 ***
22236668-AGAT-GAAG 20074782-AGAT-GAAG DYZ19 ***
22256920-ATT-GTG 20095034-ATT-GTG DYZ19 ***
22256885-GA-CC 20094999-GA-CC DYZ19 ***
22252800-CACT-GACC 20090914-CACT-GACC DYZ19 ***
22252775-AA-CT 20090889-AA-CT DYZ19 ***
22252760-TTCCAAAGTT-GTTTAGATTG 20090874-TTCCAAAGTT-GTTTAGATTG DYZ19 ***
22252712-GGTAG-TTTAC 20090826-GGTAG-TTTAC DYZ19 ***
22252662-ACATGGT-TCAATGA 20090776-ACATGGT-TCAATGA DYZ19 ***
22249354-GTGT-TTGA 20087468-GTGT-TTGA DYZ19 ***
22235145-AAAAT-GAAAC 20073259-AAAAT-GAAAC DYZ19 ***
13692920-TAAA-GAAT 11537244-TAAA-GAAT ***
22232190-GTGCTGT-TTTCTGA 20070304-GTGCTGT-TTTCTGA DYZ19 ***
22232165-CAAA-AAAT 20070279-CAAA-AAAT DYZ19 ***
22228032-AC-TG 20066146-AC-TG DYZ19 ***
22226585-GAGCT-CAGCA 20064699-GAGCT-CAGCA DYZ19 ***
21824255-C-CAAAAA 19662369-C-CAAAAA 30×A***
20569614-C-CAAAAAAA 18407728-C-CAAAAAAA P5_Dst 33×A***
13708231-AT-TA 11552555-AT-TA ***
13695338-TATCA-CATCG 11539662-TATCA-CATCG ***
13695204-GTTGT-CTTGA 11539528-GTTGT-CTTGA ***
22232221-T-A 20070335-T-A DYZ19 ***
22232151-G-C 20070265-G-C BY1843 DYZ19 ***
58843537-TTT-GTC 56747332-AAA-GAC ***
13862191-G-A 11741485-G-A ***
13838607-A-G 11717901-A-G ***
13702068-A-G 11546392-A-G ***
22504630-T-G 20342744-T-G DYZ19 ***
9968273-T-C 10130664-T-C ***
9968263-C-T 10130654-C-T ***
22435749-A-AT 20273863-A-AT DYZ19 ***
13843909-C-G 11723203-C-G ***
13689209-TCAAAA-T,TGGAAT 11533533-TCAAAA-T,TGGAAT ***
13661960-G-A 11506284-G-A BY54290 ***
22250232-A-G 20088346-A-G DYZ19 ***
13649665-A-T 11493989-A-T ***
13649664-T-C 11493988-T-C ***
13649654-A-T 11493978-A-T ***
13649651-G-C 11493975-G-C ***
22503403-C-G 20341517-C-G DYZ19 ***
28800159-A-G 26654012-A-G ***
13833439-T-A,G 11712733-T-A,G ***
13833435-T-A 11712729-T-A ***
58841099-C-T 56749772-G-A ***
22239352-T-A 20077466-T-A DYZ19 ***
13203929-G-A 11048253-G-A ***
13141293-C-A 10630779-C-A ***
58912938-A-C 56677933-T-G ***
13649650-T-C 11493974-T-C BY87021 ***
13457781-G-T 11302105-G-T ***
13818653-T-C 11697947-T-C ***
13475909-T-G 11320233-T-G ***
26882139-TA-T 24735992-TA-T P1_r3 11×A***
22358487-G-A 20196601-G-A DYZ19 ***
13485820-T-G 11330144-T-G ***
13143778-TCCACTGCACTGCACA-T 10633264-TCCACTGCACTGCACA-T ***
13458412-ATTCCC-A 11302736-ATTCCC-A ***
16494380-GAT-G 14382500-GAT-G 8×AT***
58974000-C-G 56827853-C-G ***
13661952-A-G 11506276-A-G ***
13845622-T-A 11724916-T-A ***
22481300-A-C 20319414-A-C DYZ19 ***
22342953-A-G 20181067-A-G DYZ19 ***
28785797-T-G 26639650-T-G ***
22244998-C-G 20083112-C-G DYZ19 ***
13143631-T-A 10633117-T-A ***
13203936-A-T 11048260-A-T ***
58834802-T-C 56756069-A-G ***
28785798-G-A 26639651-G-A ***
28804551-C-T 26658404-C-T ***
13818655-G-A 11697949-G-A ***
13818647-T-G 11697941-T-G ***
13805045-C-T 11684339-C-T ***
13715220-A-T 11559544-A-T ***
9940864-A-AAT 10103255-A-AAT ***
26169893-TA-T 24023746-TA-T P1_Y1 10×A***
28799806-T-A 26653659-T-A ***
13461115-T-C 11305439-T-C ***
13802950-G-A 11682244-G-A ***
13848339-G-GA 11727633-G-GA ***
13715219-C-T 11559543-C-T ***
13485827-T-C,G 11330151-T-C,G ***
13458433-C-T 11302757-C-T ***
58974053-T-C 56827906-T-C ***
28804552-T-C 26658405-T-C S714 ***
58858911-CCATTG-C 56731950-GAATGC-G ***
22342845-A-G 20180959-A-G DYZ19 ***
13697758-G-T 11542082-G-T ***
13848314-A-G 11727608-A-G ***
13862260-G-C 11741554-G-C ***
13686927-G-C 11531251-G-C ***
13686888-G-A 11531212-G-A ***
13686921-T-C 11531245-T-C ***
13686920-A-T 11531244-A-T ***
24895682-TC-T 22749535-TC-T g1 ***
6238667-GCA-G 6370626-GCA-G IR3_Dst ***
28801742-T-G 26655595-T-G ***
24209830-GA-G 22063683-GA-G P3_b1 11×A***
22489904-T-C 20328018-T-C DYZ19 ***
13686897-C-T 11531221-C-T ***
28785789-A-G 26639642-A-G ***
13194867-T-C 11039191-T-C ***
13833426-G-C 11712720-G-C ***
13676703-A-G 11521027-A-G ***
13485847-A-G 11330171-A-G ***
28801724-C-G 26655577-C-G ***
28785779-A-G 26639632-A-G ***
13446748-C-G 11291072-C-G ***
13446730-T-C 11291054-T-C ***
13139327-C-T 10628813-C-T ***
13805380-T-G 11684674-T-G ***
13808675-G-A 11687969-G-A ***
13143798-T-C 10633284-T-C ***
22232065-G-A 20070179-G-A DYZ19 ***
22341791-A-G 20179905-A-G DYZ19 ***
22236558-A-G 20074672-A-G Z3459 DYZ19 ***
22256920-A-G 20095034-A-G DYZ19 ***
22365977-G-T 20204091-G-T DYZ19 ***
22292897-A-C 20131011-A-C DYZ19 ***
22341656-G-C 20179770-G-C DYZ19 ***
22257238-A-C 20095352-A-C DYZ19 ***
22263737-G-T 20101851-G-T Z3468 DYZ19 ***
22263714-C-T 20101828-C-T DYZ19 ***
22419678-N-C 20257792-N-C DYZ19 ***
22309684-A-G 20147798-A-G DYZ19 ***
22252899-A-C 20091013-A-C DYZ19 ***
22292975-T-G 20131089-T-G DYZ19 ***
22419677-N-G 20257791-N-G DYZ19 ***
58881774-C-T 56709097-G-A ***
22297317-C-G 20135431-C-G DYZ19 ***
22252689-C-A 20090803-C-A DYZ19 ***
22268366-T-A 20106480-T-A DYZ19 ***
22257011-A-C 20095125-A-C DYZ19 ***
22421811-C-T 20259925-C-T DYZ19 ***
22491685-C-G 20329799-C-G DYZ19 ***
13485503-T-C 11329827-T-C ***
13129640-G-T 10619126-G-T ***
22231859-C-G 20069973-C-G S3071 DYZ19 ***
22231796-C-T 20069910-C-T DYZ19 ***
22227924-T-G 20066038-T-G DYZ19 ***
22227923-C-G 20066037-C-G DYZ19 ***
22227906-A-C 20066020-A-C DYZ19 ***
14258526-A-C 12137820-A-C ***
13129686-A-T 10619172-A-T ***
13129655-A-G 10619141-A-G ***
13129629-A-G 10619115-A-G ***
22256936-C-A 20095050-C-A DYZ19 ***
13129553-T-A 10619039-T-A ***
13129484-A-G 10618970-A-G ***
13129469-G-T 10618955-G-T ***
13129458-A-G 10618944-A-G ***
13129423-G-A 10618909-G-A ***
13129415-G-T 10618901-G-T ***
9951870-C-A 10114261-C-A ***
22256937-C-A 20095051-C-A DYZ19 ***
22292872-T-G 20130986-T-G DYZ19 ***
22421962-T-A 20260076-T-A DYZ19 ***
22352897-A-T 20191011-A-T DYZ19 ***
26297068-CAT-C 24150921-CAT-C P1_Y1 ***
9968277-A-T 10130668-A-T ***
13801483-C-A 11680777-C-A ***
13801424-G-A 11680718-G-A ***
13676583-A-G 11520907-A-G ***
13649710-G-A 11494034-G-A ***
13649708-A-C 11494032-A-C ***
13474008-C-G,T 11318332-C-G,T ***
13458578-T-A 11302902-T-A ***
13456219-T-C 11300543-T-C S13825 ***
13473618-G-A 11317942-G-A ***
13853060-AGGGAG-A 11732354-AGGGAG-A ***
13676603-A-G 11520927-A-G ***
13676708-C-G 11521032-C-G ***
22502591-G-T 20340705-G-T DYZ19 ***
10025176-G-A 10187567-G-A ***
13203925-C-T 11048249-C-T ***
22503169-T-C 20341283-T-C A4407 DYZ19 ***
13838554-A-G 11717848-A-G ***
13676718-T-G 11521042-T-G ***
13454001-C-G 11298325-C-G ***
13826087-A-T 11705381-A-T ***
22253730-T-G 20091844-T-G DYZ19 ******
22257262-A-C 20095376-A-C DYZ19 ***
13420035-C-A 11264359-C-A ***
22352439-G-T 20190553-G-T DYZ19 ***
22491404-C-A 20329518-C-A DYZ19 ***
58895403-A-C 56695468-T-G ***
10043156-C-T 10205547-C-T ***
22252895-C-T 20091009-C-T DYZ19 ***
22480883-T-G 20318997-T-G DYZ19 ***
22268200-G-T 20106314-G-T DYZ19 ***
13606903-G-A 11451227-G-A ***
22353378-T-C 20191492-T-C DYZ19 ***
22345513-G-T 20183627-G-T DYZ19 ***
58843973-G-T 56746898-C-A ***
58907253-C-T 56683618-G-A ***
59000744-A-G 56854597-A-G ***
9940587-A-T 10102978-A-T ***
58977018-T-A 56830871-T-A ***
58976909-T-C 56830762-T-C ***
28801639-G-A 26655492-G-A ***
28799786-C-T 26653639-C-T 4×GGAGT***
27791872-T-G 25645725-T-G P1_Y2 ***
58843502-T-TA 56747368-A-AT ***
58843820-ACTTCCAGAACATTCCA-CTTTCGACACCCAGCCT 56747035-TGGAATGTTCTGGAAGT-AGGCTGGGTGTCGAAAG ***
22236485-A-T 20074599-A-T DYZ19 ***
13500110-CAAAAAA-C 11344434-CAAAAAA-C 16×A***
22488496-G-T 20326610-G-T DYZ19 ***
22421841-T-G 20259955-T-G DYZ19 ***
5393293-A-C 5525252-A-C ***
22421360-CC-AT 20259474-CC-AT DYZ19 ***
22421312-TTAC-CAGT 20259426-TTAC-CAGT DYZ19 ***
22421293-AGAA-GGAG 20259407-AGAA-GGAG DYZ19 ***
22421286-GAAC-TTACA 20259400-GAAC-TTACA DYZ19 ***
22234368-TC-GA 20072482-TC-GA DYZ19 ***
9942043-A-ATTT 10104434-A-ATTT 28×T***
22491770-C-T 20329884-C-T DYZ19 ***
58913158-T-G 56677713-A-C ***
58846649-G-T 56744222-C-A ***
22421596-G-T 20259710-G-T DYZ19 ***
22421354-T-A 20259468-T-A DYZ19 ***
22421324-T-C 20259438-T-C DYZ19 ***
22360572-C-G 20198686-C-G DYZ19 ***
22235045-C-G 20073159-C-G DYZ19 ***
22234374-C-T 20072488-C-T DYZ19 ***
22488497-T-C 20326611-T-C DYZ19 ***
22496169-T-C 20334283-T-C DYZ19 ***
22311315-C-T 20149429-C-T DYZ19 ***
3146672-AGTGTGTGT-A 3278631-AGTGTGTGT-A 21×GT***
13473535-G-C 11317859-G-C ***
13473522-T-C 11317846-T-C ***
58831547-CATTT-GATGA 56759320-AAATG-TCATC ***
13484489-AGTTT-TTTTA 11328813-AGTTT-TTTTA ***
58831521-G-T 56759350-C-A ***
9932691-A-G 10095082-A-G ***
58984206-CATA-TATC 56838059-CATA-TATC ***
22361379-AGAGTTTTT-TGAGTTTG 20199493-AGAGTTTTT-TGAGTTTG DYZ19 ***
58851955-G-A 56738916-C-T ***
27499360-T-C 25353213-T-C P1_Y2 ***
58851915-T-C 56738956-A-G ***
22420891-G-C 20259005-G-C DYZ19 ***
22420848-A-G 20258962-A-G DYZ19 ***
22342558-T-C 20180672-T-C DYZ19 ***
22342557-A-C 20180671-A-C DYZ19 ***
22273654-C-G 20111768-C-G DYZ19 ***
58912945-GGC-TGT 56677924-GCC-ACA ***
58831567-T-C 56759304-A-G ***
27499376-C-T 25353229-C-T P1_Y2 ***
13475916-A-G 11320240-A-G ***
22273660-G-C 20111774-G-C DYZ19 ***
58840473-G-T 56750398-C-A ***
22365813-C-G 20203927-C-G DYZ19 ***
13263676-TGCG-AGCT 11108000-TGCG-AGCT ***
58877079-G-C 56713792-C-G ***
58855088-G-T 56735783-C-A ***
58844840-C-A 56746031-G-T ***
58840442-C-A 56750429-G-T ***
58840431-G-C 56750440-C-G ***
58840421-G-C 56750450-C-G ***
58838355-A-C 56752516-T-G ***
22337286-G-C 20175400-G-C DYZ19 ***
13254009-TTTT-A 11098333-TTTT-A ***
22337250-C-T 20175364-C-T DYZ19 ***
22268207-A-C 20106321-A-C DYZ19 ***
22263702-C-G 20101816-C-G DYZ19 ***
22268181-G-A 20106295-G-A DYZ19 ***
58844027-T-TTCCATTCGATTCCA 56746842-A-AATGGAATCGAATGG ***
58820332-CATTCA-C 56770529-GGAATT-G ***
28804491-ATGAAT-GTGGAG 26658344-ATGAAT-GTGGAG ***
22501927-TTTAG-GTGAT 20340041-TTTAG-GTGAT DYZ19 ***
13435833-ATACG-GTACA 11280157-ATACG-GTACA ***
13139979-GGAGGGG-CATTGC 10629465-GGAGGGG-CATTGC ***
22263779-G-A 20101893-G-A DYZ19 ***
22266054-G-A 20104168-G-A FGC76134 DYZ19 ***
13306286-C-G 11150610-C-G ***
22421441-GC-TGG 20259555-GC-TGG DYZ19 ***
22353012-GG-AA 20191126-GG-AA DYZ19 ***
13470168-AG-CC 11314492-AG-CC ***
58876306-A-T 56714565-T-A ***
58872476-C-T 56718395-G-A ***
22502642-C-G 20340756-C-G DYZ19 ***
22344209-A-G 20182323-A-G DYZ19 ***
20420959-T-A 18259073-T-A P5_Dst ***
13142419-GTGTCCT-CA 10631905-GTGTCCT-CA ***
18403055-G-A 16291175-G-A P6_Gap ***
13393354-C-A 11237678-C-A ***
3167154-T-G 3299113-T-G ***
58823284-TCTCAT-A 56767582-ATGAGA-T ***
22237314-CC-AAT 20075428-CC-AAT DYZ19 ***
13140043-GAGTG-ACT 10629529-GAGTG-ACT ***
13129663-TC-CTT 10619149-TC-CTT ***
22345997-C-TAG 20184111-C-TAG DYZ19 ***
22235133-AGC-TG 20073247-AGC-TG DYZ19 ***
22420840-G-A 20258954-G-A DYZ19 ***
58868288-A-C 56722583-T-G ***
22235093-G-GC 20073207-G-GC DYZ19 ***
22273695-C-G 20111809-C-G DYZ19 ***
22265873-GC-TG 20103987-GC-TG DYZ19 ***
13142458-GCCACTCTACTT-TCCTCTCCACTC 10631944-GCCACTCTACTT-TCCTCTCCACTC ***
58843643-C-T 56747228-G-A 4×CCATT***
13203979-CTC-TAT 11048303-CTC-TAT ***
28556469-T-G 26410322-T-G ***
58877059-AGCGGA-C 56713807-TCCGCT-G ***
22273708-C-T 20111822-C-T DYZ19 ***
13616457-G-T 11460781-G-T ***
23951427-N-T 21805280-N-T ***
58846796-A-G 56744075-T-C ***
58891545-TG-AT 56699325-CA-AT ***
58848719-TG-AT 56742151-CA-AT ***
58914447-G-C 56676424-C-G 4×CATTC***
58852349-G-A 56738522-C-T ***
22501987-A-T 20340101-A-T DYZ19 ***
22501960-A-T 20340074-A-T DYZ19 ***
22367933-G-A 20206047-G-A DYZ19 ***
22342963-A-C 20181077-A-C DYZ19 ***
10024136-G-T 10186527-G-T ***
22244926-GA-G 20083040-GA-G DYZ19 ***
13473398-G-T 11317722-G-T ***
23084704-GT-G 20922818-GT-G 19×T***
22236518-GATGG-TAAGA 20074632-GATGG-TAAGA DYZ19 ***
58843684-A-C 56747187-T-G ***
58843666-T-A 56747205-A-T ***
22289483-G-A 20127597-G-A DYZ19 ***
13528617-T-C 11372941-T-C ***
13422277-C-T 11266601-C-T ***
10049572-T-C 10211963-T-C ***
13473556-T-C 11317880-T-C ***
58840476-A-C 56750395-T-G ***
58870180-T-A 56720691-A-T ***
22499104-G-A 20337218-G-A DYZ19 ***
22499088-G-C 20337202-G-C DYZ19 ***
13255004-C-T 11099328-C-T ***
22495764-CTTG-GTT 20333878-CTTG-GTT DYZ19 ***
5593309-CAA-C 5725268-CAA-C 15×A***
22289731-TG-GA 20127845-TG-GA DYZ19 ***
58868662-G-A 56722209-C-T ***
58843619-CGTTTCG-GGAGTCA 56747246-CGAAACG-TGACTCC ***
58843685-G-C 56747186-C-G ***
22234348-C-T 20072462-C-T DYZ19 ***
13256107-A-C 11100431-A-C ***
22504674-GTGT-CTGG 20342788-GTGT-CTGG DYZ19 ***
22342845-ATC-GTT 20180959-ATC-GTT DYZ19 ***
22234427-T-A 20072541-T-A DYZ19 ***
13250569-T-G 11094893-T-G FGC81663 ***
22268178-T-G 20106292-T-G DYZ19 ***
58876306-ATTGC-TTTGT 56714561-GCAAT-ACAAA ***
13389874-C-T 11234198-C-T ***
22352931-A-T 20191045-A-T DYZ19 ***
58866446-CCCA-TCCG 56724422-TGGG-CGGA ***
28819269-GGTA-TGGG 26673122-GGTA-TGGG ***
14491215-A-AAACAT ***
3604621-TTAA-T 3736580-TTAA-T 12×TAA***
13441433-TG-T 11285757-TG-T 10×G***
58913068-C-A 56677803-G-T ***
58870015-T-C 56720856-A-G FGC78751 ***
25472004-C-T 23325857-C-T FGC11716 P2_r2 ***
22342390-G-C 20180504-G-C DYZ19 ***
27398709-C-T 25252562-C-T FGC28799 P1_g3 ***
58831512-CATT-TATG 56759356-AATG-CATA ***
27862535-T-TGAGA 25716388-T-TGAGA P1_Y2 22×GA***
24388090-A-ATC 22241943-A-ATC ***
22421538-G-C 20259652-G-C DYZ19 ***
3902502-TAAAAATATAATACATTCAAATAGAA-T 4034461-TAAAAATATAATACATTCAAATAGAA-T ***
13616629-G-A 11460953-G-A ***
13728174-CGG-TGA 11572498-CGG-TGA ***
19187385-A-ATTTTTT 17075505-A-ATTTTTT 28×T***
13461950-TGGT-AGGC 11306274-TGGT-AGGC ***
5555645-C-CA 5687604-C-CA 18×A***
22481826-G-T 20319940-G-T DYZ19 ***
22342816-G-T 20180930-G-T DYZ19 ***
22273721-G-T 20111835-G-T DYZ19 ***
22273725-T-C 20111839-T-C DYZ19 ***
22962414-G-GTTTTT 20800528-G-GTTTTT 20×T***
58838545-G-C 56752326-C-G ***
5107030-A-AT 5238989-A-AT ***
22327478-C-A 20165592-C-A DYZ19 ***
13728164-T-C 11572488-T-C ***
28253491-C-CAAAAA 26107344-C-CAAAAA P1_b4 32×A***
22337261-TCTT-ACTA 20175375-TCTT-ACTA DYZ19 ***
13488959-GCC-TCG 11333283-GCC-TCG ***
13483218-CT-TG 11327542-CT-TG ***
13473507-GATA-TATG 11317831-GATA-TATG ***
8575956-A-AT 8707915-A-AT 28×T***
5107036-ACCAT-CCCAC 5238995-ACCAT-CCCAC ***
22256973-TTCATGGACTTA-ATCAAGGTCTTG 20095087-TTCATGGACTTA-ATCAAGGTCTTG DYZ19 ***
22281896-TCT-GTC 20120010-TCT-GTC DYZ19 ***
58843970-GATG-CATT 56746898-CATC-AATG ***
58840518-T-G 56750353-A-C ***
58852068-C-T 56738803-G-A ***
58848606-G-A 56742265-C-T ***
58848519-G-A 56742352-C-T ***
58848499-G-A 56742372-C-T ***
58846302-C-G 56744569-G-C ***
58844750-C-G 56746121-G-C ***
58843815-C-A 56747056-G-T ***
58843764-A-C 56747107-T-G ***
58833499-A-G 56757372-T-C ***
58997192-CCT-ACG 56851045-CCT-ACG ***
26153962-G-A 24007815-G-A P1_Y1 15×A***
22491429-G-C 20329543-G-C DYZ19 ***
22481053-G-A 20319167-G-A DYZ19 ***
22435779-G-T 20273893-G-T DYZ19 ***
22421679-C-G 20259793-C-G DYZ19 ***
22421582-T-C 20259696-T-C DYZ19 ***
22360677-C-G 20198791-C-G DYZ19 ***
22342696-T-G 20180810-T-G DYZ19 ***
58852082-T-C 56738789-A-G ***
13435869-T-TG 11280193-T-TG ***
22335714-A-C 20173828-A-C DYZ19 ***
22366465-TTTT-CTTA 20204579-TTTT-CTTA DYZ19 ***
13475961-A-C 11320285-A-C ***
13389947-T-C 11234271-T-C ***
58995146-C-T 56848999-C-T ***
13798576-N-A 11677870-A-. ***
58990057-CGGT-TGGC 56843910-CGGT-TGGC ***
58829353-CGA-TGC 56761516-TCG-GCA ***
28804509-ATATGA-GAATGG 26658362-ATATGA-GAATGG ***
28804503-CA-GG 26658356-CA-GG ***
22335732-TAG-GTT 20173846-TAG-GTT DYZ19 ***
58820252-TG-AT 56770618-CA-AT ***
22297108-C-CT 20135222-C-CT DYZ19 ***
22268178-TTTG-GTTA 20106292-TTTG-GTTA DYZ19 ***
22263840-CA-TC 20101954-CA-TC DYZ19 ***
22252975-TA-CT 20091089-TA-CT DYZ19 ***
22236528-TA-AC 20074642-TA-AC DYZ19 ***
22231783-AAAGGAAA-GATGTAAC 20069897-AAAGGAAA-GATGTAAC DYZ19 ***
13514892-TGAG-T 11359216-TGAG-T ***
13129622-CA-GG 10619108-CA-GG ***
13129615-CT-TG 10619101-CT-TG ***
22337241-G-T 20175355-G-T DYZ19 ***
22335671-G-T 20173785-G-T DYZ19 ***
22263795-A-G 20101909-A-G DYZ19 ***
58985694-TCT-GCA 56839547-TCT-GCA ***
22263783-T-G 20101897-T-G DYZ19 ***
13440814-A-G 11285138-A-G ***
22457231-C-G 20295345-C-G DYZ19 ***
58890048-A-T 56700823-T-A ***
5785679-GAAAG-AAAAA 5917638-GAAAG-AAAAA ***
59007432-C-CTTTA 56861285-C-CTTTA 18×T***
59002250-CAA-C 56856103-CAA-C 14×A***
58987557-TTGT-CTGC 56841410-TTGT-CTGC ***
58978909-GCCAA-TCCAC 56832762-GCCAA-TCCAC ***
22268187-T-C 20106301-T-C DYZ19 ***
58884397-TG-AT 56706473-CA-AT ***
58884236-TCCGTTTGATGCCATC-T 56706617-TGGGATGGCATCAAAC-T ***
58872956-CATTCAA-GATTTAG 56717909-TTGAATG-CTAAATC ***
58869098-TTTCT-ATTCC 56721769-AGAAA-GGAAT ***
58866592-TG-AT 56724278-CA-AT ***
58866552-CCC-ACA 56724317-GGG-TGT ***
58846417-TTCCATTTCATATTATTCCATTCCATTCAAA-T 56744417-GAATGGATTTGAATGGAATGGAATAATATGA-G ***
58844015-TATTCACTTCCATTTCC-T 56746835-CGAATGGAAATGGAAGT-C ***
9951359-T-A 10113750-T-A ***
13444937-A-G 11289261-A-G ***
22335666-T-C 20173780-T-C DYZ19 ***
22231787-G-T 20069901-G-T DYZ19 ***
22300984-C-T 20139098-C-T DYZ19 ***
22292065-G-C 20130179-G-C DYZ19 ***
22268290-C-A 20106404-C-A DYZ19 ***
22251627-T-C 20089741-T-C DYZ19 ***
22251619-A-T 20089733-A-T DYZ19 ***
22251617-A-C 20089731-A-C DYZ19 ***
22251591-A-T 20089705-A-T DYZ19 ***
22234702-A-C 20072816-A-C DYZ19 ***
13561928-G-A 11406252-G-A FGC7973 ***
22480926-C-G 20319040-C-G DYZ19 ***
58852098-G-A 56738773-C-T ***
58913099-G-A 56677772-C-T ***
22504831-G-T 20342945-G-T DYZ19 ***
13484461-T-A 11328785-T-A ***
13484485-G-C 11328809-G-C ***
13537278-G-A 11381602-G-A ***
9951370-A-C 10113761-A-C ***
13440967-C-A 11285291-C-A ***
9951364-A-T 10113755-A-T ***
13476019-G-A 11320343-G-A ***
22268336-T-G 20106450-T-G DYZ19 ***
23951427-N-NT 21805280-N-NT ***
58889965-G-A 56700906-C-T ***
22227923-CT-GG 20066037-CT-GG DYZ19 ***
22127975-C-CTTTTTT 19966089-C-CTTTTTT 20×T***
13484476-GAGCA-AAGCC 11328800-GAGCA-AAGCC ***
13140074-GAGTGCGTGTG-CACTCCATTTT 10629560-GAGTGCGTGTG-CACTCCATTTT ***
22229322-A-AG 20067436-A-AG DYZ19 ***
58917658-N-G 56673213-N-C ***
58912635-G-C 56678236-C-G ***
58895086-C-A 56695785-G-T FGC43851 FGC78598 ***
58846680-A-C 56744191-T-G ***
22342669-GATGAGGC-AATTAAGT 20180783-GATGAGGC-AATTAAGT DYZ19 ***
58843740-A-C 56747131-T-G ***
22504103-G-A 20342217-G-A DYZ19 ***
22501967-G-T 20340081-G-T DYZ19 ***
22361107-A-G 20199221-A-G DYZ19 ***
22357635-G-T 20195749-G-T DYZ19 ***
22342651-T-G 20180765-T-G DYZ19 ***
22342639-T-A 20180753-T-A DYZ19 ***
22335693-T-G 20173807-T-G DYZ19 ***
22268537-TTTAC-T 20106651-TTTAC-T DYZ19 ***
22342722-CCT-TCA 20180836-CCT-TCA DYZ19 ***
13740850-C-T 11585174-C-T ***
22236469-C-T 20074583-C-T DYZ19 ***
58913060-G-C 56677811-C-G ***
22501937-A-C 20340051-A-C DYZ19 ***
22501919-C-T 20340033-C-T DYZ19 ***
22498439-T-G 20336553-T-G DYZ19 ***
22361164-T-C 20199278-T-C DYZ19 ***
22344756-C-T 20182870-C-T DYZ19 ***
22266217-T-C 20104331-T-C DYZ19 ***
22236668-A-G 20074782-A-G DYZ19 ***
20574016-C-A 18412130-C-A P5_Dst ***
22361210-CGAA-AGAC 20199324-CGAA-AGAC DYZ19 ***
9951397-C-T 10113788-C-T ***
26365074-G-A 24218927-G-A P1_Y1 ***
22344763-T-A 20182877-T-A DYZ19 ***
22344769-T-A 20182883-T-A DYZ19 ***
58859614-A-G 56731257-T-C ***
13203970-C-T 11048294-C-T ***
27151329-GTA-TTT 25005182-GTA-TTT P1_g3 ***
25592898-CTC-ATA 23446751-CTC-ATA P1_gr1 ***
22481441-GCAGT-CCAGA 20319555-GCAGT-CCAGA DYZ19 ***
14258440-C-T 12137734-C-T S613 ***
13518312-C-T 11362636-C-T ***
58848681-C-A 56742190-G-T ***
22268302-C-T 20106416-C-T DYZ19 ***
22366032-G-A 20204146-G-A DYZ19 ***
22364601-A-T 20202715-A-T DYZ19 ***
22360595-T-G 20198709-T-G DYZ19 ***
22360592-G-C 20198706-G-C DYZ19 ***
22342724-T-A 20180838-T-A DYZ19 ***
22342583-A-T 20180697-A-T DYZ19 ***
22337441-A-G 20175555-A-G DYZ19 ***
22337437-A-C 20175551-A-C DYZ19 ***
22268301-C-G 20106415-C-G DYZ19 ***
22421560-C-A 20259674-C-A DYZ19 ***
22268297-G-T 20106411-G-T DYZ19 ***
22250305-G-T 20088419-G-T DYZ19 ***
22250271-C-T 20088385-C-T DYZ19 ***
22250265-T-G 20088379-T-G DYZ19 ***
19937298-A-C 17825418-A-C P5_Prx ***
13562868-G-A 11407192-G-A ***
13475937-A-G 11320261-A-G ***
13475930-T-G 11320254-T-G ***
22248431-C-T 20086545-C-T DYZ19 ***
22366930-A-T 20205044-A-T DYZ19 ***
22421683-T-A 20259797-T-A DYZ19 ***
13379546-C-T 11223870-C-T ***
22266203-ATC-TTG 20104317-ATC-TTG DYZ19 ***
22344795-G-A 20182909-G-A DYZ19 ***
22480719-G-T 20318833-G-T DYZ19 ***
22289623-C-A 20127737-C-A DYZ19 ***
9940872-C-A 10103263-C-A ***
58872637-CTTCCATTCCATTCGA-C 56718206-CAATGGAATGGAATCG-C ***
58841093-CTCTATC-TTCCATT 56749772-GATAGAG-AATGGAA ***
22421582-TTTAA-CTTAG 20259696-TTTAA-CTTAG DYZ19 ***
22342573-TA-T 20180687-TA-T DYZ19 ***
22231844-AGCT-CACG 20069958-AGCT-CACG DYZ19 ***
22435772-C-T 20273886-C-T DYZ19 ***
13483494-GG-CA 11327818-GG-CA ***
9700780-C-CAAA 9863171-C-CAAA FGC5285 IR3_Prx 23×A***
22353019-GT-TC 20191133-GT-TC DYZ19 ***
58913180-C-G 56677691-G-C ***
58892084-G-T 56698787-C-A ***
58846314-G-A 56744557-C-T ***
58843791-T-A 56747080-A-T ***
58840611-C-A 56750260-G-T ***
58835807-C-T 56755064-G-A ***
58846787-G-A 56744084-C-T ***

In the table above, the meaning of the confidence field depends on whether the data comes from an FTDNA kit or an FGC kit. For FTDNA kits, + implies a "PASS" result with just one possible variant, * indicates a "PASS" but with multiple variants, ** indicates "REJECTED" with just a single variant, and *** indicates "REJECTED" with multiple possible variants. 'A*' are heterozygous variants not called by FTDNA, but still pulled from the VCF file. For FGC kits, + indicates over 99% likely genuine (95% for INDELs); * over 95% likely genuine (90% for INDELs); ** about 40% likely genuine; *** about 10% likely genuine. Manual entries read directly from a BAM file will be either + indicating positive, or * indicating that the data show a mixture of possible variants.

For the FTDNA kits, the BED data is encoded in the background color of the cells. Those cells with a white background have coverage, those with a grey background indicate no coverage in the BED file, and those with a pink background indicate the mutation is on the edge of a coverage region. These pink regions often indicate that the individual may be positive for a SNP even if there is no corresponding entry in the vcf file.

The combBED column indicates whether or not the mutation is a SNP and falls in the combBED region defined in Defining a New Rate Constant for Y-Chromosome SNPs based on Full Sequencing Data by Dmitry Adamov, Vladimir Guryanov, Sergey Karzhavin, Vladimir Tagankin, Vadim Urasin.

The McDonald BED column indicates whether or not the mutation is a SNP and falls in the BED region used by Dr. Iain McDonald in the age analysis he does for R-U106 men.

Haplotype Progression

The data below reveals the progression of changes in the haplotype. The bottom row is the haplotype for this man and above him are the inferred ancestral haplotypes for various upstream blocks. These inferred haplotypes are very much a work in progress, and any suggested modifications are appreciated. I think we can use our vast collection of haplotype data to refine these haplotypes. Mutations made from each upstream block are shown in sequence. The cell color is determined by the block in which the mutation took place.

DYS393
DYS390
DYS19
DYS391
DYS385
DYS426
DYS388
DYS439
DYS389i
DYS392
DYS389ii
DYS458
DYS459
DYS455
DYS454
DYS447
DYS437
DYS448
DYS449
DYS464
DYS460
Y-GATA-H4
YCAII
DYS456
DYS607
DYS576
DYS570
CDY
DYS442
DYS438
DYS531
DYS578
DYF395S1
DYS590
DYS537
DYS641
DYS472
DYF406S1
DYS511
DYS425
DYS413
DYS557
DYS594
DYS436
DYS490
DYS534
DYS450
DYS444
DYS481
DYS520
DYS446
DYS617
DYS568
DYS487
DYS572
DYS640
DYS492
DYS565
DYS710
DYS485
DYS632
DYS495
DYS540
DYS714
DYS716
DYS717
DYS505
DYS556
DYS549
DYS589
DYS522
DYS494
DYS533
DYS636
DYS575
DYS638
DYS462
DYS452
DYS445
Y-GATA-A10
DYS463
DYS441
Y-GGAAT-1B07
DYS525
DYS712
DYS593
DYS650
DYS532
DYS715
DYS504
DYS513
DYS561
DYS552
DYS726
DYS635
DYS587
DYS643
DYS497
DYS510
DYS434
DYS461
DYS435
P312/S1161324141111-14121212131329179-1011112515192915-15-17-17111119-231615181736-38121211915-1681010810101223-231610121215812222013121113111112123315916122626191211131210912121011113012132413101020151913241712152412231810141791211
L21/S1451324141111-14121212131329179-1011112515192915-15-17-17111119-231615181736-38121211915-1681010810101223-231610121215812222013121113111112123515916122526191211131211912121011113012132413101020151913241712152412231810141791211
McClure1324141111-141212121316291710-1011112515182915-16-16-17111119-231514201737-40121211915-1681010810101323-231710121215813222013121113111212123515916122426191211121212913111011113112142413101021151612241712152412241810141791211

Age Analysis Information (work in progress)

AllMcDonaldYFull
Kit: 995121056196576134707683210
Kit: PY5HU*16000000100000008300000
Kit: 99512959727778137007711868
Used in age calculations16000000100000008300000
Counts of SNPs32
Variant counts last updated 2019-05-11 10:44:00.

* BED data not available. Using default values.


Big Tree Main Page