Tree Position

R-P312/S116 > Z290 > L21/S145 > DF13 > Z39589 > L1335/S530 > L1065 > Z16325 > S744 > S764 > S756 > Z16328 > FGC32449 > BY154 > FGC17059 > FGC45280 > FGC17058

Unique Mutations

The mutations unique to this man are summarized in the table below. Those with a '+' or '*' confidence level are considered by FamilyTreeDNA or FullGenomesCorp to be high quality SNPs/INDELs. For completeness, all other mutations of lesser confidence are included as well. These additional mutations may be useful for distinguishing between very closely related men.

Occasionally, some of the mutations listed here will be thought to be shared with other men in which case they might appear in upstream blocks on the tree. When this happens, the 'Blocks' field will indicate what block they appear in. Such a situation might arise with BigY men if the BED data suggests another man may be positive for a SNP, even though it doesn't appear in his VCF data. It might also happen if Chromo2 testing or Sanger sequencing of other men not on the tree show the SNP to be shared.

POS-REF-ALT (hg19) POS-REF-ALT (hg38) Blocks Names Region McDonald BED combBED STRFTDNA
167382
BigY2
167382
FGC
2NM3D
20046032-G-A 17934152-G-A P5_Prx ***A*
13695057-G-C 11539381-G-C A*
3233767-A-G 3365726-A-G FGC45277 +
18396484-T-A 16284604-T-A FGC45285 P6_Gap +++
10911809-C-A Y67231 **
7623641-C-A 7755600-C-A **
7646545-A-G 7778504-A-G **
7633742-A-G 7765701-A-G **
7542451-G-T 7674410-G-T **
7778975-C-A 7910934-C-A **
7446874-C-A 7578833-C-A IR1_L **
7395170-C-A 7527129-C-A **
7272989-C-T 7404948-C-T **
7258978-C-A 7390937-C-A **
7258010-C-A 7389969-C-A **
7239744-C-A 7371703-C-A **
7233063-C-A 7365022-C-A **
7699272-AGTTCATGT-A 7831231-AGTTCATGT-A **
7896975-G-T 8028934-G-T **
7808972-G-T 7940931-G-T **
8399176-C-A 8531135-C-A **
8799793-C-A 8931752-C-A **
8731744-G-T 8863703-G-T **
8681533-C-A 8813492-C-A **
8631407-TTTG-T 8763366-TTTG-T **
8589689-C-A 8721648-C-A **
8584059-C-A 8716018-C-A **
8293797-G-T 8425756-G-T **
7204804-T-G 7336763-T-G **
8178772-C-A 8310731-C-A **
8173697-T-A 8305656-T-A **
8109952-C-A 8241911-C-A **
8093328-G-A 8225287-G-A **
8093307-G-A 8225266-G-A **
8075405-C-A 8207364-C-A **
7204820-C-G 7336779-C-G **
7155267-C-A 7287226-C-A **
7196093-C-A 7328052-C-A **
6978557-C-A 7110516-C-A **
6667489-G-C 6799448-G-C **
6667494-A-G 6799453-A-G **
6667496-C-T 6799455-C-T **
6767783-G-T 6899742-G-T **
6789252-C-A 6921211-C-A **
6808080-G-A 6940039-G-A **
6828017-C-A 6959976-C-A **
6840781-C-A 6972740-C-A **
6867564-G-A 6999523-G-A **
6918528-T-C 7050487-T-C **
6953348-T-G 7085307-T-G **
6957152-C-A 7089111-C-A **
6978517-G-T 7110476-G-T **
7011552-CA-C 7143511-CA-C **
7176016-T-C 7307975-T-C **
7020539-A-C 7152498-A-C **
7031102-G-T 7163061-G-T **
7040218-G-T 7172177-G-T **
7061248-T-C 7193207-T-C **
7088603-C-A 7220562-C-A **
7101126-G-T 7233085-G-T **
7101980-A-C 7233939-A-C **
7106428-C-A 7238387-C-A **
7113144-T-C 7245103-T-C **
7124979-C-A 7256938-C-A **
7153082-C-A 7285041-C-A **
7154843-G-T 7286802-G-T **
7155263-G-A 7287222-G-A **
8852673-C-T 8984632-C-T **
8852524-C-A 8984483-C-A **
9111677-T-A 9274068-T-A **
8865703-C-A 8997662-C-A **
13463804-C-A 11308128-C-A **
10976912-C-A **
10990481-C-A **
11034623-C-G **
13195826-T-C 11040150-T-C **
13200378-A-C 11044702-A-C **
13202606-C-A 11046930-C-A **
13294240-C-A 11138564-C-A **
13302061-G-T 11146385-G-T **
13312803-A-G 11157127-A-G **
13421645-G-T 11265969-G-T **
13448775-A-C 11293099-A-C **
13459375-C-A 11303699-C-A **
13461033-C-A 11305357-C-A **
13469144-T-C 11313468-T-C **
10945949-C-A **
13469363-A-G 11313687-A-G **
13480062-A-G 11324386-A-G **
13480903-T-C 11325227-T-C **
13526475-C-A 11370799-C-A **
13566386-T-A 11410710-T-A **
11665812-A-G **
13803422-G-T 11682716-G-T **
13804413-G-A 11683707-G-A **
13859957-A-C 11739251-A-C **
13859959-G-C 11739253-G-C **
13859963-T-A 11739257-T-A **
13887647-CAA-C 11766941-CAA-C **
13887677-A-G 11766971-A-G BY30255 **
13887685-A-G 11766979-A-G **
10946181-C-A **
10940367-A-G **
6590339-A-G 6722298-A-G **
9890529-A-G 10052920-A-G **
9111685-A-T 9274076-A-T **
9111687-G-T 9274078-G-T **
9166399-C-A 9328790-C-A **
9410460-C-A 9572851-C-A **
9423056-C-T 9585447-C-T **
9424387-T-G 9586778-T-G **
9444479-C-A 9606870-C-A **
9444494-A-C 9606885-A-C **
9462260-G-T 9624651-G-T **
9508489-C-G 9670880-C-G **
9521397-C-G 9683788-C-G **
9624634-G-T 9787025-G-T IR3_Prx **
9730641-T-C 9893032-T-C IR3_Prx **
9830824-C-A 9993215-C-A **
9906773-C-A 10069164-C-A **
10898719-C-A **
9937103-G-T 10099494-G-T **
9937119-G-T 10099510-G-T **
10057878-A-C 10220269-A-C **
10067060-T-C 10229451-T-C **
10677613-T-C **
10757465-C-A **
10760424-C-CAATTA **
10780335-C-A **
10788693-C-A **
10810693-T-C **
10826880-A-C **
10839016-A-G **
10874178-T-C **
10885171-C-T **
6666366-G-A 6798325-G-A **
6070083-C-A 6202042-C-A **
6581874-C-A 6713833-C-A **
8677029-C-A 8808988-C-A **
10754044-C-T **
5230927-C-A 5362886-C-A **
17333941-C-A 15222061-C-A **
23126680-C-A 20964794-C-A **
19547267-A-C 17435387-A-C **
28091455-A-C 25945308-A-C P1_Y2 10×AC**
9874970-G-A 10037361-G-A **
23048232-C-A 20886346-C-A **
4136648-AC-A 4268607-AC-A **
21919402-TTC-T 19757516-TTC-T **
8341678-C-A 8473637-C-A **
17318823-C-A 15206943-C-A **
28500756-C-T 26354609-C-T **
7507129-G-T 7639088-G-T **
4557241-C-A 4689200-C-A **
14345021-C-A 12224316-C-A **
21238281-C-A 19076395-C-A **
17397253-ATTTT-A 15285373-ATTTT-A 16×T**
2790511-C-A 2922470-C-A **
27521793-G-A 25375646-G-A P1_Y2 **
2689424-C-A 2821383-C-A **
13453710-T-C 11298034-T-C **
22868830-C-A 20706944-C-A 10×A**
13213251-C-A 11057575-C-A **
18858552-C-A 16746672-C-A **
2885407-C-A 3017366-C-A **
6808081-G-T 6940040-G-T **
13887663-T-C 11766957-T-C **
15740862-C-A 13628982-C-A **
17037331-A-T 14925451-A-T **
14622112-C-A 12510310-C-A **
16232251-C-A 14120371-C-A **
15952026-T-C 13840146-T-C **
8288740-C-A 8420699-C-A **
6748731-C-A 6880690-C-A **
6806725-C-A 6938684-C-A **
24220979-G-T 22074832-G-T P3_b1 **
17193165-T-C 15081285-T-C **
9172689-C-A 9335080-C-A **
18848514-A-G 16736634-A-G **
17734980-T-G 15623100-T-G **
22207275-C-A 20045389-C-A **
4174509-C-A 4306468-C-A **
8384756-G-T 8516715-G-T **
9551440-G-GTC 9713831-G-GTC IR3_Prx 11×T**
19391345-C-A 17279465-C-A **
13987272-G-A 11866566-G-A **
17058643-C-T 14946763-C-T **
8636018-A-G 8767977-A-G **
19532452-C-A 17420572-C-A **
15612233-C-CAT 13500353-C-CAT **
15035000-C-A 12923088-C-A **
18891251-C-A 16779371-C-A **
28091459-C-CAA 25945312-C-CAA P1_Y2 **
16575-C-T **
16071818-C-A 13959938-C-A **
17402419-C-A 15290539-C-A **
13198678-C-A 11043002-C-A **
14736105-C-A 12624173-C-A **
17181528-C-A 15069648-C-A **
8635994-GAC-G 8767953-GAC-G **
8636013-C-CAT 8767972-C-CAT **
8636017-C-T 8767976-C-T **
9082380-C-A 9244771-C-A **
2689421-A-T 2821380-A-T **
6346127-C-A 6478086-C-A **
5074649-G-T 5206608-G-T **
4336659-C-A 4468618-C-A **
4455994-G-T 4587953-G-T **
4470730-A-C 4602689-A-C **
4700824-A-C 4832783-A-C **
4758113-G-T 4890072-G-T **
4769455-C-A 4901414-C-A **
4770564-A-T 4902523-A-T **
4788881-C-A 4920840-C-A **
4804654-G-T 4936613-G-T **
4860404-C-A 4992363-C-A **
4866866-C-A 4998825-C-A **
4874903-G-T 5006862-G-T **
4936983-T-C 5068942-T-C **
4951033-C-A 5082992-C-A **
5200333-C-T 5332292-C-T **
4244948-C-A 4376907-C-A **
5221002-A-C 5352961-A-C **
5461503-C-A 5593462-C-A **
5558489-C-T 5690448-C-T **
5571177-G-T 5703136-G-T **
5675364-C-A 5807323-C-A **
5755767-G-T 5887726-G-T **
5816911-A-G 5948870-A-G **
5861613-A-C 5993572-A-C **
5874122-C-A 6006081-C-A **
5990194-C-A 6122153-C-A **
6000735-C-G 6132694-C-G **
6001493-C-A 6133452-C-A **
6010152-T-G 6142111-T-G **
13952640-C-G 11831934-C-G **
4326526-C-A 4458485-C-A **
4136650-AC-A 4268609-AC-A **
2691812-C-A 2823771-C-A **
2867846-C-A 2999805-C-A **
2728157-C-T 2860116-C-T **
2759467-AAAAC-A 2891426-AAAAC-A **
2759477-A-G 2891436-A-G **
2759490-AG-A 2891449-AG-A **
2759498-T-TGGTG 2891457-T-TGGTG **
2759502-ACGTG-A 2891461-ACGTG-A **
2773765-G-T 2905724-G-T **
2785208-C-A 2917167-C-A **
2812832-C-A 2944791-C-A **
2817705-TC-T 2949664-TC-T **
2835756-C-A 2967715-C-A **
2850989-C-T 2982948-C-T **
2854987-T-C 2986946-T-C **
2859227-G-T 2991186-G-T **
2878032-C-A 3009991-C-A **
4093456-G-T 4225415-G-T **
2888775-G-T 3020734-G-T **
2898313-G-T 3030272-G-T **
2898330-G-T 3030289-G-T **
3393191-C-A 3525150-C-A **
3536213-C-A 3668172-C-A **
3545963-G-T 3677922-G-T **
3599068-C-A 3731027-C-A **
3627325-A-T 3759284-A-T **
3665703-G-T 3797662-G-T **
3681398-G-A 3813357-G-A **
3685358-G-T 3817317-G-T **
3726259-C-A 3858218-C-A **
3731949-C-A 3863908-C-A **
4081461-C-A 4213420-C-A **
13894274-C-A 11773568-C-A **
14018087-A-G 11897381-A-G **
13973350-T-G 11852644-T-G **
21262619-G-A 19100733-G-A **
20700642-TG-A 18538756-TG-A P4_Prx **
21029279-C-A 18867393-C-A P4_Dst **
21054295-C-A 18892409-C-A **
21087093-G-T 18925207-G-T **
21100442-A-G 18938556-A-G **
21106782-C-A 18944896-C-A **
21113007-C-A 18951121-C-A **
21118478-A-C 18956592-A-C **
21135046-C-A 18973160-C-A **
21167347-C-A 19005461-C-A **
21182377-C-A 19020491-C-A **
21207102-C-A 19045216-C-A **
21240795-C-A 19078909-C-A **
21265334-C-A 19103448-C-A **
20631871-T-G 18469985-T-G P4_Prx **
21301387-C-A 19139501-C-A **
21305034-C-A 19143148-C-A **
21329592-C-A 19167706-C-A **
21491148-C-A 19329262-C-A **
21498938-T-G 19337052-T-G **
21505660-C-A 19343774-C-A **
21523227-C-A 19361341-C-A **
21634288-T-C 19472402-T-C **
21665682-C-A 19503796-C-A **
21714701-A-G 19552815-A-G **
21895586-C-A 19733700-C-A **
21910074-T-C 19748188-T-C **
21923870-C-A 19761984-C-A **
21963798-A-C 19801912-A-C **
20631875-G-T 18469989-G-T P4_Prx **
20574791-G-T 18412905-G-T P5_Dst **
22013612-C-T 19851726-C-T **
19373793-G-T 17261913-G-T **
18780573-T-C 16668693-T-C **
18814755-C-A 16702875-C-A **
18864487-T-C 16752607-T-C **
18865139-A-G 16753259-A-G **
18892038-C-A 16780158-C-A **
18923249-C-A 16811369-C-A **
18937246-C-T 16825366-C-T **
18949661-C-A 16837781-C-A **
19040667-C-A 16928787-C-A **
19088154-C-A 16976274-C-A **
19271979-C-A 17160099-C-A **
19314695-C-A 17202815-C-A **
19358687-A-G 17246807-A-G **
19362648-C-T 17250768-C-T **
19407659-G-T 17295779-G-T **
20458876-T-C 18296990-T-C P5_Dst **
19407674-C-G 17295794-C-G **
19407692-C-A 17295812-C-A **
19415633-C-A 17303753-C-A **
19429470-G-T 17317590-G-T **
19437755-A-G 17325875-A-G **
19461774-C-T 17349894-C-T **
19475194-C-A 17363314-C-A **
19508201-C-T 17396321-C-T **
19547264-T-C 17435384-T-C **
19588052-T-TC 17476172-T-TC P5_Prx **
19663401-C-A 17551521-C-A P5_Prx **
19950024-T-TC 17838144-T-TC P5_Prx **
20021537-A-T 17909657-A-T P5_Prx **
20420962-A-AG 18259076-A-AG P5_Dst **
21966391-C-G 19804505-C-G **
22033412-C-A 19871526-C-A **
18756938-T-C 16645058-T-C **
28621919-C-T 26475772-C-T **
24885565-C-A 22739418-C-A g1 **
25651763-T-C 23505616-T-C P1_b3 **
26478224-G-T 24332077-G-T P1_Y1 **
26538979-G-T 24392832-G-T P1_g2 **
26699124-T-C 24552977-T-C P1_g2 **
27535169-G-T 25389022-G-T P1_Y2 **
27571001-A-C 25424854-A-C P1_Y2 **
28459271-G-T 26313124-G-T **
28588184-C-A 26442037-C-A **
28609686-G-C 26463539-G-C **
28611572-G-T 26465425-G-T **
28621906-C-A 26475759-C-A **
28621907-A-T 26475760-A-T **
28621920-A-G 26475773-A-G **
24407060-G-T 22260913-G-T **
28621929-A-C 26475782-A-C **
28643750-C-A 26497603-C-A **
28661657-T-C 26515510-T-C **
28707319-C-A 26561172-C-A **
28716277-T-C 26570130-T-C **
28731843-C-A 26585696-C-A **
28778002-G-A 26631855-G-A **
28787994-A-G 26641847-A-G **
56833589-A-T **
56837160-G-T **
56837526-G-T **
56838442-G-T **
56843912-G-T **
56856873-C-A **
24614152-G-T 22468005-G-T P3_t2 **
24382060-G-T 22235913-G-T **
22090026-A-G 19928140-A-G **
22970192-G-T 20808306-G-T **
22092983-T-G 19931097-T-G **
22170302-C-G 20008416-C-G **
22173555-C-A 20011669-C-A **
22199549-CA-C 20037663-CA-C **
22264488-A-G 20102602-A-G DYZ19 **
22488991-A-G 20327105-A-G DYZ19 **
22489007-G-T 20327121-G-T DYZ19 **
22527259-G-T 20365373-G-T **
22729486-G-A 20567600-G-A **
22760700-C-A 20598814-C-A **
22802943-A-G 20641057-A-G **
22836509-T-C 20674623-T-C **
22901840-G-T 20739954-G-T **
22910540-T-A 20748654-T-A **
23025686-C-A 20863800-C-A **
23983159-G-T 21837012-G-T **
23120089-C-A 20958203-C-A **
23186049-C-A 21024163-C-A **
23200551-T-C 21038665-T-C **
23252380-A-T 21090494-A-T **
23262863-G-T 21100977-G-T **
23272948-A-G 21111062-A-G **
23285492-T-C 21123606-T-C **
23316211-AT-A 21154325-AT-A **
23413041-G-C 21251155-G-C **
23522460-T-A 21360574-T-A **
23554991-G-T 21393105-G-T **
23609138-C-A 21447252-C-A **
23609602-C-A 21447716-C-A **
23971028-G-T 21824881-G-T **
18756942-T-C 16645062-T-C **
18756923-T-G 16645043-T-G **
10949736-T-G **
15503494-C-A 13391614-C-A **
15065113-A-T 12953205-A-T **
15066469-A-G 12954560-A-G **
15070336-A-C 12958427-A-C **
15073858-C-A 12961948-C-A **
15087436-G-T 12975526-G-T **
15127683-A-C 13015770-A-C **
15151297-T-C 13039384-T-C **
15228064-C-A 13116150-C-A **
15257738-A-G 13145822-A-G **
15347162-T-G 13235281-T-G **
15396517-T-G 13284637-T-G **
15455125-C-A 13343245-C-A **
15499495-G-C 13387615-G-C **
15532522-T-G 13420642-T-G **
14977406-G-A 12865481-G-A **
15566743-A-G 13454863-A-G **
15689114-C-A 13577234-C-A **
15733878-TCAAA-T 13621998-TCAAA-T **
15756458-C-A 13644578-C-A **
15776322-A-T 13664442-A-T **
15801550-C-A 13689670-C-A **
15811302-T-C 13699422-T-C **
15904088-T-C 13792208-T-C **
15922048-G-A 13810168-G-A **
15938065-C-A 13826185-C-A **
15957091-C-A 13845211-C-A **
16038146-C-A 13926266-C-A **
16046194-C-A 13934314-C-A **
16057911-G-C 13946031-G-C **
15050036-T-G 12938127-T-G **
14927197-C-A 12815262-C-A **
16095230-A-G 13983350-A-G **
14422856-C-A 12302131-C-A **
14038044-C-A 11917338-C-A **
14100934-C-T 11980228-C-T **
14177896-G-T 12057190-G-T **
14198547-T-C 12077841-T-C **
14229272-G-A 12108566-G-A **
14229722-C-A 12109016-C-A **
14250465-G-T 12129759-G-T **
14266250-C-A 12145544-C-A **
14266995-C-A 12146289-C-A **
14278285-C-A 12157579-C-A **
14313515-A-G 12192809-A-G **
14373476-A-C 12252772-A-C **
14385025-C-T 12264321-C-T **
14385284-T-A 12264580-T-A **
14435335-C-A 12314608-C-A **
14914874-T-G 12802941-T-G **
14450424-A-G 12329697-A-G **
14480073-C-A 12359342-C-A **
14546850-G-T 12435051-G-T **
14576436-C-A 12464636-C-A **
14600470-C-A 12488670-C-A **
14622133-A-G 12510331-A-G **
14643615-C-A 12531684-C-A **
14703460-TA-T 12591526-TA-T **
14711990-G-A 12600057-G-A **
14712709-G-T 12600776-G-T **
14771761-C-A 12659830-C-A **
14776005-C-A 12664074-C-A **
14800101-C-A 12688172-C-A **
14880341-C-A 12768411-C-A **
16071798-C-A 13959918-C-A **
16134581-C-A 14022701-C-A **
18756922-C-T 16645042-C-T **
17936788-C-A 15824908-C-A **
17366937-G-T 15255057-G-T **
17375278-TTC-T 15263398-TTC-T **
17386674-G-T 15274794-G-T **
17403825-T-C 15291945-T-C **
17602452-C-A 15490572-C-A **
17637857-C-A 15525977-C-A **
17639279-C-A 15527399-C-A **
17651296-C-A 15539416-C-A **
17714103-C-A 15602223-C-A **
17729156-A-T 15617276-A-T **
17734995-G-C 15623115-G-C **
17734996-T-G 15623116-T-G **
17749275-G-A 15637395-G-A **
17885684-C-A 15773804-C-A **
17942314-C-A 15830434-C-A **
17327315-A-G 15215435-A-G **
17952623-C-CTTT 15840743-C-CTTT 16×T**
18000919-CA-C 15889039-CA-C P7_Gap **
18016612-C-A 15904732-C-A P7_Dst **
18071960-C-A 15960080-C-A **
18072049-G-T 15960169-G-T **
18088461-T-G 15976581-T-G **
18090264-G-T 15978384-G-T **
18097748-C-A 15985868-C-A **
18128013-G-T 16016133-G-T **
18253480-G-T 16141600-G-T **
18581901-T-C 16470021-T-C **
18710468-T-G 16598588-T-G **
18739498-C-A 16627618-C-A **
18751464-G-T 16639584-G-T **
17346350-G-A 15234470-G-A **
17327294-G-T 15215414-G-T **
16211119-G-T 14099239-G-T **
16710504-C-A 14598624-C-A **
16216835-G-T 14104955-G-T **
16308190-A-G 14196310-A-G **
16342145-G-T 14230265-G-T **
16379007-C-A 14267127-C-A **
16384859-T-G 14272979-T-G **
16422197-T-C 14310317-T-C **
16422373-C-A 14310493-C-A **
16504974-C-T 14393094-C-T **
16507943-G-T 14396063-G-T **
16554709-C-A 14442829-C-A **
16593912-A-G 14482032-A-G **
16627698-GTATATATA-G 14515818-GTATATATA-G 12×TA**
16679918-C-T 14568038-C-T FGC66111 **
16703348-A-G 14591468-A-G **
16770525-C-A 14658645-C-A **
17246395-G-A 15134515-G-A **
16818781-GT-G 14706901-GT-G **
16824984-C-A 14713104-C-A **
16826514-C-A 14714634-C-A **
16973908-G-T 14862028-G-T **
16998584-C-A 14886704-C-A **
16999520-T-C 14887640-T-C **
17037346-G-A 14925466-G-A **
17037347-C-G 14925467-C-G **
17059860-G-T 14947980-G-T **
17090597-C-A 14978717-C-A **
17100353-C-A 14988473-C-A **
17158470-C-A 15046590-C-A **
17207338-C-A 15095458-C-A **
17226805-G-T 15114925-G-T **
16717354-G-T 14605474-G-T **
56863139-A-C **
20655026-G-A 18493140-G-A P4_Prx **
14474987-C-A 12354256-C-A **
15912128-C-A 13800248-C-A ****
13696579-G-A 11540903-G-A *****
3208801-C-T 3340760-C-T **
3208846-T-C 3340805-T-C **
14080035-G-GATATAT 11959329-G-GATATAT 29×AT**
23773323-T-TACACAC 21611437-T-TACACAC 24×AC**
13489368-C-A 11333692-C-A **
16590836-C-A 14478956-C-A ****
22252091-C-A 20090205-C-A BY1869 DYZ19 **
17346353-A-G 15234473-A-G **
5976927-C-A 6108886-C-A **
15671151-GTT-G 13559271-GTT-G 13×T**
10970864-C-A **
3851758-G-T 3983717-G-T **
21551672-CACATATATGTATGTATGTGT-C 19389786-CACATATATGTATGTATGTGT-C **
10678121-C-A **
21262605-C-A 19100719-C-A **
5338103-TGC-T 5470062-TGC-T **
21263471-C-T 19101585-C-T Z31092 **
17346345-G-A 15234465-G-A **
13842730-G-GTGGAA 11722024-G-GTGGAA 12×TGGAA**
58860368-C-T 56730503-G-A **
16503042-C-A 14391162-C-A **
16503084-C-T 14391204-C-T **
4226175-G-T 4358134-G-T **
17684311-C-A 15572431-C-A ****
14465406-C-A 12344679-C-A **
17932933-G-A 15821053-G-A **
13351319-A-C 11195643-A-C **
10065836-A-T 10228227-A-T **
22349332-T-G 20187446-T-G DYZ19 **
22358786-G-T 20196900-G-T DYZ19 **
14844388-C-A 12732454-C-A **
23425309-G-A 21263423-G-A **
11009813-C-G **
16423656-C-A 14311776-C-A **
19670774-CT-C 17558894-CT-C P5_Prx **
5066063-G-T 5198022-G-T **
11009942-C-A **
5040891-G-GA 5172850-G-GA 10×A**
15763252-G-T 13651372-G-T **
9524026-TA-T 9686417-TA-T **
6868881-C-G 7000840-C-G ****
5310007-C-A 5441966-C-A **
19892868-GTTT-G 17780988-GTTT-G P5_Prx 31×T**
14933544-C-A 12821609-C-A **
7991358-C-A 8123317-C-A **
18709704-C-A 16597824-C-A **
14039284-C-A 11918578-C-A **
6630624-C-A 6762583-C-A ****
17167874-C-A 15055994-C-A **
7724406-G-T 7856365-G-T **
10807239-A-G **
28679600-C-A 26533453-C-A **
9089039-G-T 9251430-G-T **
19547269-C-T 17435389-C-T **
7144032-C-A 7275991-C-A **
4094590-C-A 4226549-C-A **
23609951-C-A 21448065-C-A **
19075343-G-A 16963463-G-A **
56833502-CCACTA-T **
9056459-C-A **
10946139-C-A **
14540595-C-A 12428796-C-A **
56839461-T-CC **
56830344-A-T **
13489016-C-T 11333340-C-T ***
14118812-G-T 11998106-G-T ***
13466443-C-G 11310767-C-G ***
13470103-G-A 11314427-G-A ***
13727661-G-T 11571985-G-T ***
13470483-G-T 11314807-G-T ***
13470530-G-T 11314854-G-T ***
6341130-C-A 6473089-C-A IR3_Dst ***
13470538-G-T 11314862-G-T ***
13488438-T-A 11332762-T-A ***
13727222-G-A 11571546-G-A ***
13726937-A-C 11571261-A-C ***
13726909-G-A 11571233-G-A ***
13489044-G-A 11333368-G-A ***
13489200-G-A 11333524-G-A ***
13489398-G-T 11333722-G-T ***
6640586-T-A 6772545-T-A ***
13424737-T-C 11269061-T-C ***
16971187-G-A 14859307-G-A ***
17047880-AT-A,ATT 14936000-AT-A,ATT 16×T***
13489475-T-G 11333799-T-G ***
13726903-A-G 11571227-A-G ***
13727042-T-A 11571366-T-A ***
17005652-G-T 14893772-G-T ***
13489028-C-T 11333352-C-T ***
13351474-G-C 11195798-G-C ***
13351499-A-G 11195823-A-G ***
9432658-A-C 9595049-A-C ***
18270059-C-A 16158179-C-A ***
8062650-T-A 8194609-T-A ***
8064645-C-A 8196604-C-A ***
7441698-G-T 7573657-G-T ***
8177846-G-A 8309805-G-A ***
14180996-G-C 12060290-G-C ***
9303323-C-A 9465714-C-A ***
9315677-G-T 9478068-G-T ***
9410483-G-C 9572874-G-C ***
6248961-C-A 6380920-C-A IR3_Dst ***
7297197-A-G 7429156-A-G ***
7003515-G-A 7135474-G-A ***
6721131-T-G 6853090-T-G ***
6244752-G-C 6376711-G-C IR3_Dst ***
9527705-T-C 9690096-T-C ***
18564532-C-A 16452652-C-A ***
9529427-T-A 9691818-T-A IR3_Prx ***
9636452-C-G 9798843-C-G IR3_Prx ***
9665286-A-T 9827677-A-T IR3_Prx ***
9719216-T-C 9881607-T-C IR3_Prx ***
9779343-G-T 9941734-G-T ***
9802337-T-C 9964728-T-C ***
6259259-A-T 6391218-A-T IR3_Dst ***
10078336-A-T 10240727-A-T ***
13114631-C-T 10604117-C-T ***
13132770-A-G 10622256-A-G ***
13311734-G-C 11156058-G-C ***
13340994-G-T 11185318-G-T ***
17503523-C-A 15391643-C-A ***
17475293-T-C 15363413-T-C ***
9299404-G-A 9461795-G-A ***
17161381-T-A 15049501-T-A ***
14632232-G-T 12520301-G-T ***
20084789-A-T 17972909-A-T P5_Dst ***
15513558-C-T 13401678-C-T ***
18971236-A-T 16859356-A-T ***
19102433-T-C 16990553-T-C ***
19326820-C-A 17214940-C-A ***
19428875-G-A 17316995-G-A ***
19487639-G-T 17375759-G-T ***
19575219-G-T 17463339-G-T P5_Prx ***
19611328-T-C 17499448-T-C P5_Prx ***
15185243-C-A 13073329-C-A ***
19846282-G-T 17734402-G-T P5_Prx ***
19846299-G-T 17734419-G-T P5_Prx ***
19987925-G-T 17876045-G-T P5_Prx ***
19996959-C-G 17885079-C-G P5_Prx ***
20025387-G-A 17913507-G-A P5_Prx ***
20084963-G-T 17973083-G-T P5_Dst ***
18959203-A-T 16847323-A-T ***
15053678-C-A 12941769-C-A ***
20438410-G-T 18276524-G-T P5_Dst ***
20501858-T-G 18339972-T-G P5_Dst ***
20510855-G-T 18348969-G-T P5_Dst ***
20567981-C-A 18406095-C-A P5_Dst ***
20645930-C-A 18484044-C-A P4_Prx ***
20645999-G-T 18484113-G-T P4_Prx ***
20646012-G-T 18484126-G-T P4_Prx ***
20646015-G-A 18484129-G-A P4_Prx ***
20866033-G-T 18704147-G-T P4_Dst ***
14712089-C-A 12600156-C-A ***
20943055-G-T 18781169-G-T P4_Dst ***
20998260-T-C 18836374-T-C P4_Dst ***
21670158-C-T 19508272-C-T ***
18971235-A-G 16859355-A-G ***
18800587-A-G 16688707-A-G ***
14736598-T-C 12624666-T-C ***
16815016-G-C 14703136-G-C ***
15098373-A-G 12986461-A-G ***
15189299-C-A 13077385-C-A ***
15636545-T-G 13524665-T-G ***
15646942-T-C 13535062-T-C ***
15854436-A-C 13742556-A-C ***
16097230-A-C 13985350-A-C ***
16484090-C-A 14372210-C-A ***
16097232-A-T 13985352-A-T ***
16209481-T-A 14097601-T-A ***
16395521-C-A 14283641-C-A ***
16209527-C-T 14097647-C-T ***
16701449-C-T 14589569-C-T ***
16726947-T-C 14615067-T-C ***
16213751-C-A 14101871-C-A ***
16815069-G-T 14703189-G-T ***
15713342-AT-A 13601462-AT-A ***
16974271-T-A 14862391-T-A ***
16977276-A-G 14865396-A-G ***
17059505-A-G 14947625-A-G ***
17161043-G-A 15049163-G-A ***
6163951-T-A 6295910-T-A IR3_Dst ***
17227033-C-T 15115153-C-T ***
17230521-T-G 15118641-T-G ***
17785211-T-C 15673331-T-C ***
15877589-C-A 13765709-C-A ***
18275404-T-A 16163524-T-A P6_Prx ***
18291305-C-T 16179425-C-T P6_Prx ***
18298124-A-T 16186244-A-T P6_Prx ***
18479329-C-A 16367449-C-A P6_Dst ***
18799581-A-G 16687701-A-G ***
6178765-A-C 6310724-A-C IR3_Dst ***
58854447-CA-C 56736421-AT-A ***
6011558-A-T 6143517-A-T ***
58823032-G-C 56767839-C-G ***
58975910-T-TTCCATTCCATTCCATTCCATCTCATTGCATTCGTC 56829763-T-TTCCATTCCATTCCATTCCATCTCATTGCATTCGTC ***
24315731-C-A 22169584-C-A P3_t1 ***
58975920-T-G 56829773-T-G ***
58976192-C-T 56830045-C-T ***
23966612-G-T 21820465-G-T ***
23953221-G-T 21807074-G-T ***
23953217-G-T 21807070-G-T ***
23792016-C-A 21630130-C-A ***
23745355-G-T 21583469-G-T ***
58980848-G-A 56834701-G-A ***
58855949-G-T 56734922-C-A ***
15263355-G-GTTAAAT 13151440-GTAAATT-TTAAATG ***
20377686-GA-G 18215800-GA-G P5_Dst 13×A***
27087610-GCCTTCCTTCCTT-G 24941463-GCCTTCCTTCCTT-G P1_r4 15×CCTT***
22366032-G-T 20204146-G-T DYZ19 ***
58975678-A-C 56829531-A-C ***
27651810-G-A 25505663-G-A P1_Y2 ***
13351508-G-A 11195832-G-A ***
13470522-G-A 11314846-G-A ***
22322768-A-C 20160882-A-C DYZ19 ***
23062152-C-A 20900266-C-A ***
58908848-T-C 56682023-A-G ***
25207733-G-A 23061586-G-A P2_r1 ***
22333380-C-G 20171494-C-G DYZ19 ***
22311258-A-T 20149372-A-T DYZ19 ***
22323036-A-C 20161150-A-C DYZ19 ***
58845140-T-A 56745731-A-T ***
22732966-C-A 20571080-C-A ***
58845909-C-T 56744962-G-A ***
22322726-T-A 20160840-T-A DYZ19 ***
24391542-G-A 22245395-G-A ***
24425335-A-AAATG 22279188-A-AAATG ***
14787825-TATA-T 12675895-TATA-T ***
13686820-C-G 11531144-C-G ***
8501689-CTCT-C,CT 8633648-CTCT-C,CT 18×TCT***
9187478-A-G 9349869-A-G ***
13142280-T-G 10631766-T-G ***
56834482-C-G ***
13142282-T-A 10631768-T-A ***
56833357-A-G ***
56826553-CCTTCCATTCGATTCTATTCCATTCGATTCT-C,CTTTCCATTTGATTCTATTCCATTCGATTCT ***
28788605-C-A 26642458-C-A ***
13142285-T-C 10631771-T-C ***
13455108-C-G 11299432-C-G ***
13649003-GGAATT-G 11493327-GGAATT-G ***
13652097-GGAATCGAACA-G 11496421-GGAATCGAACA-G ***
13658381-A-G 11502705-A-G ***
13658401-CGAATG-C 11502725-CGAATG-C 4×GAATG***
13823270-A-G 11702564-A-G ***
58975603-A-T 56829456-A-T ***
13839860-G-A 11719154-G-A ***
13843664-C-G 11722958-C-G ***
13857505-G-T 11736799-G-T ***
13869599-G-T 11748893-G-T ***
28546988-C-A 26400841-C-A ***
27862535-TGAGAGA-T,TGAGAGAGA 25716388-TGAGAGA-T,TGAGAGAGA P1_Y2 22×GA***
22272284-A-G 20110398-A-G DYZ19 ***
26165192-C-T 24019045-C-T P1_Y1 ***
27810194-A-G 25664047-A-G P1_Y2 ***
28807296-C-A 26661149-C-A ***
58819382-C-T 56771489-G-A ***
58974016-C-A 56827869-C-A ***
25108986-C-A 22962839-C-A g1 ***
58975582-C-T 56829435-C-T ***
5354735-TATATATATATACAC-T 5486694-TATATATATATACAC-T ***
18775580-TGA-T 16663700-TGA-T ***
5346655-T-C 5478614-T-C ***
58913542-G-T 56677329-C-A ***
58909657-C-T 56681214-G-A ***
58858901-CCATTCCATTCCATTG-C 56731937-GTGCAATGGAATGGAA-G ***
22341179-A-T 20179293-A-T DYZ19 ***
22341180-G-A 20179294-G-A DYZ19 ***
22114388-A-T 19952502-A-T ***
22364485-C-A 20202599-C-A DYZ19 ***
58890719-T-A 56700152-A-T ***
27499244-T-G 25353097-T-G P1_Y2 ***
8125005-AAAGG-A 8256964-AAAGG-A ***
4275303-T-G 4407262-T-G ***
22330219-A-T 20168333-A-T DYZ19 ***
24235169-G-C 22089022-G-C P3_b1 ***
58913626-A-T 56677245-T-A ***
22281893-T-G 20120007-T-G DYZ19 ***
28235229-T-C 26089082-T-C P1_b4 ***
25717439-T-A 23571292-T-A P1_b3 ***
26416496-G-A 24270349-G-A P1_Y1 ***
58834626-C-G 56756245-G-C ***
58819948-C-T 56770923-G-A ***
2786773-A-T 2918732-A-T ***
2786793-A-C 2918752-A-C ***
3633061-T-C 3765020-T-C ***
3838714-A-G 3970673-A-G ***
3871464-C-T 4003423-C-T ***
19071644-C-T 16959764-C-T ***
4429114-T-C 4561073-T-C ***
4698805-T-A 4830764-T-A ***
4726140-A-T 4858099-A-T ***
5107410-G-A 5239369-G-A ***
18907995-T-TAC 16796115-T-TAC 8×AC***
58876802-T-A 56714069-A-T ***
22356785-T-C 20194899-T-C DYZ19 ***
22146262-G-A 19984376-G-A ***
13742278-T-C 11586602-T-C ***
22115447-CTT-C,CT 19953561-CTT-C,CT 12×T***
58977747-C-A 56831600-C-A ***
22342907-G-C 20181021-G-C DYZ19 ***
22357272-G-A 20195386-G-A DYZ19 ***
22357300-T-A 20195414-T-A DYZ19 ***
22502297-T-A 20340411-T-A DYZ19 ***
13454813-A-ATTCCC 11299137-A-ATTCCC ***
17275760-A-AGGGAC 15163880-A-AGGGAC ***
21829990-T-A 19668104-T-A ***
58839145-G-C 56751726-C-G ***
21713500-C-A 19551614-C-A ***
58839164-C-T 56751707-G-A ***
24910853-CATAT-C 22764706-CATAT-C g1 26×AT***
22357280-A-T 20195394-A-T DYZ19 ***
22272937-TAG-T 20111051-TAG-T DYZ19 ***
13728060-C-T 11572384-C-T ***
25845166-T-A 23699019-T-A P1_b3 ***
17196748-GT-AA 15084868-GT-AA ***
25592446-AT-A 23446299-AT-A P1_gr1 14×T***
9885647-CTTT-C 10048038-CTTT-C 16×T***
21300353-C-A 19138467-C-A ***
58876430-C-G 56714441-G-C ***
22252503-C-G 20090617-C-G DYZ19 ***
9307396-CTT-GTG 9469787-CTT-GTG ***
22356760-GTCCATCACATA-TTCCTTCAGATG 20194874-GTCCATCACATA-TTCCTTCAGATG DYZ19 ***
21829853-T-A 19667967-T-A ***
21174606-T-C 19012720-T-C ***
24862094-T-A 22715947-T-A P3_b2 ***
25444461-G-T 23298314-G-T P2_r2 ***
58887966-T-A 56702905-A-T ***
22114186-C-A 19952300-C-A ***
22328411-T-G 20166525-T-G DYZ19 ***
22193437-T-G 20031551-T-G ***
28331647-A-T 26185500-A-T P1_b4 ***
27525162-G-T 25379015-G-T P1_Y2 ***
27525165-C-T 25379018-C-T P1_Y2 ***
27528973-C-A 25382826-C-A P1_Y2 ***
27528991-G-A 25382844-G-A P1_Y2 ***
27651841-C-T 25505694-C-T P1_Y2 ***
27884320-A-G 25738173-A-G P1_Y2 ***
27884328-T-A 25738181-T-A P1_Y2 ***
27902244-C-T 25756097-C-T P1_Y2 ***
28032139-C-A 25885992-C-A P1_Y2 ***
28117213-C-T 25971066-C-T P1_b4 ***
28170743-T-G 26024596-T-G P1_b4 ***
28237487-G-C 26091340-G-C P1_b4 ***
28246397-A-T 26100250-A-T P1_b4 ***
28253484-T-A 26107337-T-A P1_b4 ***
28333340-T-C 26187193-T-C P1_b4 ***
27499296-C-A 25353149-C-A P1_Y2 ***
58837599-C-T 56753272-G-A ***
58868535-T-G 56722336-A-C ***
58864014-C-A 56726857-G-T ***
4778520-T-C 4910479-T-C ***
58862448-C-A 56728423-G-T ***
58844301-T-C 56746570-A-G ***
58841822-C-G 56749049-G-C ***
58834597-A-C 56756274-T-G ***
28355900-A-T 26209753-A-T P1_gr2 ***
58834542-G-C 56756329-C-G ***
58824828-C-G 56766043-G-C ***
4951357-T-A 5083316-T-A ***
58819986-T-G 56770885-A-C ***
28753633-T-C 26607486-T-C ***
28457674-G-A 26311527-G-A ***
27516724-T-A 25370577-T-A P1_Y2 ***
27499294-C-A 25353147-C-A P1_Y2 ***
58876420-C-T 56714451-G-A ***
26584286-C-T 24438139-C-T P1_g2 ***
26810590-A-T 24664443-A-T P1_g2 ***
26810518-G-A 24664371-G-A P1_g2 ***
26726509-G-A 24580362-G-A P1_g2 ***
26635699-T-C 24489552-T-C P1_g2 ***
26625857-C-G 24479710-C-G P1_g2 ***
26591721-G-A 24445574-G-A P1_g2 ***
26584189-T-A 24438042-T-A P1_g2 ***
26980638-C-T 24834491-C-T P1_r4 ***
26553971-C-G 24407824-C-G P1_g2 ***
26477674-A-G 24331527-A-G P1_Y1 ***
26463197-T-C 24317050-T-C P1_Y1 ***
7196613-C-A 7328572-C-A ***
26463188-A-C 24317041-A-C P1_Y1 ***
26463164-A-G 24317017-A-G P1_Y1 ***
26948574-G-T 24802427-G-T P1_r3 ***
26991032-C-A 24844885-C-A P1_r4 ***
27499287-T-A 25353140-T-A P1_Y2 ***
27424796-C-A 25278649-C-A P1_g3 ***
6768541-G-A 6900500-G-A ***
6769725-C-A 6901684-C-A ***
27499256-T-G 25353109-T-G P1_Y2 ***
27498663-C-A 25352516-C-A P1_Y2 ***
27466253-C-T 25320106-C-T P1_Y2 ***
27434707-A-T 25288560-A-T P1_g3 ***
27353328-G-T 25207181-G-T P1_g3 ***
27077156-A-C 24931009-A-C P1_r4 ***
27340858-A-C 25194711-A-C P1_g3 ***
27284850-A-C 25138703-A-C P1_g3 ***
27284723-A-C 25138576-A-C P1_g3 ***
27272169-A-C 25126022-A-C P1_g3 ***
27230946-T-A 25084799-T-A P1_g3 ***
27225049-G-C 25078902-G-C P1_g3 ***
58868616-C-G 56722255-G-C ***
58876659-C-T 56714212-G-A ***
26421947-G-T 24275800-G-T P1_Y1 ***
18050048-AATATATATATATATATAT-A 15938168-AATATATATATATATATAT-A 19×AT***
23661080-TA-T 21499194-TA-T 10×A***
14379598-GATACATAC-G,GATAGATAGATACATAC 12258894-GATACATAC-G,GATAGATAGATACATAC ***
22503332-CCAGAT-GCTGAG 20341446-CCAGAT-GCTGAG DYZ19 ***
22488380-GAGT-CAGG 20326494-GAGT-CAGG DYZ19 ***
22450384-TTTAG-GTTAT 20288498-TTTAG-GTTAT DYZ19 ***
22292017-CT-AA 20130131-CT-AA DYZ19 ***
17275779-A-AAGGGG 15163899-A-AAGGGG ***
24447126-A-AGAAT 22300979-A-AGAAT ***
17196752-A-AAAGG 15084872-A-AAAGG ***
16242633-T-TCTATCTAC 14130753-T-TCTATCTAC ***
16050926-C-CTTTT 13939046-C-CTTTT ***
15278821-T-TTTATTTTATA 13166910-A-ATTATT 6×TTATA***
2707975-GT-G,GTT 2839934-GT-G,GTT 18×T***
15037755-A-AGT 12925845-A-AGT ***
24305272-CAAAAAAAAAA-C 22159125-CAAAAAAAAAA-C P3_t1 21×A***
24614413-G-GA 22468266-G-GA P3_t2 10×A***
13489567-CCGGGG-ACTGGA 11333891-CCGGGG-ACTGGA ***
6931328-C-A 7063287-C-A ***
16711217-C-A 14599337-C-A ***
10776523-A-G ***
6953254-GAC-G 7085213-GAC-G ***
56830971-C-G ***
13455788-C-G 11300112-C-G ***
6168439-AAT-A 6300398-AAT-A IR3_Dst ***
58866702-CATTC-AATTA 56724165-GAATG-TAATT ***
25724454-CCACACA-C 23578307-CCACACA-C P1_b3 19×CA***
58820103-AATC-CATT 56770765-GATT-AATG ***
58819983-AATT-GATG 56770885-AATT-CATC ***
28170502-CA-C 26024355-CA-C P1_b4 15×A***
27072229-G-GATATAT 24926082-G-GATATAT P1_r4 21×AT***
26890135-GATATAT-G 24743988-GATATAT-G P1_r3 20×AT***
26810515-GTAG-TTAA 24664368-GTAG-TTAA P1_g2 ***
13688218-AATGGC-A 11532542-AATGGC-A ***
13489474-CT-AG 11333798-CT-AG ***
58876690-C-T 56714181-G-A ***
58901942-G-C 56688929-C-G ***
58912059-A-T 56678812-T-A ***
58908943-T-G 56681928-A-C ***
58908658-T-C 56682213-A-G ***
58905889-G-T 56684982-C-A ***
58902224-C-A 56688647-G-T ***
58901956-T-C 56688915-A-G ***
58901919-G-A 56688952-C-T ***
28442556-CA-C 26296409-CA-C P1_gr2 16×A***
58899839-A-C 56691032-T-G ***
58899403-C-T 56691468-G-A ***
58891018-T-A 56699853-A-T ***
58887224-T-A 56703647-A-T ***
58886842-G-C 56704029-C-G ***
58884468-A-T 56706403-T-A ***
58971125-T-C 56824978-T-C ***
3164460-C-A 3296419-C-A ***
13489442-CAGCGG-AAGCAA 11333766-CAGCGG-AAGCAA ***
13139551-CATTCCATTCCATTCCATTCCATTCCATTCCATTCCACTCCACTCCAAACCATTCT-C 10629037-CATTCCATTCCATTCCATTCCATTCCATTCCATTCCACTCCACTCCAAACCATTCT-C ***
13489398-GG-TT 11333722-GG-TT ***
13478612-GACTGACTG-AACTAACTA 11322936-GACTGACTG-AACTAACTA ***
13454811-C-CCATTA 11299135-C-CCATTA ***
13454807-T-TATTCC 11299131-T-TATTCC ***
13447126-C-CCATTT 11291450-C-CCATTT ***
13447110-T-TCCATC 11291434-T-TCCATC ***
13139020-T-TCAATCCCATTC 10628506-T-TCAATCCCATTC ***
3012709-C-A 3144668-C-A ***
9024003-A-ACTGAATGTTAAATATATAATTAACAGCAGCATTCAGTATAGACCTTTAATTAGTAAATG 9186394-A-ACTGAATGTTAAATATATAATTAACAGCAGCATTCAGTATAGACCTTTAATTAGTAAATG ***
8566855-C-CT 8698814-C-CT ***
8125045-AAAG-A 8257004-AAAG-A ***
3930563-G-GTA 4062522-G-GTA 21×TA***
3822962-GATATATATATAT-G 3954921-GATATATATATAT-G 26×AT***
3790878-G-GTGTGTATATA 3922837-G-GTGTGTATATA 21×TA***
26460027-C-T 24313880-C-T P1_Y1 ***
26368406-A-G 24222259-A-G P1_Y1 ***
22195277-C-A 20033391-C-A ***
22500360-A-T 20338474-A-T DYZ19 ***
13455806-T-C 11300130-T-C ***
13455809-C-A 11300133-C-A ***
13455811-T-A 11300135-T-A ***
13458776-C-A 11303100-C-A ***
22518033-A-T 20356147-A-T ***
22500420-C-A 20338534-C-A DYZ19 ***
22495969-C-G 20334083-C-G DYZ19 ***
13446809-TCCATTCC-T 11291133-TCCATTCC-T ***
22450779-T-C 20288893-T-C DYZ19 ***
22364860-C-A 20202974-C-A DYZ19 ***
13482368-T-C 11326692-T-C ***
22364844-C-G 20202958-C-G DYZ19 ***
22364762-T-G 20202876-T-G DYZ19 ***
22364743-G-T 20202857-G-T DYZ19 ***
22518060-A-T 20356174-A-T ***
13446752-C-A 11291076-C-A ***
22358631-T-G 20196745-T-G DYZ19 ***
23181091-G-T 21019205-G-T ***
24143103-T-C 21996956-T-C P3_b1 ***
24077226-A-G 21931079-A-G P3_b1 ***
24051027-C-T 21904880-C-T P3_b1 ***
24009119-G-T 21862972-G-T ***
23318249-G-T 21156363-G-T ***
23285907-C-A 21124021-C-A ***
23086818-T-C 20924932-T-C ***
22543310-T-G 20381424-T-G ***
23014193-G-T 20852307-G-T ***
22955403-C-A 20793517-C-A ***
13228382-A-G 11072706-A-G ***
22780935-C-T 20619049-C-T ***
22637740-A-T 20475854-A-T ***
22543612-G-T 20381726-G-T ***
11649553-G-A ***
22357884-C-T 20195998-C-T DYZ19 ***
24185960-C-T 22039813-C-T P3_b1 ***
22248456-A-T 20086570-A-T DYZ19 ***
22292007-G-A 20130121-G-A DYZ19 ***
22282162-T-A 20120276-T-A DYZ19 ***
22258178-C-T 20096292-C-T DYZ19 ***
22249099-T-C 20087213-T-C DYZ19 ***
22248470-C-A 20086584-C-A DYZ19 ***
14379497-C-A 12258793-C-A ***
22247798-C-T 20085912-C-T DYZ19 ***
22308204-C-G 20146318-C-G DYZ19 ***
22236959-C-A 20075073-C-A DYZ19 ***
22236645-A-T 20074759-A-T DYZ19 ***
22236575-G-A 20074689-G-A DYZ19 ***
10008571-A-T 10170962-A-T ***
22236408-A-C 20074522-A-C DYZ19 ***
14521486-T-A 12409687-T-A ***
22292018-T-A 20130132-T-A DYZ19 ***
22322863-T-C 20160977-T-C DYZ19 ***
22357863-G-A 20195977-G-A DYZ19 ***
22351542-C-A 20189656-C-A DYZ19 ***
13857872-A-T 11737166-A-T ***
22357799-G-T 20195913-G-T DYZ19 ***
22357655-A-G 20195769-A-G DYZ19 ***
22356806-A-C 20194920-A-C DYZ19 ***
22356787-C-T 20194901-C-T DYZ19 ***
22352837-C-G 20190951-C-G DYZ19 ***
22349361-A-C 20187475-A-C DYZ19 ***
22323002-C-A 20161116-C-A DYZ19 ***
22341537-T-A 20179651-T-A DYZ19 ***
22341535-A-T 20179649-A-T DYZ19 ***
14000688-C-A 11879982-C-A ***
22330346-T-C 20168460-T-C DYZ19 ***
22324529-C-A 20162643-C-A DYZ19 ***
22323067-A-T 20161181-A-T DYZ19 ***
24185906-G-T 22039759-G-T P3_b1 ***
24186160-G-T 22040013-G-T P3_b1 ***
26352796-G-A 24206649-G-A P1_Y1 ***
8389762-A-G 8521721-A-G ***
25505171-A-T 23359024-A-T P1_gr1 ***
8182844-G-A 8314803-G-A ***
8230804-C-A 8362763-C-A ***
8254932-C-A 8386891-C-A ***
8292651-C-A 8424610-C-A ***
25505171-A-G 23359024-A-G P1_gr1 ***
8392002-C-A 8523961-C-A ***
25566783-C-A 23420636-C-A P1_gr1 ***
25456341-C-A 23310194-C-A P2_r2 ***
25453181-C-T 23307034-C-T P2_r2 ***
25323407-A-T 23177260-A-T P2_r1 ***
25323401-C-A 23177254-C-A P2_r1 ***
25323337-C-A 23177190-C-A P2_r1 ***
25323310-T-A 23177163-T-A P2_r1 ***
25526049-T-G 23379902-T-G P1_gr1 ***
25589749-T-A 23443602-T-A P1_gr1 ***
8841079-T-C 8973038-T-C ***
26120183-T-A 23974036-T-A P1_Y1 ***
26314390-G-T 24168243-G-T P1_Y1 ***
7355053-G-A 7487012-G-A ***
26291362-C-T 24145215-C-T P1_Y1 ***
7426754-C-A 7558713-C-A ***
26274254-C-T 24128107-C-T P1_Y1 ***
26134067-C-T 23987920-C-T P1_Y1 ***
26108158-G-A 23962011-G-A P1_Y1 ***
25606997-T-C 23460850-T-C P1_gr1 ***
26078691-T-C 23932544-T-C P1_Y1 ***
25929232-C-T 23783085-C-T P1_Y1 17×T***
25845197-C-A 23699050-C-A P1_b3 ***
25729258-G-T 23583111-G-T P1_b3 ***
25625276-G-T 23479129-G-T P1_b3 ***
25607005-T-C 23460858-T-C P1_gr1 ***
25323308-C-A 23177161-C-A P2_r1 ***
25323303-A-T 23177156-A-T P2_r1 ***
24186380-G-T 22040233-G-T P3_b1 ***
10668386-A-G ***
24862096-C-A 22715949-C-A P3_b2 ***
24764608-G-A 22618461-G-A P3_b2 ***
24759905-G-T 22613758-G-T P3_b2 ***
9966690-CA-C 10129081-CA-C ***
24667167-A-G 22521020-A-G P3_b2 ***
24595260-C-T 22449113-C-T P3_t2 ***
24574743-G-T 22428596-G-T P3_t2 ***
24942177-T-G 22796030-T-G g1 ***
24313285-A-C 22167138-A-C P3_t1 ***
24278512-G-C 22132365-G-C P3_b1 ***
24235688-T-A 22089541-T-A P3_b1 ***
24235566-C-A 22089419-C-A P3_b1 ***
10789312-G-A ***
24226278-T-G 22080131-T-G P3_b1 ***
24862144-T-G 22715997-T-G P3_b2 ***
24990963-T-G 22844816-T-G g1 ***
25281852-G-A 23135705-G-A P2_r1 ***
25207328-C-A 23061181-C-A g1 ***
25268561-T-C 23122414-T-C P2_r1 ***
25207714-T-A 23061567-T-A P2_r1 ***
25207701-T-G 23061554-T-G P2_r1 ***
25207478-C-A 23061331-C-A P2_r1 ***
25207356-C-A 23061209-C-A g1 ***
25207341-T-A 23061194-T-A g1 ***
25207296-C-A 23061149-C-A g1 ***
25046510-A-T 22900363-A-T g1 ***
25180814-T-C 23034667-T-C g1 ***
25162796-G-A 23016649-G-A g1 ***
9457119-C-A 9619510-C-A ***
25101474-T-C 22955327-T-C g1 ***
25097258-C-A 22951111-C-A g1 ***
25056222-C-A 22910075-C-A g1 ***
22498089-A-T 20336203-A-T DYZ19 ***

In the table above, the meaning of the confidence field depends on whether the data comes from an FTDNA kit or an FGC kit. For FTDNA kits, + implies a "PASS" result with just one possible variant, * indicates a "PASS" but with multiple variants, ** indicates "REJECTED" with just a single variant, and *** indicates "REJECTED" with multiple possible variants. 'A*' are heterozygous variants not called by FTDNA, but still pulled from the VCF file. For FGC kits, + indicates over 99% likely genuine (95% for INDELs); * over 95% likely genuine (90% for INDELs); ** about 40% likely genuine; *** about 10% likely genuine. Manual entries read directly from a BAM file will be either + indicating positive, or * indicating that the data show a mixture of possible variants.

For the FTDNA kits, the BED data is encoded in the background color of the cells. Those cells with a white background have coverage, those with a grey background indicate no coverage in the BED file, and those with a pink background indicate the mutation is on the edge of a coverage region. These pink regions often indicate that the individual may be positive for a SNP even if there is no corresponding entry in the vcf file.

The combBED column indicates whether or not the mutation is a SNP and falls in the combBED region defined in Defining a New Rate Constant for Y-Chromosome SNPs based on Full Sequencing Data by Dmitry Adamov, Vladimir Guryanov, Sergey Karzhavin, Vladimir Tagankin, Vadim Urasin.

The McDonald BED column indicates whether or not the mutation is a SNP and falls in the BED region used by Dr. Iain McDonald in the age analysis he does for R-U106 men.

ERROR: There was an error querying the server about the notes for this person.



Big Tree Main Page