Tree Position

R-P312/S116 > Z290 > L21/S145 > DF13 > Z39589 > L1335/S530 > L1065 > Z16325 > S744 > S764 > S756 > Z16328 > FGC32449 > ~22261318-T-G > A30 > A35 > BY155

Unique Mutations

The mutations unique to this man are summarized in the table below. Those with a '+' or '*' confidence level are considered by FamilyTreeDNA or FullGenomesCorp to be high quality SNPs/INDELs. For completeness, all other mutations of lesser confidence are included as well. These additional mutations may be useful for distinguishing between very closely related men.

Occasionally, some of the mutations listed here will be thought to be shared with other men in which case they might appear in upstream blocks on the tree. When this happens, the 'Blocks' field will indicate what block they appear in. Such a situation might arise with BigY men if the BED data suggests another man may be positive for a SNP, even though it doesn't appear in his VCF data. It might also happen if Chromo2 testing or Sanger sequencing of other men not on the tree show the SNP to be shared.

POS-REF-ALT (hg19) POS-REF-ALT (hg38) Blocks Names Region McDonald BED combBED STRFTDNA
B1955
BigY2
B1955
13687943-A-T 11532267-A-T A*
13687769-A-C 11532093-A-C A*
26162020-A-AT 24015873-A-AT P1_Y1 9×TA*
28817597-A-T 26671450-A-T A*
19685856-A-AT 17573976-A-AT P5_Prx 9×TA*
6191320-C-A 6323279-C-A IR3_Dst A*
13458686-C-G 11303010-C-G A*
26243398-C-G 24097251-C-G P1_Y1 A*
28587793-T-A 26441646-T-A A*
19187385-ATT-A,AT 17075505-ATT-A,AT 28×T*
13936205-G-GAAGAAAGAAAGAAAGAAAGA 11815499-G-GAAGAAAGAAAGAAAGAAAGA 14×AAGA****
11020973-T-C **
13199293-A-G 11043617-A-G **
13196695-C-T 11041019-C-T **
10964590-TCC-T **
13196691-C-A 11041015-C-A **
13196685-G-C 11041009-G-C **
11038271-C-A **
10971699-C-T **
10978716-A-C **
11009090-A-G **
11009081-C-CTACTT **
11009048-C-A **
10971698-T-A **
11009045-A-T **
11009023-CCACTA-C **
11006618-G-T **
10991985-G-T **
10988757-C-CT **
10983337-A-T **
11018438-C-T **
5434049-T-A 5566008-T-A **
13205313-G-C 11049637-G-C **
13587642-GT-G 11431966-GT-G **
11657516-C-T **
11657511-A-T **
11654035-C-T **
11654034-A-G **
11648362-C-G **
11646522-G-T **
13588227-T-TA 11432551-T-TA **
13587650-T-C 11431974-T-C **
13587646-A-AG 11431970-A-AG **
13587634-A-G 11431958-A-G **
13218720-C-T 11063044-C-T **
13476375-T-C 11320699-T-C **
13441547-G-A 11285871-G-A **
13429739-T-G 11274063-T-G **
13248622-G-T 11092946-G-T **
13224761-C-T 11069085-C-T **
13223430-GA-G 11067754-GA-G **
13223408-GGA-G 11067732-GGA-G **
13219948-C-A 11064272-C-A **
13219941-A-G 11064265-A-G **
10963318-T-C **
10964582-C-T **
10951256-T-A **
10963303-CAACCT-C **
10828193-A-ATTTGG **
10881898-T-C **
10876099-T-C **
10876083-GTCAATTCCTC-G **
10874160-C-G **
10873355-C-T **
10859613-T-C **
10843183-C-T **
10841837-C-A **
10840493-A-G **
10829063-C-A **
10828190-AG-A **
10881986-A-G **
10828187-C-CA **
10825151-A-G **
10814876-C-T **
10814873-C-G **
10814862-TTCACC-T **
10814858-C-A **
10814846-C-T **
10801547-C-A **
10793195-C-A **
10791771-C-T **
10881983-T-A **
10883533-A-T **
10963300-G-C **
10936062-C-A **
10955085-C-A **
11669720-G-T **
10950460-A-G **
10947619-T-C **
10941190-C-A **
10941188-C-G **
10941174-T-TCCACA **
10941173-T-C **
10936075-T-G **
10936070-T-C **
10936051-T-C **
10883536-C-T **
10934726-C-G **
10931492-T-TTCATC **
10931486-G-C **
10926186-CACT-C **
10926180-C-A **
10911309-C-T **
10903734-A-C **
10894078-C-T **
10892060-C-T **
10888371-G-A **
11657865-T-C **
11673041-A-C **
11670672-G-A **
14511227-T-C 12399432-T-C **
14539392-G-A 12427593-G-A **
14519556-C-A 12407757-C-A **
14515146-G-T 12403351-G-T **
14514151-A-G 12402356-A-G **
14514141-A-G 12402346-A-G **
14514133-A-T 12402338-A-T **
14514131-T-A 12402336-T-A **
14513208-A-G 12401413-A-G **
14511333-A-G 12399538-A-G **
14511228-G-A 12399433-G-A **
14511221-G-T 12399426-G-T **
14539401-T-C 12427602-T-C **
14511211-T-G 12399416-T-G **
14511202-A-G 12399407-A-G **
14511201-C-T 12399406-C-T **
14501080-T-C 12389285-T-C **
14501070-C-CT 12389275-C-CT **
12378113-G-T **
14483792-C-A 12363061-C-A **
14480163-C-CT 12359432-C-CT **
14457592-T-C 12336865-T-C **
14427058-AT-A 12306333-AT-A **
14539393-T-G 12427594-T-G **
14539402-G-A 12427603-G-A **
14369795-C-A 12249091-C-A **
14730174-C-T 12618242-C-T **
14884592-A-G 12772658-A-G **
14810996-C-A 12699067-C-A **
14789362-G-A 12677433-G-A **
14786464-G-C 12674534-G-C **
14785618-C-G 12673688-C-G **
14769349-C-T 12657418-C-T **
14765299-G-A 12653368-G-A **
14765291-A-G 12653360-A-G **
14761440-T-G 12649509-T-G **
14730175-A-G 12618243-A-G **
14696912-A-G 12584978-A-G **
14539404-T-C 12427605-T-C **
14689200-C-A 12577266-C-A **
14672245-A-G 12560311-A-G **
14669942-G-T 12558008-G-T **
14639181-T-C 12527250-T-C **
14633490-A-C 12521559-A-C **
14556577-T-A 12444778-T-A **
14553340-C-A 12441541-C-A **
14551449-GATA-G 12439650-GATA-G **
14551447-C-T 12439648-C-T **
14539408-A-G 12427609-A-G **
14405836-G-C 12285133-G-C **
14361958-C-A 12241253-C-A **
11672856-T-A **
13993275-C-A 11872569-C-A **
14081460-A-G 11960754-A-G **
14076691-G-T 11955985-G-T **
14073402-C-A 11952696-C-A **
14071643-T-C 11950937-T-C **
14071461-C-A 11950755-C-A **
14035162-T-A 11914456-T-A **
14033967-T-C 11913261-T-C **
14025382-C-A 11904676-C-A **
14022783-C-T 11902077-C-T **
14006627-C-A 11885921-C-A **
13937889-A-C 11817183-A-C **
14099723-G-T 11979017-G-T **
13937873-T-C 11817167-T-C **
13918696-AT-A 11797990-AT-A **
13891839-C-G 11771133-C-G **
13891837-C-T 11771131-C-T **
13891831-G-T 11771125-G-T **
13891828-T-C 11771122-T-C **
13866197-C-A 11745491-C-A **
13857000-C-A 11736294-C-A **
13801483-C-G 11680777-C-G **
10785159-ACTCCACACCAC-A **
14086554-G-T 11965848-G-T **
14118362-A-C 11997656-A-C **
14356516-A-G 12235811-A-G **
14183319-A-T 12062613-A-T **
14339205-A-C 12218500-A-C **
14325111-C-A 12204405-C-A **
14285718-C-A 12165012-C-A **
14216241-T-C 12095535-T-C **
14183369-G-A 12062663-G-A **
14183367-A-G 12062661-A-G **
14183362-T-A 12062656-T-A **
14183359-C-T 12062653-C-T **
14183353-A-T 12062647-A-T **
14183350-T-C 12062644-T-C **
14183308-A-G 12062602-A-G **
14118367-C-G 11997661-C-G **
14183304-A-G 12062598-A-G **
14183270-T-G 12062564-T-G **
14183263-A-C 12062557-A-C **
14176426-C-A 12055720-C-A **
14175134-C-A 12054428-C-A **
14161837-C-A 12041131-C-A **
14161836-C-G 12041130-C-G **
14161757-G-T 12041051-G-T **
14120914-T-C 12000208-T-C **
14118380-C-T 11997674-C-T **
10785173-C-CA **
10778826-T-C **
10778909-A-G **
6903703-G-A 7035662-G-A **
7048050-T-C 7180009-T-C **
7033328-C-T 7165287-C-T **
7033323-T-C 7165282-T-C **
7033312-C-G 7165271-C-G **
7028072-G-T 7160031-G-T **
6971793-G-T 7103752-G-T B350 **
6957849-C-A 7089808-C-A **
6954718-C-A 7086677-C-A **
6934579-G-TA 7066538-G-TA **
6934557-A-G 7066516-A-G **
6903702-C-A 7035661-C-A **
7099750-C-A 7231709-C-A **
6903681-C-G 7035640-C-G **
6903672-G-GATGA 7035631-G-GATGA **
6892633-G-GT 7024592-G-GT **
6892604-G-A 7024563-G-A **
6868870-A-G 7000829-A-G **
6816546-GAAAAAAA-G 6948505-GAAAAAAA-G 22×A**
6793593-G-T 6925552-G-T **
6793585-A-G 6925544-A-G **
6793584-C-T 6925543-C-T **
6765594-A-T 6897553-A-T **
7084345-C-T 7216304-C-T **
7106432-G-CA 7238391-G-CA **
6730612-G-T 6862571-G-T **
7309770-T-C 7441729-T-C **
7670436-C-A 7802395-C-A **
7659761-G-T 7791720-G-T **
7621110-C-T 7753069-C-T **
7588859-C-A 7720818-C-A **
7504618-C-A 7636577-C-A IR1_L **
7420401-C-T 7552360-C-T **
7415050-T-A 7547009-T-A **
7390177-A-G 7522136-A-G **
7332698-G-T 7464657-G-T **
7318687-C-A 7450646-C-A **
7263769-A-G 7395728-A-G **
7131330-C-A 7263289-C-A **
7263761-A-T 7395720-A-T **
7263734-AG-A 7395693-AG-A **
7228450-T-G 7360409-T-G **
7217204-A-G 7349163-A-G **
7182901-G-A 7314860-G-A **
7159350-A-G 7291309-A-G **
7138996-T-C 7270955-T-C **
7138993-T-A 7270952-T-A **
7138984-C-T 7270943-C-T **
7138843-A-C 7270802-A-C **
6730619-G-T 6862578-G-T **
6700800-C-T 6832759-C-T Y82342 **
7886426-A-G 8018385-A-G **
4752392-G-T 4884351-G-T **
5292906-T-C 5424865-T-C **
5261789-A-C 5393748-A-C **
5230912-G-T 5362871-G-T **
5199774-C-T 5331733-C-T **
5127741-C-A 5259700-C-A **
5125668-A-G 5257627-A-G **
5004775-A-C 5136734-A-C **
4936641-C-T 5068600-C-T **
4926245-A-G 5058204-A-G **
4881239-C-A 5013198-C-A **
4733834-TTG-T 4865793-TTG-T **
5292923-A-G 5424882-A-G **
4700048-T-G 4832007-T-G **
4629578-G-T 4761537-G-T **
4547672-G-T 4679631-G-T **
4539417-C-A 4671376-C-A **
4421797-G-T 4553756-G-T **
4398611-C-A 4530570-C-A **
4392280-GACAAA-G 4524239-GACAAA-G **
4329160-T-C 4461119-T-C **
4325584-T-C 4457543-T-C **
4323431-G-T 4455390-G-T **
5292909-G-T 5424868-G-T **
5292929-T-G 5424888-T-G **
6700760-C-A 6832719-C-A **
6177585-T-C 6309544-T-C IR3_Dst **
6645948-C-A 6777907-C-A **
6621513-T-C 6753472-T-C **
6621493-T-G 6753452-T-G **
6502703-C-A 6634662-C-A **
6419082-G-A 6551041-G-A **
6401383-C-A 6533342-C-A **
6355626-G-A 6487585-G-A **
6329174-T-C 6461133-T-C IR3_Dst **
6273854-A-ACC 6405813-A-ACC IR3_Dst **
6250489-T-C 6382448-T-C IR3_Dst **
6155252-G-A 6287211-G-A IR3_Dst **
5292934-T-C 5424893-T-C **
6070296-A-G 6202255-A-G **
6051899-G-T 6183858-G-T **
6023992-G-T 6155951-G-T **
5951526-C-A 6083485-C-A **
5800341-T-C 5932300-T-C **
5736638-A-T 5868597-A-T **
5630970-T-A 5762929-T-A **
5454775-A-T 5586734-A-T **
5328359-A-T 5460318-A-T **
5318435-C-A 5450394-C-A **
7871448-C-G 8003407-C-G **
7964450-G-A 8096409-G-A **
10778842-T-TC **
9764143-A-C 9926534-A-C **
10024966-C-G 10187357-C-G **
10022229-C-T 10184620-C-T **
9964204-C-A 10126595-C-A **
9961345-C-T 10123736-C-T **
9945194-G-T 10107585-G-T **
9929351-A-T 10091742-A-T **
9929329-G-T 10091720-G-T FGC62095 **
9907646-G-T 10070037-G-T **
9892465-C-A 10054856-C-A **
9776197-C-T 9938588-C-T **
9764139-A-G 9926530-A-G **
10050044-C-A 10212435-C-A **
9709029-A-G 9871420-A-G IR3_Prx **
9457167-C-A 9619558-C-A **
9456620-C-T 9619011-C-T **
9456619-G-C 9619010-G-C **
9456618-G-C 9619009-G-C **
9456611-G-A 9619002-G-A **
9456598-A-T 9618989-A-T **
9451612-A-C 9614003-A-C **
9451595-AT-A 9613986-AT-A **
9451571-C-T 9613962-C-T **
10033634-G-T 10196025-G-T **
10657791-G-T **
9451538-A-G 9613929-A-G **
10767598-TGGTAC-T **
14884596-G-A 12772662-G-A **
10778825-A-T **
10778823-G-A **
10768346-T-C **
10768339-A-T **
10768338-T-G **
10768335-C-A **
10768332-T-A **
10768325-T-C **
10767608-C-T **
10767394-T-C **
10667429-C-A **
10761035-T-TTTCAATCCATTCCACTCCAC **
10756955-C-CATGCCATTCTACTCGGGTTG **
10693830-T-A **
10692568-G-A **
10692566-T-C **
10692557-C-T **
10692553-T-C **
10692552-C-T **
10692542-C-T **
10692506-C-T **
9451541-G-A 9613932-G-A **
9451532-T-C 9613923-T-C **
7984406-T-C 8116365-T-C **
8056253-T-C 8188212-T-C **
8253743-A-G 8385702-A-G **
8253742-C-T 8385701-C-T **
8250883-C-A 8382842-C-A **
8237383-T-C 8369342-T-C **
8093391-C-A 8225350-C-A **
8092134-G-C 8224093-G-C **
8075371-G-A 8207330-G-A **
8075368-T-A 8207327-T-A **
8075360-T-C 8207319-T-C **
8058580-A-G 8190539-A-G **
8056252-A-G 8188211-A-G **
8345909-A-G 8477868-A-G **
8056209-G-A 8188168-G-A **
8046413-A-T 8178372-A-T **
8044719-A-G 8176678-A-G **
8043321-A-G 8175280-A-G **
8043312-T-C 8175271-T-C **
8017016-G-A 8148975-G-A **
8008895-G-C 8140854-G-C **
7996723-C-A 8128682-C-A **
7984439-G-A 8116398-G-A **
7984412-G-T 8116371-G-T **
8345892-C-G 8477851-C-G **
8345912-A-G 8477871-A-G **
9451530-G-A 9613921-G-A **
9125620-G-A **
9451529-T-C 9613920-T-C **
9442148-G-A 9604539-G-A **
9442143-G-A 9604534-G-A **
9442142-T-C 9604533-T-C **
9401195-C-A 9563586-C-A **
9385041-G-A 9547432-G-A **
9074118-C-CT 9236509-C-CT **
9052109-A-G 9214500-A-G **
9030230-G-A 9192621-G-A **
9125622-G-A **
9111575-T-C **
8434650-T-G 8566609-T-G **
8849900-T-C 8981859-T-C **
8816471-C-A 8948430-C-A **
8816374-A-G 8948333-A-G **
8790288-T-C 8922247-T-C **
8776665-C-A 8908624-C-A **
8760583-A-C 8892542-A-C **
8760561-G-A 8892520-G-A **
8720690-C-A 8852649-C-A **
8704289-G-T 8836248-G-T **
8704245-C-T 8836204-C-T **
8456581-C-A 8588540-C-A **
14884594-G-A 12772660-G-A **
14927337-A-G 12815402-A-G **
14908262-G-A 12796329-G-A Y67428 **
21563085-T-C 19401199-T-C **
22023272-C-A 19861386-C-A **
21974984-C-T 19813098-C-T **
21974935-G-T 19813049-G-T **
21944933-C-A 19783047-C-A **
21931063-C-A 19769177-C-A **
21880861-CCCGGCTAAA-G 19718975-CCCGGCTAAA-G **
21708226-C-T 19546340-C-T **
21616045-C-A 19454159-C-A **
21583999-C-A 19422113-C-A **
21563134-T-C 19401248-T-C **
21554304-G-A 19392418-G-A **
22146580-T-A 19984694-T-A **
21554264-C-A 19392378-C-A **
21549292-T-G 19387406-T-G **
21410163-T-C 19248277-T-C **
21410157-T-C 19248271-T-C **
21410142-G-A 19248256-G-A **
21371538-G-C 19209652-G-C **
21321568-G-A 19159682-G-A **
21275738-T-A 19113852-T-A **
21248842-G-T 19086956-G-T **
21248102-G-T 19086216-G-T **
22124456-G-A 19962570-G-A **
22147465-G-C 19985579-G-C **
21209040-T-A 19047154-T-A **
22317922-G-A 20156036-G-A DYZ19 **
22587771-A-G 20425885-A-G **
22547261-G-T 20385375-G-T **
22542684-C-G 20380798-C-G **
22435653-A-G 20273767-A-G DYZ19 **
22435649-T-A 20273763-T-A DYZ19 **
22429612-G-T 20267726-G-T DYZ19 **
22429590-C-A 20267704-C-A DYZ19 **
22335179-G-T 20173293-G-T DYZ19 **
22317947-G-A 20156061-G-A DYZ19 **
22317939-G-T 20156053-G-T DYZ19 **
22316226-G-C 20154340-G-C DYZ19 **
22164348-C-T 20002462-C-T **
22316219-G-T 20154333-G-T DYZ19 **
22316211-C-T 20154325-C-T DYZ19 **
22268184-G-A 20106298-G-A DYZ19 **
22268166-T-G 20106280-T-G DYZ19 **
22268160-C-A 20106274-C-A DYZ19 **
22177592-T-C 20015706-T-C **
22176271-G-A 20014385-G-A **
22165094-C-T 20003208-C-T **
22164374-T-C 20002488-T-C **
22164368-T-C 20002482-T-C **
21235034-C-A 19073148-C-A **
21182525-C-T 19020639-C-T **
22614766-C-A 20452880-C-A **
19558838-CA-C 17446958-CA-C **
19746897-GT-G 17635017-GT-G P5_Prx **
19746891-G-GTTT 17635011-G-GTTT P5_Prx **
19746887-G-GT 17635007-G-GT P5_Prx **
19746881-A-G 17635001-A-G P5_Prx **
19619273-G-T 17507393-G-T P5_Prx **
19619202-C-A 17507322-C-A P5_Prx **
19558869-T-C 17446989-T-C **
19558851-A-G 17446971-A-G **
19558850-C-T 17446970-C-T **
19558846-T-G 17446966-T-G **
19558832-C-T 17446952-C-T **
20229570-A-ATG 18067684-A-ATG P5_Dst **
19558827-T-TAG 17446947-T-TAG **
19558820-TCC-T 17446940-TCC-T **
19542368-A-T 17430488-A-T **
19542343-G-A 17430463-G-A **
19542342-T-C 17430462-T-C **
19542332-A-G 17430452-A-G **
19542323-G-A 17430443-G-A **
19542308-T-G 17430428-T-G **
19542301-G-GTATCC 17430421-G-GTATCC **
19542299-T-TCCAGGAA 17430419-T-TCCAGGAA **
20229561-CA-C 18067675-CA-C P5_Dst **
20306027-G-T 18144141-G-T P5_Dst **
21182524-C-T 19020638-C-T **
21054303-G-T 18892417-G-T **
21182512-T-C 19020626-T-C **
21182507-T-C 19020621-T-C **
21156941-T-C 18995055-T-C **
21156938-T-C 18995052-T-C **
21147867-C-A 18985981-C-A **
21137816-T-G 18975930-T-G **
21115903-A-C 18954017-A-C **
21111990-A-T 18950104-A-T **
21068505-C-A 18906619-C-A Y105342 **
21054308-A-G 18892422-A-G **
21054302-T-C 18892416-T-C **
20337571-CT-C 18175685-CT-C P5_Dst 7×TTTA**
21054273-A-G 18892387-A-G **
21054256-G-A 18892370-G-A **
20957691-T-TC 18795805-T-TC P4_Dst **
20948669-CTGTTTGTTTG-C 18786783-CTGTTTGTTTG-C P4_Dst 7×TGTT**
20902303-G-GAAA 18740417-G-GAAA P4_Dst 14×A**
20815807-C-A 18653921-C-A P4_Gap **
20649924-T-C 18488038-T-C P4_Prx **
20649916-T-TC 18488030-T-TC P4_Prx **
20649910-T-TCC 18488024-T-TCC P4_Prx **
20350317-A-C 18188431-A-C P5_Dst **
22587797-T-C 20425911-T-C **
22649470-G-A 20487584-G-A **
19539623-A-T 17427743-A-T **
24295866-T-TA 22149719-T-TA P3_t1 **
27762806-C-T 25616659-C-T P1_Y2 **
27499309-TC-T 25353162-TC-T P1_Y2 **
26122093-C-A 23975946-C-A P1_Y1 **
26120228-T-C 23974081-T-C P1_Y1 **
26089937-G-T 23943790-G-T P1_Y1 **
24871272-C-A 22725125-C-A P3_b2 **
24508442-C-T 22362295-C-T **
24508439-C-T 22362292-C-T **
24403588-T-C 22257441-T-C **
24296338-T-C 22150191-T-C P3_t1 **
24164152-C-A 22018005-C-A P3_b1 **
27873325-T-C 25727178-T-C P1_Y2 **
24003107-G-T 21856960-G-T **
21754419-C-T **
23876058-C-A 21714172-C-A **
23819112-C-A 21657226-C-A **
23807110-C-G 21645224-C-G **
23802291-G-T 21640405-G-T **
23777766-T-A 21615880-T-A **
23777763-G-A 21615877-G-A **
23777749-A-T 21615863-A-T **
23777745-T-C 21615859-T-C **
27762814-T-TACATAC 25616667-T-TACATAC P1_Y2 **
27966837-T-TTTG 25820690-T-TTTG P1_Y2 **
23504955-A-C 21343069-A-C **
28706318-T-A 26560171-T-A **
56861033-G-T **
56846470-T-C **
56837803-AC-A **
56698470-A-C **
28800742-G-A 26654595-G-A **
28800731-A-G 26654584-A-G **
28762692-T-G 26616545-T-G **
28762676-T-G 26616529-T-G **
28755153-A-G 26609006-A-G **
28755141-A-AGATG 26608994-A-AGATG **
28703513-G-A 26557366-G-A **
28043513-A-AG 25897366-A-AG P1_Y2 **
28611710-T-C 26465563-T-C **
28610391-C-T 26464244-C-T **
28610370-C-T 26464223-C-T **
28610361-C-T 26464214-C-T **
28610354-T-G 26464207-T-G **
28606032-A-G 26459885-A-G **
28600518-C-T 26454371-C-T **
28530905-C-T 26384758-C-T **
28486862-T-A 26340715-T-A **
28076494-CT-C 25930347-CT-C P1_Y2 **
23610989-C-A 21449103-C-A **
23504944-G-A 21343058-G-A **
22649481-C-T 20487595-C-T **
22954557-T-C 20792671-T-C **
23026737-A-T 20864851-A-T **
23019052-GT-G 20857166-GT-G **
22988899-C-T 20827013-C-T **
22988897-C-AA 20827011-C-AA **
22988886-A-G 20827000-A-G **
22988885-C-T 20826999-C-T **
22985673-C-A 20823787-C-A **
22979444-A-G 20817558-A-G **
22962069-G-A 20800183-G-A **
22962064-C-A 20800178-C-A **
22937523-T-A 20775637-T-A **
23034381-C-G 20872495-C-G **
22868913-T-G 20707027-T-G **
22855732-C-A 20693846-C-A **
22854749-G-A 20692863-G-A **
22837776-G-T 20675890-G-T **
22790257-A-G 20628371-A-G **
22788693-T-C 20626807-T-C **
22788648-G-A 20626762-G-A **
22739499-G-A 20577613-G-A **
22653266-C-T 20491380-C-T **
22649493-C-T 20487607-C-T **
23029894-G-T 20868008-G-T **
23045377-AG-A 20883491-AG-A **
23504941-C-T 21343055-C-T **
23373500-C-T 21211614-C-T **
23504935-G-A 21343049-G-A **
23504934-T-C 21343048-T-C **
23504931-T-G 21343045-T-G **
23472306-G-T 21310420-G-T **
23373540-G-A 21211654-G-A **
23373526-G-T 21211640-G-T **
23373525-A-G 21211639-A-G **
23373511-A-C 21211625-A-C **
23373508-A-G 21211622-A-G **
23373503-T-C 21211617-T-C **
23373493-A-G 21211607-A-G **
23045381-A-G 20883495-A-G **
23373492-C-T 21211606-C-T **
23363987-C-T 21202101-C-T **
23360623-C-T 21198737-C-T **
23306075-T-C 21144189-T-C **
23289975-C-A 21128089-C-A **
23260722-C-A 21098836-C-A **
23198749-G-T 21036863-G-T **
23187596-C-A 21025710-C-A **
23087149-G-T 20925263-G-T **
23081990-T-C 20920104-T-C **
19542275-T-A 17430395-T-A **
19522524-A-G 17410644-A-G **
14908293-C-G 12796360-C-G **
16196111-C-A 14084231-C-A **
16344939-C-A 14233059-C-A **
16324062-G-A 14212182-G-A **
16324058-T-A 14212178-T-A **
16321631-G-T 14209751-G-T **
16305903-C-T 14194023-C-T **
16305900-G-A 14194020-G-A **
16305887-T-A 14194007-T-A **
16290919-T-G 14179039-T-G **
16284068-C-A 14172188-C-A **
16271023-A-G 14159143-A-G **
16184092-C-A 14072212-C-A **
16423131-T-C 14311251-T-C **
16177048-T-G 14065168-T-G **
16175259-T-C 14063379-T-C **
16175255-T-A 14063375-T-A **
16175254-T-A 14063374-T-A **
16175251-G-C 14063371-G-C **
16160749-G-C 14048869-G-C P8_Dst **
16135970-G-T 14024090-G-T P8_Dst **
16055075-A-T 13943195-A-T **
16021635-T-C 13909755-T-C **
16021632-C-G 13909752-C-G **
16396430-G-T 14284550-G-T **
16426813-G-T 14314933-G-T **
16021610-T-A 13909730-T-A **
16676862-AT-A 14564982-AT-A **
16883218-A-G 14771338-A-G **
16754967-A-G 14643087-A-G **
16750037-G-A 14638157-G-A **
16750034-T-C 14638154-T-C **
16745311-G-A 14633431-G-A **
16745310-A-C 14633430-A-C **
16743080-G-A 14631200-G-A **
16689870-C-A 14577990-C-A **
16689847-A-T 14577967-A-T **
16681403-C-A 14569523-C-A **
16676846-G-T 14564966-G-T **
16487185-T-C 14375305-T-C **
16656130-C-A 14544250-C-A **
16649707-G-T 14537827-G-T **
16624735-C-A 14512855-C-A **
16609557-AT-A 14497677-AT-A **
16593900-A-T 14482020-A-T **
16572724-G-A 14460844-G-A **
16572714-G-T 14460834-G-T **
16572699-A-G 14460819-A-G **
16489478-C-A 14377598-C-A **
16487893-G-C 14376013-G-C **
16021626-A-C 13909746-A-C **
16007323-C-A 13895443-C-A **
16896336-C-T 14784456-C-T **
15215512-C-T 13103598-C-T **
15433490-C-T 13321610-C-T **
15433489-A-G 13321609-A-G **
15433472-A-G 13321592-A-G **
15424444-A-C 13312564-A-C **
15402853-C-T 13290973-C-T **
27289-C-T **
15321313-T-A 13209431-T-A **
15260816-A-G 13148900-A-G **
15221820-A-T 13109906-A-T **
15215515-G-A 13103601-G-A **
15215506-C-G 13103592-C-G **
15445622-C-G 13333742-C-G **
15215472-G-T 13103558-G-T **
15215463-G-T 13103549-G-T **
15210788-T-C 13098874-T-C **
15193519-C-T 13081605-C-T **
15146635-A-G 13034722-A-G **
14986085-C-A 12874153-C-A **
14963820-G-T 12851895-G-T **
14933719-C-A 12821784-C-A **
4215647-T-C 4347606-T-C **
14916823-G-A 12804890-G-A Y23317 **
15445506-G-T 13333626-G-T **
15445628-T-C 13333748-T-C **
15986673-G-A 13874793-G-A **
15732837-G-T 13620957-G-T **
15986664-T-G 13874784-T-G **
15986429-A-G 13874549-A-G **
15941369-A-C 13829489-A-C **
15932500-C-A 13820620-C-A **
15844751-C-T 13732871-C-T **
15844740-T-C 13732860-T-C **
15844730-G-T 13732850-G-T **
15832239-G-TTT 13720359-G-TTT **
15769363-G-T 13657483-G-T **
15741404-G-T 13629524-G-T **
15730533-A-G 13618653-A-G **
15445633-T-C 13333753-T-C **
15696927-T-A 13585047-T-A **
15696885-A-T 13585005-A-T **
15696883-A-T 13585003-A-T **
15696879-C-T 13584999-C-T **
15696873-C-CCT 13584993-C-CCT **
15684594-C-A 13572714-C-A **
15683670-C-A 13571790-C-A **
15646791-C-T 13534911-C-T **
15570187-T-A 13458307-T-A **
15447125-C-A 13335245-C-A **
16896269-G-A 14784389-G-A **
16896341-C-T 14784461-C-T **
19505112-A-C 17393232-A-C **
18853318-C-A 16741438-C-A **
18930705-T-G 16818825-T-G **
18930704-A-T 16818824-A-T **
18930696-A-C 16818816-A-C **
18930695-A-G 16818815-A-G **
18930693-T-G 16818813-T-G **
18930688-A-G 16818808-A-G **
18928855-C-A 16816975-C-A **
18908082-ATGTGTGTGTG-A 16796202-ATGTGTGTGTG-A 14×TG**
18902966-G-T 16791086-G-T **
18880228-G-T 16768348-G-T **
18814755-C-T 16702875-C-T **
18987232-G-T 16875352-G-T **
18794966-T-G 16683086-T-G **
18794963-A-G 16683083-A-G **
18794960-A-C 16683080-A-C **
18794959-C-T 16683079-C-T **
18783939-T-C 16672059-T-C **
18653851-C-A 16541971-C-A **
18647546-A-G 16535666-A-G **
18602201-G-C 16490321-G-C **
18558108-C-A 16446228-C-A **
18549350-T-G 16437470-T-G **
18937358-A-G 16825478-A-G **
18997282-A-G 16885402-A-G **
18410393-G-T 16298513-G-T P6_Gap **
19290774-A-C 17178894-A-C **
19496339-A-G 17384459-A-G **
19496336-C-T 17384456-C-T **
19467077-C-A 17355197-C-A **
19414893-G-C 17303013-G-C **
19340424-T-C 17228544-T-C **
19318285-A-G 17206405-A-G **
19318283-A-G 17206403-A-G **
19318282-C-T 17206402-C-T **
19318260-G-A 17206380-G-A **
19310997-TCTC-T 17199117-TCTC-T **
19272059-A-C 17160179-A-C **
19023297-T-C 16911417-T-C **
19272047-G-A 17160167-G-A **
19268442-C-A 17156562-C-A **
19268381-T-G 17156501-T-G **
19200846-C-A 17088966-C-A **
19138657-G-T 17026777-G-T **
19075169-G-A 16963289-G-A **
19075167-T-C 16963287-T-C **
19070965-A-C 16959085-A-C **
19067120-C-A 16955240-C-A **
19055376-G-T 16943496-G-T **
18423945-C-A 16312065-C-A P6_Gap **
18385189-C-A 16273309-C-A P6_Gap **
17047957-C-T 14936077-C-T **
17439327-C-A 15327447-C-A **
17633161-T-A 15521281-T-A **
17633154-C-T 15521274-C-T **
17630957-C-G 15519077-C-G **
17544729-C-A 15432849-C-A **
17515416-C-A 15403536-C-A **
17515406-T-A 15403526-T-A **
17498853-T-A 15386973-T-A **
17492805-A-C 15380925-A-C **
17479906-C-A 15368026-C-A **
17478429-C-A 15366549-C-A **
17420926-T-C 15309046-T-C **
17633298-C-T 15521418-C-T **
17377941-C-A 15266061-C-A **
17285029-A-G 15173149-A-G **
17285028-C-T 15173148-C-T **
17277069-C-A 15165189-C-A **
17276421-A-G 15164541-A-G **
17276404-C-T 15164524-C-T **
17270665-T-C 15158785-T-C **
17115037-C-A 15003157-C-A **
17061531-TAA-T 14949651-TAA-T **
17055816-C-A 14943936-C-A **
17633164-T-C 15521284-T-C **
17641920-A-T 15530040-A-T **
18263287-A-T 16151407-A-T **
18102134-C-G 15990254-C-G **
18244486-C-A 16132606-C-A **
18196359-T-C 16084479-T-C **
18196052-C-T 16084172-C-T **
18196048-A-G 16084168-A-G **
18195184-G-TT 16083304-G-TT **
18190840-G-T 16078960-G-T **
18177198-T-C 16065318-T-C **
18136024-C-A 16024144-C-A **
18125498-G-A 16013618-G-A **
18102135-A-G 15990255-A-G **
18102128-AG-A 15990248-AG-A **
17673655-C-A 15561775-C-A **
18102123-A-C 15990243-A-C **
18100770-A-C 15988890-A-C **
18057297-AT-A 15945417-AT-A **
17806431-AT-A 15694551-AT-A **
17757670-G-A 15645790-G-A **
17737838-T-C 15625958-T-C **
17737837-G-A 15625957-G-A **
17737836-G-T 15625956-G-T **
17737828-G-A 15625948-G-A **
17715563-C-A 15603683-C-A **
17676451-C-A 15564571-C-A **
4287979-G-T 4419938-G-T **
15387880-T-A 13276000-T-A **
4069629-G-T 4201588-G-T **
13239636-A-G 11083960-A-G **
15215450-T-A 13103536-T-A **
15215452-T-C 13103538-T-C **
15215457-A-C 13103543-A-C **
6697212-C-A 6829171-C-A **
15986675-C-A 13874795-C-A **
15844733-G-A 13732853-G-A **
10934725-C-G **
10814855-T-A **
4983799-TG-T 5115758-TG-T **
10651645-G-T **
11005131-C-A **
11025378-A-AT **
6177568-A-C 6309527-A-C IR3_Dst **
11025385-C-T **
11021663-A-C **
10778821-C-T **
7106428-C-T 7238387-C-T **
27762810-C-T 25616663-C-T P1_Y2 **
15402839-C-T 13290959-C-T **
13487769-A-C 11332093-A-C **
14539420-A-C 12427621-A-C **
28778886-G-T 26632739-G-T **
7425206-C-A 7557165-C-A **
2747818-AAT-A 2879777-AAT-A **
14572958-C-A 12461158-C-A **
10934714-T-TG **
10937431-A-T **
22215285-A-G 20053399-A-G **
28809344-G-A 26663197-G-A **
28768636-C-A 26622489-C-A **
10767673-C-T **
14858946-C-T 12747012-C-T **
9438099-C-T 9600490-C-T 30×T**
15696895-T-G 13585015-T-G **
15696902-T-C 13585022-T-C **
2666602-T-G 2798561-T-G **
13233340-G-A 11077664-G-A **
28594251-A-G 26448104-A-G **
7252333-C-A 7384292-C-A **
5204578-C-A 5336537-C-A **
6944002-C-A 7075961-C-A **
28809349-T-A 26663202-T-A **
10937409-C-G **
10936077-T-C **
7615204-C-A 7747163-C-A **
16598974-T-C 14487094-T-C **
24475434-C-A 22329287-C-A **
21315178-T-C 19153292-T-C **
22023255-G-A 19861369-G-A **
26117878-A-T 23971731-A-T P1_Y1 **
10831632-T-C **
10938335-TCCACC-T **
9764161-T-G 9926552-T-G **
17300683-G-A 15188803-G-A **
13936467-C-A 11815761-C-A **
16583340-G-A 14471460-G-A Y70161 **
22215310-C-T 20053424-C-T **
10947638-A-AATCCT **
14183374-G-A 12062668-G-A **
18379870-T-TA 16267990-T-TA P6_Prx **
10963320-T-C **
15696911-A-G 13585031-A-G **
14183284-A-G 12062578-A-G Y90541 **
14183294-G-A 12062588-G-A **
14183296-T-A 12062590-T-A **
23056180-C-A 20894294-C-A **
17333985-T-C 15222105-T-C **
17334008-A-G 15222128-A-G **
21824913-C-A 19663027-C-A **
21880900-CA-C 19719014-CA-C **
14405839-C-T 12285136-C-T **
13493191-C-A 11337515-C-A **
14786629-T-C 12674699-T-C **
18183155-C-A 16071275-C-A **
6784638-C-A 6916597-C-A **
14785626-C-T 12673696-C-T **
10866507-C-A **
10765693-C-A **
14609786-C-G 12497988-C-G **
5494562-C-A 5626521-C-A **
11673211-C-A **
14458556-TC-T 12337829-TC-T **
9456617-G-A 9619008-G-A **
10951258-TTCA-T **
28782071-C-A 26635924-C-A **
14065707-A-G 11945001-A-G **
28483025-C-T 26336878-C-T **
7947046-A-T 8079005-A-T **
22594654-A-C 20432768-A-C **
16583341-C-T 14471461-C-T **
8704246-C-G 8836205-C-G **
10876105-C-G **
6697140-C-A 6829099-C-A **
10794533-G-T **
15909435-T-G 13797555-T-G **
10692569-C-T FT45459 **
11006668-C-T **
27980973-T-TC 25834826-T-TC P1_Y2 **
18976603-G-T 16864723-G-T **
13205311-C-T 11049635-C-T **
22962056-C-T 20800170-C-T **
3641498-C-A 3773457-C-A **
10868105-A-T **
10868108-C-G **
11037100-C-A **
16904654-A-T 14792774-A-T **
10951254-T-C **
13937412-C-A 11816706-C-A **
14183358-T-A 12062652-T-A **
11009041-T-C **
22164360-G-A 20002474-G-A **
20927095-T-TTG 18765209-T-TTG P4_Dst **
10971685-C-T **
10785140-G-T **
4172308-C-A 4304267-C-A **
14908279-A-T 12796346-A-T **
23742327-C-T 21580441-C-T **
20649914-T-C 18488028-T-C P4_Prx **
22268152-T-A 20106266-T-A DYZ19 **
8056265-G-A 8188224-G-A **
9891037-T-C 10053428-T-C **
9929308-C-T 10091699-C-T **
9929314-G-C 10091705-G-C **
14292801-G-A 12172095-G-A K200 **
15288100-T-C 13176199-T-C **
15433481-T-C 13321601-T-C M6406 **
16480170-G-A 14368290-G-A **
22429624-G-C 20267738-G-C DYZ19 **
23364108-G-A 21202222-G-A **
24052532-C-A 21906385-C-A P3_b1 **
23364104-G-A 21202218-G-A **
23514293-C-T 21352407-C-T **
15433500-G-A 13321620-G-A **
15353791-T-C 13241910-T-C **
22164362-A-C 20002476-A-C FGC23293 **
8644278-G-A 8776237-G-A BY3504Y22925 **
9929301-G-A 10091692-G-A **
9929292-T-C 10091683-T-C **
6663751-G-T 6795710-G-T **
7984440-G-A 8116399-G-A **
22316207-T-G 20154321-T-G DYZ19 **
13801484-A-C 11680778-A-C **
23373519-T-C 21211633-T-C **
21200202-G-T 19038316-G-T **
18390083-C-A 16278203-C-A P6_Gap 19×A**
13801468-C-G 11680762-C-G **
6250506-C-A 6382465-C-A FGC80937 IR3_Dst **
59033046-C-T 56886899-C-T **
13809910-G-A 11689204-G-A **
13860593-C-T 11739887-C-T **
59033093-T-C 56886946-T-C **
59033099-T-A 56886952-T-A **
59033101-C-T 56886954-C-T **
59033032-G-A 56886885-G-A **
59033108-T-C 56886961-T-C **
59033112-T-C 56886965-T-C **
14771285-G-A 12659354-G-A CTS3257 **
28604465-C-G 26458318-C-G CTS12543 **
26120257-TTTCC-T 23974110-TTTCC-T P1_Y1 5×TTCC**
4223442-A-G 4355401-A-G ****
13588226-T-A 11432550-T-A **
6757694-A-C 6889653-A-C **
6878915-A-T 7010874-A-T **
16492532-G-T 14380652-G-T PR5835 ****
18020806-G-C 15908926-G-C ****
23198909-C-A 21037023-C-A ****
24415780-A-C 22269633-A-C **
25939863-A-G 23793716-A-G P1_Y1 **
24296319-C-A 22150172-C-A P3_t1 **
4067369-T-A 4199328-T-A 26×A**
5540254-CGT-C 5672213-CGT-C 10×GT**
13233337-G-A 11077661-G-A **
13273371-CT-C 11117695-CT-C 10×T**
22436200-T-C 20274314-T-C DYZ19 **
11021660-A-T **
14908271-A-G 12796338-A-G **
6953386-G-GA 7085345-G-GA 9×A**
15132082-A-T 13020169-A-T **
28610362-T-C 26464215-T-C **
19924680-T-A 17812800-T-A P5_Prx **
15215520-T-C 13103606-T-C **
21315156-C-T 19153270-C-T **
21315158-TG-T 19153272-TG-T **
10814878-T-C **
15986671-T-G 13874791-T-G **
10749107-C-A **
17347562-C-A 15235682-C-A **
10657835-G-T **
8056205-A-T 8188164-A-T **
19304704-C-A 17192824-C-A **
10796129-T-C **
10951735-C-T **
16896346-T-C 14784466-T-C **
22335163-A-G 20173277-A-G DYZ19 **
14308225-C-A 12187519-C-A **
28607818-C-A 26461671-C-A **
11010412-T-A **
23779725-C-A 21617839-C-A **
16175235-T-C 14063355-T-C **
16648166-A-C 14536286-A-C **
21921904-T-G 19760018-T-G **
14908270-C-T 12796337-C-T **
25333905-G-A 23187758-G-A P2_r1 **
10938323-ACTACAGTCCT-A **
21979988-C-A 19818102-C-A **
8345911-A-G 8477870-A-G **
20993599-A-AG 18831713-A-AG P4_Dst **
10934703-T-A **
28610396-T-G 26464249-T-G **
14033954-G-A 11913248-G-A **
10947627-T-A **
4052188-A-G 4184147-A-G **
14080001-G-T 11959295-G-T **
18926872-CAAAAAA-C 16814992-CAAAAAA-C 17×A**
6765588-T-G 6897547-T-G **
11010246-A-C **
15402848-A-C 13290968-A-C **
17085721-CTTTTT-C 14973841-CTTTTT-C 20×T**
20497572-CTTTT-C 18335686-CTTTT-C P5_Dst 30×T**
16783310-C-A 14671430-C-A **
14017681-C-A 11896975-C-A **
13205337-T-G 11049661-T-G **
13205339-C-T 11049663-C-T **
23199910-G-C 21038024-G-C **
13487726-C-T 11332050-C-T **
13487747-C-CA 11332071-C-CA **
22429608-A-G 20267722-A-G DYZ19 **
22429611-A-G 20267725-A-G F7734 DYZ19 **
25524729-G-A 23378582-G-A P1_gr1 **
14384968-C-A 12264264-C-A **
11010249-C-A **
11010261-A-C **
8556229-A-G 8688188-A-G **
6918523-G-A 7050482-G-A **
4540187-C-A 4672146-C-A **
14627225-C-A 12515293-C-A **
10778838-C-A **
10971683-G-A **
17467014-T-C 15355134-T-C **
23514340-C-T 21352454-C-T **
17515431-CA-C 15403551-CA-C **
6994504-C-A 7126463-C-A **
13318015-T-A 11162339-T-A **
14183378-C-A 12062672-C-A **
16971268-G-A 14859388-G-A **
3992113-G-A 4124072-G-A **
15696882-A-G 13585002-A-G **
14511236-T-C 12399441-T-C **
13223404-G-A 11067728-G-A **
14511239-C-T 12399444-C-T **
10947325-C-A **
7033313-A-G 7165272-A-G **
5073558-C-A 5205517-C-A **
22089878-T-C 19927992-T-C **
14183276-G-A 12062570-G-A **
14765290-G-T 12653359-G-T **
18196372-A-T 16084492-A-T **
10876052-G-T **
17122216-A-AT 15010336-A-AT 8×T**
21828501-C-A 19666615-C-A **
13998265-T-C 11877559-T-C **
7534643-CAAAAAA-C 7666602-CAAAAAA-C 17×A**
16357206-G-GT 14245326-G-GT **
22101954-C-A 19940068-C-A **
23255375-C-A 21093489-C-A **
27053557-A-C 24907410-A-C P1_r4 **
7171910-C-A 7303869-C-A **
16572702-G-A 14460822-G-A Z28469 **
28600509-T-C 26454362-T-C **
28600510-G-A 26454363-G-A **
4888108-C-A 5020067-C-A **
6981156-G-A 7113115-G-A **
18539050-C-A 16427170-C-A **
21526937-T-A 19365051-T-A **
21526942-A-G 19365056-A-G **
21526954-A-T 19365068-A-T **
22165100-G-A 20003214-G-A **
16357196-T-G 14245316-T-G **
21750816-C-A **
19300700-C-A 17188820-C-A **
23305712-C-A 21143826-C-A **
27232188-CT-C 25086041-CT-C P1_g3 **
21410155-A-G 19248269-A-G **
6903824-C-A 7035783-C-A **
3712244-C-A 3844203-C-A **
6903664-G-T 7035623-G-T **
8760575-G-A 8892534-G-A **
18626753-C-A 16514873-C-A FT24345 **
22882156-C-A 20720270-C-A **
19156152-G-A 17044272-G-A **
23285174-C-A 21123288-C-A **
19558821-C-A 17446941-C-A **
21141141-C-A 18979255-C-A **
2885435-G-C 3017394-G-C **
2708411-CGAGAGAGAGAGAGA-C 2840370-CGAGAGAGAGAGAGA-C 23×GA**
3695984-A-G 3827943-A-G **
2745771-T-G 2877730-T-G **
2758183-G-T 2890142-G-T **
2759973-T-C 2891932-T-C **
2762059-CAAA-C 2894018-CAAA-C 8×A**
2773941-G-A 2905900-G-A **
2774753-G-C 2906712-G-C **
2856782-CTTTTTT-C 2988741-CTTTTTT-C 24×T**
2885423-G-A 3017382-G-A FT48634 **
2885425-TGAG-T 3017384-TGAG-T **
2885440-G-A 3017399-G-A **
2684030-ATT-A 2815989-ATT-A **
2885444-T-C 3017403-T-C **
2885450-T-C 3017409-T-C **
2885453-A-G 3017412-A-G **
2906665-T-G 3038624-T-G **
2928749-A-G 3060708-A-G **
2967112-AT-A 3099071-AT-A **
3033433-A-G 3165392-A-G **
2684041-G-T 2816000-G-T **
3240379-C-T 3372338-C-T FT38321 **
3422942-G-T 3554901-G-T **
3400234-G-T 3532193-G-T **
3274905-G-T 3406864-G-T **
2684062-A-C 2816021-A-C **
10983135-C-A **
15842936-C-A 13731056-C-A **
3974711-G-T 4106670-G-T **
3594839-AT-A 3726798-AT-A **
13468307-C-T 11312631-C-T **
9764147-T-A 9926538-T-A **
19318272-T-C 17206392-T-C **
19318274-T-C 17206394-T-C **
14461327-C-A 12340600-C-A **
18174710-C-A 16062830-C-A **
13218726-T-C 11063050-T-C **
23311304-G-T 21149418-G-T **
7002362-T-C 7134321-T-C **
3975399-C-A 4107358-C-A **
10876104-A-T **
16033830-C-A 13921950-C-A **
16754975-T-C 14643095-T-C **
3929846-G-T 4061805-G-T **
3909225-G-T 4041184-G-T **
10988757-C-A **
28776776-C-A 26630629-C-A **
8043320-C-T 8175279-C-T **
13550405-A-G 11394729-A-G **
3865948-C-A 3997907-C-A **
17478750-G-A 15366870-G-A **
11018452-C-T **
3831599-T-C 3963558-T-C **
21923991-A-G 19762105-A-G **
8075355-T-G 8207314-T-G **
6748819-T-A 6880778-T-A **
28653819-C-A 26507672-C-A **
14470490-G-A 12349759-G-A **
7270315-G-A 7402274-G-A **
19563169-C-A 17451289-C-A **
15132093-A-G 13020180-A-G **
18838837-C-A 16726957-C-A **
15104943-C-A 12993031-C-A **
11674738-C-G **
11674735-T-A **
6870688-C-A 7002647-C-A **
18534197-C-A 16422317-C-A P6_Dst **
2885457-AT-A 3017416-AT-A **
21410166-T-C 19248280-T-C **
7141993-T-C 7273952-T-C **
18102146-A-G 15990266-A-G **
7470626-T-A 7602585-T-A IR1_L **
5031524-C-A 5163483-C-A **
3649471-C-A 3781430-C-A **
9830476-C-A 9992867-C-A **
5821704-C-A 5953663-C-A **
16136071-T-TC 14024191-T-TC P8_Dst **
10939711-G-T **
9764157-G-A 9926548-G-A **
13588277-A-G 11432601-A-G **
3537491-T-C 3669450-T-C **
21444505-C-A 19282619-C-A **
15202393-C-A 13090479-C-A **
14927244-C-G 12815309-C-G **
3681646-C-A 3813605-C-A **
15402842-C-G 13290962-C-G **
11657715-C-A **
5292890-A-G 5424849-A-G **
10883537-C-G **
56752237-C-A **
56752240-T-A **
56752241-C-A **
4293068-C-A 4425027-C-A **
6903671-G-T 7035630-G-T **
10949550-C-G **
16050474-C-A 13938594-C-A **
9040374-G-T 9202765-G-T **
14927249-A-G 12815314-A-G **
18196362-G-T 16084482-G-T **
56752246-G-T **
21115899-C-A 18954013-C-A **
14977296-CTTTTT-C 12865371-CTTTTT-C 15×T**
10841184-C-A **
24221459-C-A 22075312-C-A P3_b1 **
14192968-C-A 12072262-C-A **
22165107-G-T 20003221-G-T **
2772922-C-A 2904881-C-A **
10079480-AT-A 10241871-AT-A 10×T**
7984408-G-C 8116367-G-C **
14183309-C-T 12062603-C-T **
8704248-T-A 8836207-T-A **
22155545-C-A 19993659-C-A **
9442137-A-G 9604528-A-G **
3909109-C-A 4041068-C-A 22×A**
2684056-A-G 2816015-A-G **
7221536-A-G 7353495-A-G **
16305911-C-T 14194031-C-T **
3442284-A-G 3574243-A-G **
15986698-G-A 13874818-G-A **
15986693-G-C 13874813-G-C **
21371542-T-C 19209656-T-C **
24508421-A-G 22362274-A-G **
18003242-G-A 15891362-G-A P7_Gap **
8056245-C-T 8188204-C-T **
6700803-A-G 6832762-A-G **
18673689-C-A 16561809-C-A **
8181396-C-T 8313355-C-T **
8142787-C-A 8274746-C-A **
21880882-C-T 19718996-C-T **
6903688-G-A 7035647-G-A **
10831619-T-A **
3463553-A-G 3595512-A-G **
21880883-C-T 19718997-C-T **
17467019-C-G 15355139-C-G **
11009076-A-T **
10778841-T-C **
10941206-T-C **
3504198-G-T 3636157-G-T **
13830344-A-G 11709638-A-G ***
58975882-T-TCATTCCATTC 56829735-T-TCATTCCATTC ***
13818016-T-C 11697310-T-C ***
13804706-T-G 11684000-T-G ***
13801523-G-A 11680817-G-A ***
13801518-A-T 11680812-A-T ***
13661156-A-G 11505480-A-G ***
13801483-C-T 11680777-C-T ***
25176850-C-CTT 23030703-C-CTT g1 30×T***
13659554-C-A 11503878-C-A ***
13801439-C-T 11680733-C-T ***
13801509-G-C 11680803-G-C ***
13801478-G-A 11680772-G-A ***
21354079-T-G 19192193-T-G ***
13853680-C-A 11732974-C-A ***
13843374-G-A 11722668-G-A ***
13829598-A-T 11708892-A-T ***
21316034-G-A 19154148-G-A BY179651 ***
58844535-T-C 56746336-A-G ***
20602110-G-A 18440224-G-A P5_Dst ***
21296885-A-G 19134999-A-G ***
20602104-T-A 18440218-T-A P5_Dst ***
58820546-C-A 56770325-G-T ***
20602103-A-C 18440217-A-C P5_Dst ***
58974680-T-C 56828533-T-C ***
58876834-A-C 56714037-T-G ***
25465346-A-AT 23319199-A-AT P2_r2 15×T***
58980059-C-T 56833912-C-T ***
20602102-A-G 18440216-A-G P5_Dst ***
20231508-C-CAAGAAAGAAAGAAAGA 18069622-C-CAAGAAAGAAAGAAAGA P5_Dst 21×AAGA***
13853682-C-G 11732976-C-G ***
58975710-TC-AC,T 56829563-TC-AC,T ***
13804957-T-G 11684251-T-G ***
13824868-CAAATGGAATG-C 11704162-CAAATGGAATG-C ***
13843373-A-T 11722667-A-T ***
13660583-G-A 11504907-G-A ***
21929598-GTG-G,GTA 19767712-GTG-G,GTA ***
13704423-A-G 11548747-A-G ***
28800306-T-C 26654159-T-C ***
20602109-G-A 18440223-G-A P5_Dst ***
13818695-A-G 11697989-A-G ***
13140106-T-A,C 10629592-T-A,C ***
13867726-G-C 11747020-G-C ***
58844528-G-T 56746343-C-A ***
25176881-G-T 23030734-G-T g1 ***
28800322-G-A 26654175-G-A FGC30407 ***
13862169-C-A 11741463-C-A ***
13458583-T-C 11302907-T-C ***
13843402-T-G 11722696-T-G ***
13843438-T-A 11722732-T-A ***
13837539-G-A 11716833-G-A ***
13862233-A-C 11741527-A-C ***
28784818-A-T 26638671-A-T ***
21316052-G-GC 19154166-G-GC ***
21316055-A-G 19154169-A-G ***
13666139-G-A 11510463-G-A ***
13867782-C-G,T 11747076-C-G,T ***
13867405-A-T 11746699-A-T ***
58980054-C-T 56833907-C-T ***
13658921-G-C 11503245-G-C ***
13663944-A-G 11508268-A-G ***
13664544-G-A 11508868-G-A ***
13867721-C-G 11747015-C-G ***
13664598-C-G 11508922-C-G ***
13664613-C-G 11508937-C-G ***
13804296-T-G 11683590-T-G ***
13804297-T-A 11683591-T-A ***
13813386-A-G 11692680-A-G ***
13867716-G-A 11747010-G-A ***
13855091-T-G 11734385-T-G ***
13855084-T-A 11734378-T-A ***
13855065-A-T 11734359-A-T ***
13815081-A-T 11694375-A-T ***
28800307-G-A 26654160-G-A ***
13841907-A-G 11721201-A-G ***
13824897-T-A 11704191-T-A ***
58975922-C-T 56829775-C-T ***
13830346-G-A 11709640-G-A ***
13830348-A-T 11709642-A-T ***
13838532-G-A 11717826-G-A ***
13858471-A-T 11737765-A-T ***
13818687-G-A 11697981-G-A ***
22254417-A-G 20092531-A-G FGC78609 DYZ19 ***
20602133-C-CT 18440247-C-CT P5_Dst 10×T***
22254398-A-T 20092512-A-T BY46322 DYZ19 ***
13855099-T-C 11734393-T-C ***
22254392-T-G 20092506-T-G DYZ19 ***
22254378-T-G 20092492-T-G DYZ19 ***
28799008-G-A 26652861-G-A 5×GGAAT***
21163211-C-A 19001325-C-A ***
58977773-T-C 56831626-T-C ***
13802987-G-C 11682281-G-C ***
13864879-A-T 11744173-A-T ***
13402569-G-A 11246893-G-A ***
58975699-T-C 56829552-T-C ***
13802988-G-A 11682282-G-A ***
13803002-G-T 11682296-G-T ***
9945311-C-T 10107702-C-T ***
28785931-A-AAGTGG 26639784-A-AAGTGG ***
13652215-A-G 11496539-A-G ***
13803012-G-T 11682306-G-T ***
13650661-T-A 11494985-T-A ***
21100529-A-G 18938643-A-G ***
13805486-C-G 11684780-C-G ***
13684846-A-G 11529170-A-G ***
13841234-T-A 11720528-T-A ***
13862027-T-A 11741321-T-A ***
13847247-T-C 11726541-T-C ***
13868472-A-T 11747766-A-T ***
58977206-C-T 56831059-C-T ***
13819003-C-G 11698297-C-G ***
13676608-A-G 11520932-A-G ***
19884264-CA-C 17772384-CA-C P5_Prx 11×A***
19979864-CTT-C 17867984-CTT-C P5_Prx 28×T***
10018585-A-ATTCTTTCTTTCTTCTTTCT 10180976-A-ATTCTTTCTTTCTTCTTTCT 4×TTCT***
13453958-T-C 11298282-T-C ***
13812959-T-A 11692253-T-A ***
13858133-A-C 11737427-A-C ***
13858139-T-A 11737433-T-A ***
13866909-A-G 11746203-A-G ***
22337888-G-A 20176002-G-A DYZ19 ***
28800317-A-G 26654170-A-G ***
58977211-T-C 56831064-T-C ***
23833281-A-G 21671395-A-G ***
9945373-T-C 10107764-T-C ***
13819004-G-A 11698298-G-A 11×ATGGA***
13661164-T-C 11505488-T-C ***
13446730-T-C 11291054-T-C ***
13863374-G-A 11742668-G-A ***
13863449-C-G 11742743-C-G ***
58873271-T-C 56717600-A-G ***
13814947-G-C 11694241-G-C ***
13823179-A-G 11702473-A-G ***
25280367-CT-C 23134220-CT-C P2_r1 26×T***
13138054-T-C 10627540-T-C ***
13142936-C-T 10632422-C-T ***
13458588-T-C 11302912-T-C ***
13464360-A-C 11308684-A-C ***
58974727-A-T 56828580-A-T ***
13853811-A-C 11733105-A-C ***
13809608-T-C 11688902-T-C ***
4293430-C-A 4425389-C-A ***
13823174-A-G 11702468-A-G ***
13853563-C-A 11732857-C-A ***
13838800-T-G 11718094-T-G ***
13869040-G-A 11748334-G-A ***
22444046-C-T 20282160-C-T DYZ19 ***
13141998-C-T 10631484-C-T ***
13455231-T-A 11299555-T-A 5×TTCCA***
13659447-G-T 11503771-G-T ***
13659459-T-G 11503783-T-G ***
13664584-T-G 11508908-T-G ***
13700333-G-A 11544657-G-A ***
13812083-A-G 11691377-A-G ***
27082352-GGAA-G 24936205-GGAA-G P1_r4 5×GAA***
13817757-A-G 11697051-A-G ***
13824927-G-T 11704221-G-T ***
13824952-A-T 11704246-A-T ***
13833826-A-G 11713120-A-G ***
19682539-A-G 17570659-A-G P5_Prx ***
25931592-G-GAAGAAAGA 23785445-G-GAAGAAAGA P1_Y1 14×AAGA***
28517152-C-A 26371005-C-A ***
58908820-C-A 56682051-G-T ***
58908922-C-T 56681949-G-A ***
13454583-G-A 11298907-G-A BY50604 ***
13704416-T-G 11548740-T-G ***
13867261-G-T 11746555-G-T ***
13651488-G-C 11495812-G-C ***
13853840-C-A 11733134-C-A ***
13194870-C-T 11039194-C-T ***
13704411-A-T 11548735-A-T ***
22817990-C-A 20656104-C-A ***
13139465-G-A 10628951-G-A ***
13801504-C-G 11680798-C-G ***
13858128-A-T 11737422-A-T ***
28798989-G-T 26652842-G-T ***
28799010-G-A 26652863-G-A ***
28799017-A-G 26652870-A-G ***
28799022-A-G 26652875-A-G ***
28799027-A-G 26652880-A-G ***
58977644-G-A,T 56831497-G-A,T ***
22594672-G-C 20432786-G-C ***
13704410-A-G 11548734-A-G ***
13853172-T-G 11732466-T-G ***
22839135-A-G 20677249-A-G ***
26453074-GT-G 24306927-GT-G P1_Y1 12×T***
22540424-T-A 20378538-T-A ***
13455120-C-A 11299444-C-A ***
13804390-G-A 11683684-G-A ***
13853578-A-G 11732872-A-G ***
13821011-G-A 11700305-G-A ***
13833544-C-G 11712838-C-G ***
13833591-A-G 11712885-A-G ***
13865470-T-G 11744764-T-G ***
22421062-A-C 20259176-A-C DYZ19 ***
22421068-T-G 20259182-T-G DYZ19 ***
13853638-G-A 11732932-G-A ***
13139463-A-C 10628949-A-C ***
13139449-A-C 10628935-A-C ***
13194934-A-G 11039258-A-G ***
13664848-A-C 11509172-A-C ***
13194939-T-A 11039263-T-A ***
13650683-A-G 11495007-A-G ***
13667259-C-A 11511583-C-A ***
13833481-T-C,G 11712775-T-C,G ***
13838094-C-A 11717388-C-A ***
13854247-G-T 11733541-G-T ***
22436937-G-C 20275051-G-C BY42005 DYZ19 ***
58975161-G-C 56829014-G-C ***
13802972-G-C 11682266-G-C ***
19948181-C-CCTTTCTTT,T 17836301-C-CCTTTCTTT,T P5_Prx 21×CTTT***
28792193-C-T 26646046-C-T ***
13669556-T-C 11513880-T-C ***
58981192-T-A 56835045-T-A ***
13489638-A-C 11333962-A-C ***
13813500-C-A 11692794-C-A S14590 ***
17278273-CGAAA-C,CG 15166393-CGAAA-C,CG 16×GAAA***
13447437-G-T 11291761-G-T ***
13854203-T-G 11733497-T-G ***
13863522-C-T 11742816-C-T ***
22336312-A-G 20174426-A-G DYZ19 ***
13142921-C-T 10632407-C-T ***
10024425-G-T 10186816-G-T ***
13808738-T-C 11688032-T-C ***
22968105-A-G 20806219-A-G ***
13676770-G-A 11521094-G-A BY88053 ***
13855605-G-C 11734899-G-C ***
19266816-C-A 17154936-C-A ***
17155958-T-C 15044078-T-C ***
19036743-TA-T 16924863-TA-T ***
10776935-G-T ***
58908843-C-CGCACT,T 56682028-G-A,AGTGCG 12×CCATT***
56763504-A-G ***
16948363-CTTT-C 14836483-CTTT-C 14×T***
15350097-C-A 13238216-C-A ***
15350069-C-A 13238188-C-A ***
15349885-C-A 13238004-C-A ***
17238338-G-A 15126458-G-A ***
16692071-C-A 14580191-C-A 9×A***
8568465-GTTT-G 8700424-GTTT-G 22×T***
6857222-G-C 6989181-G-C ***
13474745-C-T 11319069-C-T ***
10808646-C-A ***
14831720-G-GT,GTT 12719787-G-GT,GTT 17×T***
13833485-A-G,T 11712779-A-G,T ***
14824285-C-A 12712352-C-A ***
14093680-C-A 11972974-C-A ***
14765341-C-G 12653410-C-G ***
7196582-TTA-T 7328541-TTA-T ***
8428933-A-C 8560892-A-C ***
17012834-C-A 14900954-C-A ***
14600196-T-G 12488396-T-G ***
10799562-TTCTATTTCATTCCTC-T ***
13456726-C-A 11301050-C-A ***
7172308-G-T 7304267-G-T ***
56724759-C-T ***
7215119-T-C 7347078-T-C ***
13833497-T-A,G 11712791-T-A,G ***
25096447-AG-A,AGGAAA 22950300-AG-A,AGGAAA g1 ***
7264897-C-T 7396856-C-T ***
16283998-C-A 14172118-C-A ***
58974684-T-C 56828537-T-C ***
58974686-C-G 56828539-C-G ***
58974693-T-C 56828546-T-C ***
16342660-G-A 14230780-G-A ***
58974696-G-C 56828549-G-C ***
58977790-C-T 56831643-C-T ***
58979527-T-A 56833380-T-A ***
58981059-G-T 56834912-G-T ***
58982300-T-C 56836153-T-C ***
58982941-C-T 56836794-C-T ***
59022350-G-A 56876203-G-A ******
25628439-CTT-C 23482292-CTT-C P1_b3 26×T***
19412006-GAGA-G 17300126-GAGA-G 14×AGAA***
15504029-C-A 13392149-C-A ***
13664424-A-C,G 11508748-A-C,G ***
13446680-C-T 11291004-C-T ***
16076204-T-C 13964324-T-C ***
21629397-G-GT 19467511-G-GT 9×T***
13868516-C-A,G 11747810-C-A,G ***
16057973-A-T 13946093-A-T ***
22337907-C-A 20176021-C-A DYZ19 ***
2832945-A-G 2964904-A-G ***
14393413-G-A 12272709-G-A ZS5037 ***
15785731-T-C 13673851-T-C ***
8399151-C-A 8531110-C-A ***
15664007-C-T 13552127-C-T FGC57630 ***
13602701-C-A 11447025-C-A ***
10747118-T-A ***
16458638-C-A 14346758-C-A ***
9647683-C-A 9810074-C-A IR3_Prx ***
13473658-T-A 11317982-T-A ***
18659515-C-A 16547635-C-A ***
13235129-C-A 11079453-C-A ***
9962493-C-A 10124884-C-A ***
15623438-G-A 13511558-G-A ***
13215631-C-A 11059955-C-A ***
18940601-CA-C 16828721-CA-C ***
11033239-G-A ***
11033231-C-T ***
11033229-T-A ***
9461121-C-A 9623512-C-A ***
7338736-C-A 7470695-C-A ***
13521089-C-A 11365413-C-A ***
13486166-C-A 11330490-C-A ***
21127274-C-A 18965388-C-A ***
10987851-TTCCATTCCATTCCACTCCAC-T,TTCCATTCCATTCCATTCCAC ***
10662176-G-C,T ***
13459545-C-GGGTTA 11303869-C-GGGTTA ***
14144091-T-C 12023385-T-C ***
10746905-TTCAAC-T,TTCCAT ***
56734838-T-A ***
10782799-G-T ***
22185542-G-A 20023656-G-A ***
17895175-ATTT-A,ATT 15783295-ATTT-A,ATT 21×T***
10795037-C-A ***
10808631-C-T ***
13450109-CTCCACCCCATCCCATCCCATTCTATTCCAT-C,CTCCACCCCATTCCATTCCTTTCCATTCCAT 11294433-CTCCACCCCATCCCATCCCATTCTATTCCAT-C,CTCCACCCCATTCCATTCCTTTCCATTCCAT ***
13483417-A-G 11327741-A-G ***
7865897-C-T 7997856-C-T ***
14312320-C-A 12191614-C-A ***
11019241-C-A ***
7667926-C-A 7799885-C-A ***
14409218-C-T 12288515-C-T ***
14609823-A-ATAT 12498025-A-ATAT ***
14303039-C-A 12182333-C-A ***
14280236-C-CT 12159530-C-CT 9×T***
14238412-CA-C,CAA 12117706-CA-C,CAA 12×A***
23274825-C-T 21112939-C-T ***
10808638-C-G ***
56707191-A-T ***
21100517-G-C 18938631-G-C ***
21100519-A-G 18938633-A-G ***
21285309-C-A 19123423-C-A ***
8053514-A-G 8185473-A-G ***
8053496-C-T 8185455-C-T ***
18401368-C-A 16289488-C-A P6_Gap ***
8644323-GCAA-G 8776282-GCAA-G ***
8397456-T-C 8529415-T-C ***
7994243-T-C 8126202-T-C Y85557 ***
13927855-A-G 11807149-A-G ***
8644213-C-A 8776172-C-A ***
13971609-G-GAGGAAA 11850903-G-GAGGAAA ***
8766342-G-T 8898301-G-T ***
10808609-T-C ***
21888464-C-A 19726578-C-A ***
10664760-C-A ***
9094856-T-A 9257247-T-A ***
58974681-G-C 56828534-G-C ***
58974675-T-C 56828528-T-C ***
19109817-C-T 16997937-C-T ***
18178103-A-G 16066223-A-G ***
9654435-G-A 9816826-G-A IR3_Prx ***
9937894-A-AT 10100285-A-AT ***
13142873-T-C 10632359-T-C ***
13402571-C-G 11246895-C-G ***
18266776-A-AT 16154896-A-AT ***
13448936-A-T 11293260-A-T ***
13448937-C-T 11293261-C-T ***
13455713-C-T 11300037-C-T ***
13458573-T-C 11302897-T-C ***
13648190-GGAAAA-G 11492514-GGAAAA-G ***
13654436-A-T 11498760-A-T ***
13663939-G-A 11508263-G-A ***
13663946-T-A 11508270-T-A ***
18758039-C-A 16646159-C-A ***
13663950-A-G 11508274-A-G ***
13664578-G-A 11508902-G-A ***
13729179-A-G 11573503-A-G ***
13800548-G-T 11679842-G-T ***
13802733-A-G 11682027-A-G ***
13805007-T-G 11684301-T-G FGC78017 ***
13805404-A-G 11684698-A-G ***
13805405-T-C 11684699-T-C ***
17887553-ATT-A 15775673-ATT-A 10×T***
13805407-G-T 11684701-G-T ***
13809030-A-T 11688324-A-T ***
13809036-A-G 11688330-A-G ***
9654428-G-A 9816819-G-A IR3_Prx ***
13448916-C-T 11293240-C-T ***
13809114-G-T 11688408-G-T ***
13858570-G-A 11737864-G-A ***
13803022-G-A 11682316-G-A ***
20602112-G-C 18440226-G-C P5_Dst ***
20602118-T-A 18440232-T-A P5_Dst ***
20602125-A-C 18440239-A-C P5_Dst ***
19066244-C-A 16954364-C-A ***
20602127-T-A 18440241-T-A P5_Dst ***
19039737-C-A 16927857-C-A ***
20602128-G-A 18440242-G-A P5_Dst ***
13459176-C-G 11303500-C-G ***
13453041-G-C,T 11297365-G-C,T ***
18965922-A-G 16854042-A-G ***
13804711-A-C 11684005-A-C ***
13858464-C-G,T 11737758-C-G,T ***
22250210-T-G 20088324-T-G DYZ19 ***
13472129-G-T 11316453-G-T ***
24192237-CAA-C 22046090-CAA-C P3_b1 22×A***
28800311-G-C 26654164-G-C ***
13140980-C-T 10630466-C-T ***
13448929-T-C 11293253-T-C ***
28800300-T-G 26654153-T-G ***
13853637-T-C 11732931-T-C ***
58975664-T-TTCCATTCCATTCCAG 56829517-T-TTCCATTCCATTCCAG ***
13936147-G-C 11815441-G-C ***
13936159-A-G 11815453-A-G ***
58974701-C-T 56828554-C-T ***
58974707-A-T 56828560-A-T ***
13809112-G-A,T 11688406-G-A,T ***
13809134-G-C 11688428-G-C ***
58974666-G-C 56828519-G-C ***
27810337-GGA-G 25664190-GGA-G P1_Y2 ***
22254389-T-G 20092503-T-G DYZ19 ***
22421063-C-T 20259177-C-T DYZ19 ***
22502932-G-A 20341046-G-A DYZ19 ***
16861183-C-A 14749303-C-A ***
16789767-C-A 14677887-C-A ***
16781535-T-C 14669655-T-C ***
23317649-C-CTT 21155763-C-CTT 37×T***
5186754-A-G 5318713-A-G 16×TG***
25343331-T-C 23197184-T-C P2_r1 ***
26529174-A-G 24383027-A-G P1_g2 ***
26529181-A-G 24383034-A-G P1_g2 ***
26946206-TAAA-T 24800059-TAAA-T P1_r3 25×A***
28786616-A-G 26640469-A-G ***
15498834-G-C 13386954-G-C ***
28799832-GGATTA-G 26653685-GGATTA-G ***
28800316-C-T 26654169-C-T ***
58819384-ATTCCT-A 56771473-CGAAAG-C ***
58820540-T-C 56770331-A-G ***
58824723-T-C 56766148-A-G ***
58827223-G-T 56763648-C-A ***
58843030-GATTCCATTCCATTCT-G 56747815-AGGAATGGAATAGAAT-A ***
58876743-CTCATT-C,CCCATT 56714122-GAATGA-G,GAATGG ***
58908815-C-G 56682056-G-C ***
58972240-G-C 56826093-G-C 4×ATTCC***
16539758-G-A 14427878-G-A ***
58974311-A-C 56828164-A-C ***
16345135-CTCTTCTTCTTCT-C,CT 14233255-CTCTTCTTCTTCT-C,CT 18×TCT***
17090563-G-A 14978683-G-A ***
13809136-C-T 11688430-C-T ***
13821298-T-G 11700592-T-G ***
13809172-T-G 11688466-T-G ***
13809176-A-G 11688470-A-G ***
13809182-T-A 11688476-T-A ***
13809958-G-T 11689252-G-T ***
13815045-C-A 11694339-C-A ***
13815062-A-G 11694356-A-G ***
13815101-A-T 11694395-A-T ***
13818870-T-A 11698164-T-A ***
17603049-C-A 15491169-C-A ***
13820653-A-G 11699947-A-G ***
13820656-T-A 11699950-T-A ***
13821291-A-G 11700585-A-G ***
13833781-GGAGTT-G 11713075-GGAGTT-G ***
15498833-T-C 13386953-T-C ***
13837551-T-G 11716845-T-G ***
13838580-T-A 11717874-T-A ***
13845608-G-A,T 11724902-G-A,T ***
13855071-G-C 11734365-G-C ***
13855086-C-G 11734380-C-G ***
13855101-C-T 11734395-C-T ***
13863699-T-G 11742993-T-G ***
13867717-G-A 11747011-G-A ***
13868988-A-T 11748282-A-T ***
13936163-A-G 11815457-A-G ***
15498832-C-T 13386952-C-T ***
17246704-C-A 15134824-C-A ***
17201760-TTC-T,TTT 15089880-TTC-T,TTT ***
10008531-C-T 10170922-C-T ***

In the table above, the meaning of the confidence field depends on whether the data comes from an FTDNA kit or an FGC kit. For FTDNA kits, + implies a "PASS" result with just one possible variant, * indicates a "PASS" but with multiple variants, ** indicates "REJECTED" with just a single variant, and *** indicates "REJECTED" with multiple possible variants. 'A*' are heterozygous variants not called by FTDNA, but still pulled from the VCF file. For FGC kits, + indicates over 99% likely genuine (95% for INDELs); * over 95% likely genuine (90% for INDELs); ** about 40% likely genuine; *** about 10% likely genuine. Manual entries read directly from a BAM file will be either + indicating positive, or * indicating that the data show a mixture of possible variants.

For the FTDNA kits, the BED data is encoded in the background color of the cells. Those cells with a white background have coverage, those with a grey background indicate no coverage in the BED file, and those with a pink background indicate the mutation is on the edge of a coverage region. These pink regions often indicate that the individual may be positive for a SNP even if there is no corresponding entry in the vcf file.

The combBED column indicates whether or not the mutation is a SNP and falls in the combBED region defined in Defining a New Rate Constant for Y-Chromosome SNPs based on Full Sequencing Data by Dmitry Adamov, Vladimir Guryanov, Sergey Karzhavin, Vladimir Tagankin, Vadim Urasin.

The McDonald BED column indicates whether or not the mutation is a SNP and falls in the BED region used by Dr. Iain McDonald in the age analysis he does for R-U106 men.

Haplotype Progression

The data below reveals the progression of changes in the haplotype. The bottom row is the haplotype for this man and above him are the inferred ancestral haplotypes for various upstream blocks. These inferred haplotypes are very much a work in progress, and any suggested modifications are appreciated. I think we can use our vast collection of haplotype data to refine these haplotypes. Mutations made from each upstream block are shown in sequence. The cell color is determined by the block in which the mutation took place.

DYS393
DYS390
DYS19
DYS391
DYS385
DYS426
DYS388
DYS439
DYS389i
DYS392
DYS389ii
DYS458
DYS459
DYS455
DYS454
DYS447
DYS437
DYS448
DYS449
DYS464
DYS460
Y-GATA-H4
YCAII
DYS456
DYS607
DYS576
DYS570
CDY
DYS442
DYS438
DYS531
DYS578
DYF395S1
DYS590
DYS537
DYS641
DYS472
DYF406S1
DYS511
DYS425
DYS413
DYS557
DYS594
DYS436
DYS490
DYS534
DYS450
DYS444
DYS481
DYS520
DYS446
DYS617
DYS568
DYS487
DYS572
DYS640
DYS492
DYS565
DYS710
DYS485
DYS632
DYS495
DYS540
DYS714
DYS716
DYS717
DYS505
DYS556
DYS549
DYS589
DYS522
DYS494
DYS533
DYS636
DYS575
DYS638
DYS462
DYS452
DYS445
Y-GATA-A10
DYS463
DYS441
Y-GGAAT-1B07
DYS525
DYS712
DYS593
DYS650
DYS532
DYS715
DYS504
DYS513
DYS561
DYS552
DYS726
DYS635
DYS587
DYS643
DYS497
DYS510
DYS434
DYS461
DYS435
P312/S1161324141111-14121212131329179-1011112515192915-15-17-17111119-231615181736-38121211915-1681010810101223-231610121215812222013121113111112123315916122626191211131210912121011113012132413101020151913241712152412231810141791211
L21/S1451324141111-14121212131329179-1011112515192915-15-17-17111119-231615181736-38121211915-1681010810101223-231610121215812222013121113111112123515916122526191211131211912121011113012132413101020151913241712152412231810141791211
McCoy1324141011-14121212131330189-1011112515193015-16-17-17111219-241515181736-37121212915-1681010810101222-231610121215811221913121113111112123315916122626221211131211912121011113012122413101020151913241712162412241810141791111

Age Analysis Information (work in progress)

AllMcDonaldYFull
Kit: B19551038493274814287550118
Kit: B1955943347376239527527439
Used in age calculations1038493276239527550118
Counts of SNPs00
Variant counts last updated 2019-10-11 02:49:05.



Big Tree Main Page