Tree Position

R-P312/S116 > Z290 > L21/S145 > S552 > DF13 > Z39589 > CTS1751 > BY101020 > FT287884

Unique Mutations

The mutations unique to this man are summarized in the table below. Those with a '+' or '*' confidence level are considered by FamilyTreeDNA or FullGenomesCorp to be high quality SNPs/INDELs. For completeness, all other mutations of lesser confidence are included as well. These additional mutations may be useful for distinguishing between very closely related men.

Occasionally, some of the mutations listed here will be thought to be shared with other men in which case they might appear in upstream blocks on the tree. When this happens, the 'Blocks' field will indicate what block they appear in. Such a situation might arise with BigY men if the BED data suggests another man may be positive for a SNP, even though it doesn't appear in his VCF data. It might also happen if Chromo2 testing or Sanger sequencing of other men not on the tree show the SNP to be shared.

POS-REF-ALT (hg19) POS-REF-ALT (hg38) Blocks Names Region McDonald BED combBED STRKane-BY3
964752
22458513-C-G 20296627-C-G Z16343Z16356 DYZ19 +
13461150-A-T 11305474-A-T +
8591745-C-T 8723704-C-T FT236221 YY+
10018129-TTTTA-T 10180520-TTTTA-T 5×TTTA+
15683008-C-T 13571128-C-T FT329706 Y+
22458531-G-A 20296645-G-A S8368ZS1146 DYZ19 +
22440742-T-G 20278856-T-G Y82427BY36260 DYZ19 +
8069990-G-A 8201949-G-A A18621 YY+
11648129-C-T +
8282391-A-T 8414350-A-T FTB59732 YY+
21853677-C-CA 19691791-C-CA 43×A+
18724886-G-T 16613006-G-T YY11×T+
18892266-ATTTTATTTTATTTAT-A 16780386-ATTTTATTTTATTTAT-A +
5550280-G-GTTTTT 5682239-G-GTTTTT 39×T+
5505962-A-AT 5637921-A-AT 53×T+
3196057-T-G 3328016-T-G +
3825299-C-G 3957258-C-G +
3902974-A-T 4034933-A-T +
5249323-A-G 5381282-A-G +
5332043-A-G 5464002-A-G +
5724836-T-A 5856795-T-A +
5742331-CA-C 5874290-CA-C +
6052230-GAATA-G 6184189-GAATA-G +
7065826-G-A 7197785-G-A YY+
7325047-T-C 7457006-T-C YY+
7360065-A-G 7492024-A-G YY+
8068436-C-A 8200395-C-A YY+
8331951-G-A 8463910-G-A YY+
8833328-G-A 8965287-G-A YY+
9097832-CA-C 9260223-CA-C +
9417585-C-T 9579976-C-T YY+
9520082-T-A 9682473-T-A +
9610858-C-G 9773249-C-G IR3_Prx +
10005043-T-G 10167434-T-G Y+
13311312-G-T 11155636-G-T +
13431292-T-G 11275616-T-G +
13710990-T-A 11555314-T-A +
13726590-T-TATGGAATGGAATGGA 11570914-T-TATGGAATGGAATGGA +
14051904-G-T 11931198-G-T YY+
13197843-C-CAAAAAAAAAAAAAAAAA 42×A+
15608370-C-T 13496490-C-T YY+
16336687-G-A 14224807-G-A YY+
16661907-G-T 14550027-G-T YY+
16765130-A-T 14653250-A-T YY+
18095158-C-T 15983278-C-T YY+
19115595-G-A 17003715-G-A YY+
19555816-C-G 17443936-C-G Y+
20815371-C-T 18653485-C-T P4_Gap +
21113199-T-C 18951313-T-C YY+
21436873-A-G 19274987-A-G YY+
22048695-A-AAATAAT 19886809-A-AAATAAT 9×AAT+
22162360-C-A 20000474-C-A YY+
22226866-A-G 20064980-A-G DYZ19 +
22237564-C-T 20075678-C-T DYZ19 +
22238360-AGTG-A 20076474-AGTG-A DYZ19 +
22439000-G-T 20277114-G-T DYZ19 +
22458532-T-C 20296646-T-C DYZ19 +
22777164-G-C 20615278-G-C Y+
22900542-G-T 20738656-G-T YY+
24134633-G-A 21988486-G-A P3_b1 +
25505124-C-CT 23358977-C-CT P1_gr1 39×T+
27031713-A-T 24885566-A-T P1_r4 +
13493962-C-T 11338286-C-T *
28805503-A-G 26659356-A-G *
27967336-G-GTA 25821189-G-GTA P1_Y2 10×TA*
25815191-ATGTG-A 23669044-ATGTG-A P1_b3 13×TG*
58848158-C-CCCATT 56742662-C-CAATGG 10×CCATT*
5869966-G-GTTTTTTTTTT 6001925-G-GTTTTTTTTTT 15×T*
3933444-CAT-C 4065403-CAT-C *
28225636-A-AT 26079489-A-AT P1_b4 11×T*
9220009-C-G 9382400-C-G Y*
13699320-G-A 11543644-G-A FGC59460 *
18908110-G-GTA 16796230-G-GTA *
4474309-G-T 4606268-G-T *
9700317-GAAC-G 9862708-GAAC-G IR3_Prx 7×AAC*
5308807-G-T 5440766-G-T *
58884806-A-C 56706065-T-G *
27427095-A-AT 25280948-A-AT P1_g3 9×T*
5666004-T-C 5797963-T-C *
13512468-T-A 11356792-T-A *
8600247-GCA-G 8732206-GCA-G 8×CA*
13253782-A-G 11098106-A-G *
58848388-T-C 56742483-A-G *
13698960-C-G 11543284-C-G *
13726484-G-T 11570808-G-T *
3387992-C-T 3519951-C-T *
4403683-G-T 4535642-G-T *
4474293-C-G 4606252-C-G *
5995474-T-A 6127433-T-A *
6613151-C-G 6745110-C-G *
9931379-G-A 10093770-G-A Y*
9979125-T-A 10141516-T-A Y*
13242235-A-G 11086559-A-G *
13242372-G-C 11086696-G-C *
13252473-C-T 11096797-C-T *
13261276-T-G 11105600-T-G *
13261921-G-T 11106245-G-T *
13279495-C-G 11123819-C-G *
13295642-T-G 11139966-T-G *
13296715-A-G 11141039-A-G *
13392768-CA-C 11237092-CA-C 11×A*
13436262-G-T 11280586-G-T *
13438688-G-T 11283012-G-T *
13469780-A-C 11314104-A-C *
13478556-T-G 11322880-T-G *
13499210-A-G 11343534-A-G *
13500074-C-A 11344398-C-A *
13500077-C-G 11344401-C-G *
13571106-C-T 11415430-C-T *
13571109-A-C 11415433-A-C *
13578291-C-G 11422615-C-G *
13711998-G-A 11556322-G-A *
16344977-TTTC-T 14233097-TTTC-T 6×TTC*
16642608-C-T 14530728-C-T YY*
16642612-G-C 14530732-G-C YY*
22277104-G-A 20115218-G-A DYZ19 *
28709494-G-A 26563347-G-A *
59030975-G-T 56884828-G-T *
13464981-C-A 11309305-C-A *
15358761-G-GAAA 13246880-G-GAA 26×A*
3088643-AAG-A 3220602-AAG-A 8×AG*
9931347-C-T 10093738-C-T Y*
9931378-A-G 10093769-A-G Y*
13372815-C-T 11217139-C-T *
13403779-G-A 11248103-G-A *
13442158-C-G 11286482-C-G *
13449727-T-TAAACC 11294051-T-TAAACC *
13483767-C-A 11328091-C-A *
13512645-G-A 11356969-G-A *
13692043-A-C 11536367-A-C *
14678904-C-CTT 12566970-C-CTT 10×T*
21446240-TGAG-T 19284354-TGAG-T *
22509961-G-T 20348075-G-T DYZ19 *
23532864-TAC-T 21370978-TAC-T *
27127610-C-A 24981463-C-A Z37133 P1_g3 *
28790621-G-T 26644474-G-T *
28814364-A-G 26668217-A-G *
58855789-A-T 56735082-T-A *
58869353-T-C 56721518-A-G *
13733917-G-T 11578241-G-T *
15604354-CAAAAAA-C 13492474-CAAAAAA-C 20×A*
28802569-T-C 26656422-T-C *
13733916-C-T 11578240-C-T *
59026969-T-TTA 56880822-T-TTA *
58854810-T-G 56736061-A-C *
9958747-T-G 10121138-T-G Y*
26100509-G-GTTT 23954362-G-GTTT P1_Y1 35×T*
58885197-A-G 56705674-T-C *
8426377-G-GCTT,GCTTCTT 8558336-G-GCTT,GCTTCTT 22×CTT*
15658259-T-TAC 13546379-T-TAC 11×AC*
13478262-G-A 11322586-G-A *
9958755-A-T 10121146-A-T Y*
9958762-C-CCA 10121153-C-CCA *
5308809-G-T 5440768-G-T *
22467292-G-C 20305406-G-C DYZ19 *
27523621-G-GT 25377474-G-GT P1_Y2 10×T*
13692566-A-G 11536890-A-G *
13254611-T-TGTGTG 11098935-T-TGTGTG *
58860279-C-T 56730592-G-A *
58884206-T-C 56706665-A-G *
13261301-C-A 11105625-C-A *
59000268-G-GA 56854121-G-GA 8×A*
13478412-C-T 11322736-C-T *
5433983-G-GTA 5565942-G-GTA 10×TA*
27482837-AT-A 25336690-AT-A P1_Y2 16×T*
58914478-C-T 56676393-G-A *
17193767-TACAC-T,TAC 15081887-TACAC-T,TAC 13×AC*
9182140-C-T 9344531-C-T Y*
58904837-G-A 56686034-C-T *
13474053-A-T 11318377-A-T *
22317197-T-A 20155311-T-A DYZ19 *
22317201-C-A 20155315-C-A DYZ19 *
5035558-TTG-T,TTGTGTGTG 5167517-TTG-T,TTGTGTGTG 22×TG*
2707575-G-GA 2839534-G-GA 10×A*
9979150-A-G 10141541-A-G Y*
13479282-C-T 11323606-C-T BY86027 *
13489192-G-T 11333516-G-T *
7100954-C-CTT 7232913-C-CTT 32×T*
10964927-A-C *
17150717-G-GA 15038837-G-GA F9497 9×A*
23435682-CTTT-C,CTT 21273796-CTTT-C,CTT 21×T*
15336019-C-CA 13224137-C-CA 30×A*
10662211-C-G *
13697328-G-C 11541652-G-C *
13462033-C-T 11306357-C-T *
15449890-T-A 13338010-T-A YY*
14492793-CTTT-C 12380990-CTTT-C 15×T*
13468125-C-T 11312449-C-T *
13696944-G-A 11541268-G-A *
5999363-C-CAA 6131322-C-CAA 20×A*
9870579-GA-G 10032970-GA-G 9×A*
8075936-CTTTTT-C 8207895-CTTTTT-C 17×T*
10959615-T-A *
56706612-TGTCATGGGATGGC-T *
21922080-C-CAA 19760194-C-CAA 23×A*
13488839-CGGTTG-C 11333163-CGGTTG-C *
10783038-T-C *
13483673-C-A 11327997-C-A *
14009385-C-G 11888679-C-G YY*
13463778-G-C 11308102-G-C *
13489433-G-A 11333757-G-A *
22489679-G-T 20327793-G-T DYZ19 *
13512418-C-T 11356742-C-T *
9931316-T-C 10093707-T-C Y*
13478349-G-T 11322673-G-T *
13487603-G-A 11331927-G-A *
13691651-A-T 11535975-A-T *
13721720-T-A 11566044-T-A *
14009369-C-G 11888663-C-G YY*
10998402-T-A *
4834245-T-TA,TAA 4966204-T-TA,TAA 23×A*
58884103-C-T 56706768-G-A *
8760517-CT-C,CTT 8892476-CT-C,CTT 20×T*
8599992-G-GTT 8731951-G-GTT 16×T*
14195817-C-CAA 12075111-C-CAA 14×A*
58884147-C-A 56706724-G-T *
8214860-G-GTTT 8346819-G-GTTT 21×T*
13464508-T-G 11308832-T-G *
16692755-TG-T 14580875-TG-T *
13489354-G-A 11333678-G-A *
13463677-C-A 11308001-C-A *
5096105-CT-C 5228064-CT-C 9×T*
13489345-G-T 11333669-G-T *
13354869-A-AC 11199193-A-AC *
26971341-T-TA 24825194-T-TA P1_r4 10×A*
13468031-A-G 11312355-A-G *
13252914-T-C 11097238-T-C *
13252928-A-G 11097252-A-G *
13252933-G-A 11097257-G-A *
17046715-GTT-G,GT 14934835-GTT-G,GT 25×T*
10998388-T-C *
13393480-C-A 11237804-C-A *
8431228-CT-C,CTT 8563187-CT-C,CTT 17×T*
13521917-A-AT 11366241-A-AT 10×T*
10672210-TCTCCA-T *
17060348-AT-A 14948468-AT-A 9×T*
56678188-G-A *
5662080-T-C 5794039-T-C FGC47786 *
13705858-G-A 11550182-G-A FT449117 *
13489435-C-A 11333759-C-A *
13469356-G-A 11313680-G-A BY153336 *
13641089-A-G 11485413-A-G *
6183212-G-T 6315171-G-T IR3_Dst 20×CA*
21435190-C-CTT 19273304-C-CTT 15×T*
13252918-G-A 11097242-G-A *
13252930-A-G 11097254-A-G *
17074613-A-C 14962733-A-C YY*
13462150-T-C 11306474-T-C *
17963663-GT-G 15851783-GT-G 9×T*
13464394-T-G 11308718-T-G *
13464480-G-A 11308804-G-A *
13466446-T-G 11310770-T-G *
13478807-C-A 11323131-C-A *
13485547-TC-T 11329871-TC-T *
13721616-C-T 11565940-C-T 4×ATGGA*
13721639-G-A 11565963-G-A *
13721649-G-A 11565973-G-A *
10968423-T-A *
10968437-T-G *
10968438-C-A *
13489200-G-T 11333524-G-T *
13469684-G-A 11314008-G-A BY210308 *
9964027-C-A 10126418-C-A Y*
13478849-CACGAA-C 11323173-CACGAA-C *
13488957-G-GTT 11333281-G-GTT *
26593442-C-CT 24447295-C-CT P1_g2 11×T*
19064934-CA-C 16953054-CA-C 8×A*
6398637-AACAC-A,AAC 6530596-AACAC-A,AAC 23×AC*
13195149-T-G 11039473-T-G *
13195150-T-C 11039474-T-C *
13442777-G-A 11287101-G-A *
13504123-A-G 11348447-A-G *
13532685-A-G 11377009-A-G *
13539154-G-A 11383478-G-A *
13578321-C-T 11422645-C-T *
28807429-T-A 26661282-T-A *
28814077-A-G 26667930-A-G *
56749913-G-A *
9980743-G-A 10143134-G-A Y*
13242026-C-T 11086350-C-T *
13242027-A-G 11086351-A-G *
13439700-G-T 11284024-G-T *
13464809-T-C 11309133-T-C *
13512434-T-C 11356758-T-C *
13529041-C-T 11373365-C-T *
13705873-C-T 11550197-C-T *
13705874-G-T 11550198-G-T *
25443006-A-AT 23296859-A-AT P2_r2 9×T*
13206784-C-CA,CAAA 11051108-C-CA,CAAA 14×A*
13374277-GAA-G 11218601-GAA-G 13×A*
9951677-A-C 10114068-A-C Y*
13565515-T-G 11409839-T-G *
13586645-T-C 11430969-T-C *
19231319-CT-C,CTT 17119439-CT-C,CTT 24×T*
56859432-A-C *
7608436-CCTCTCT-C,CCT 7740395-CCTCTCT-C,CCT 15×CT*
4686573-CAA-C,CA 4818532-CAA-C,CA 15×A*
17669700-CAT-C,CATAT 15557820-CAT-C,CATAT 15×AT*
13583716-C-T 11428040-C-T *
13461900-C-G 11306224-C-G *
56878290-C-A *
22345461-G-T 20183575-G-T DYZ19 *
19791198-G-A 17679318-G-A P5_Prx *
22508652-T-C 20346766-T-C DYZ19 *
28747705-AT-A,ATT 26601558-AT-A,ATT 27×T*
13242234-C-T 11086558-C-T *
5773410-A-AT 5905369-A-AT 10×T*
4417119-A-AT 4549078-A-AT *
5425651-C-A 5557610-C-A *
13475850-AG-A 11320174-AG-A *
13512529-C-CTA 11356853-C-CTA *
20815408-CATAT-C,CAT 18653522-CATAT-C,CAT P4_Gap 22×AT*
13469153-A-T 11313477-A-T *
56707471-A-C *
56706778-G-A *
56760215-A-G *
13400517-T-C 11244841-T-C *
13464746-G-T 11309070-G-T *
22510656-A-T 20348770-A-T DYZ19 *
13476614-G-A 11320938-G-A *
13489383-CG-C 11333707-CG-C *
16458192-T-C 14346312-T-C YY*
13535164-C-A 11379488-C-A *
13535167-T-C 11379491-T-C *
13476518-G-A 11320842-G-A *
7524670-C-A 7656629-C-A YY*
8648172-G-GAT,GATAT 8780131-G-GAT,GATAT 14×AT*
6013639-A-ATT 6145598-A-ATT 11×T*
13479248-C-T 11323572-C-T *
13461920-C-T 11306244-C-T *
15865946-CTTTTTTTTTTTTTTTTT-C,CT 13754066-CTTTTTTTTTTTTTTTTT-C,CT 37×T*
13241986-G-A 11086310-G-A *
13469709-T-A 11314033-T-A *
4964729-A-AT 5096688-A-AT 34×T*
13488958-G-C 11333282-G-C *
13400547-C-A 11244871-C-A *
13400548-A-T 11244872-A-T *
13723163-G-C 11567487-G-C *
13723165-A-C 11567489-A-C *
13468464-C-T 11312788-C-T *
13468474-G-T 11312798-G-T *
13469160-T-A 11313484-T-A *
13479141-G-A 11323465-G-A *
13489591-C-A 11333915-C-A *
13711745-AATGGAACGGAATGGAATTAAATGGAACGGAATGGAATGGC-A 11556069-AATGGAACGGAATGGAATTAAATGGAACGGAATGGAATGGC-A *
16809372-TGATAGATA-T,TGATA 14697492-TGATAGATA-T,TGATA 11×GATA*
13469381-G-T 11313705-G-T *
13478856-CG-C 11323180-CG-C *
16642622-T-TTC 14530742-T-TTC *
16642623-GGC-G 14530743-GGC-G *
56830616-A-C *
13278718-A-AC 11123042-A-AC *
13278724-A-AT 11123048-A-AT *
13404483-C-T 11248807-C-T *
13404503-T-A 11248827-T-A *
13462081-C-A 11306405-C-A *
13462097-C-A 11306421-C-A *
13462105-A-C 11306429-A-C *
13462116-CAA-C 11306440-CAA-C *
13462119-C-CTG 11306443-C-CTG *
13462345-ATC-A 11306669-ATC-A *
13464503-C-A 11308827-C-A *
13464522-T-TAAGG 11308846-T-TAAGG *
13464680-T-C 11309004-T-C *
13464700-A-C 11309024-A-C *
13512540-T-TCTAC 11356864-T-TCTAC *
13512543-C-CTATATT 11356867-C-CTATATT *
6402017-A-ATGATGT 6533976-A-ATGATGT *
9980251-G-A 10142642-G-A FT462866 Y*
9980252-C-T 10142643-C-T BY82375 Y*
10662209-T-C *
13353803-T-C 11198127-T-C *
13462123-G-C 11306447-G-C FT443916 *
22509137-G-C 20347251-G-C DYZ19 *
28807436-G-A 26661289-G-A *
28807437-A-T 26661290-A-T *
3387981-C-T 3519940-C-T *
13462128-A-C 11306452-A-C *
13462129-G-T 11306453-G-T *
11015016-A-AAT *
11015018-TCC-T *
11015022-TTCCAC-T *
13257709-G-A 11102033-G-A *
56827687-T-C,TGCCATCCGATTGCATGCCATCCGATTGCATGCCATCCGATTC *
14565425-T-C 12453625-T-C Y*
28539174-CAA-C,CA 26393027-CAA-C,CA 20×A*
13461959-C-T 11306283-C-T *
13734896-G-A 11579220-G-A *
13267613-A-AAAAAAAG 11111937-A-AAAAAAAG *
13461937-G-C 11306261-G-C *
13462076-G-C 11306400-G-C *
13462079-T-A 11306403-T-A *
13478347-C-T 11322671-C-T *
13723175-G-A 11567499-G-A *
25173412-AT-A 23027265-AT-A g1 9×T*
28803142-G-A 26656995-G-A *
13436098-A-T 11280422-A-T *
13463580-C-T 11307904-C-T *
13470134-C-G 11314458-C-G *
13470136-A-C 11314460-A-C *
13470182-C-A 11314506-C-A *
13476579-G-C 11320903-G-C *
13476594-T-A 11320918-T-A *
13563544-G-T 11407868-G-T *
13734128-AATGGAACGGAATTGAATGTC-A 11578452-AATGGAACGGAATTGAATGTC-A *
56756517-T-A *
56834489-A-C *
13476783-A-G 11321107-A-G *
13476796-C-A 11321120-C-A *
13476827-C-A 11321151-C-A *
13476834-G-C 11321158-G-C *
13476847-G-T 11321171-G-T *
9986775-GAAGT-G 10149166-GAAGT-G *
9986788-C-T 10149179-C-T Y*
9986789-A-G 10149180-A-G Y*
11014999-C-CCAAAG *
13347136-T-C 11191460-T-C *
13470152-TCC-T 11314476-TCC-T *
13691798-T-TATGGA,TGGA 11536122-T-TATGGA,TGGA *
13726488-A-AGG 11570812-A-AGG *
22436456-GCAGGTTCATGGGCTTGCTCACTT-G 20274570-GCAGGTTCATGGGCTTGCTCACTT-G DYZ19 *
22436483-GAATGAAGCTGCAGACCTTTACGGTGAGTGTTACAGCACTTAAAGGTGTTATGTCCAGAGTTTGTTCCTTCAGATGTGTCCAGAGTTTCTTCCTTCTGGCAGT-G 20274597-GAATGAAGCTGCAGACCTTTACGGTGAGTGTTACAGCACTTAAAGGTGTTATGTCCAGAGTTTGTTCCTTCAGATGTGTCCAGAGTTTCTTCCTTCTGGCAGT-G DYZ19 *
28588195-G-GATGT 26442048-G-GATGT *
2933053-GTGTTTTCTTTTGTTTTGTTC-G 3065012-GTGTTTTCTTTTGTTTTGTTC-G *
10678044-C-CCATTCCATTCCATTCCAT *
7567753-CT-C,CTT 7699712-CT-C,CTT 25×T*
13512405-A-AG 11356729-A-AG *
28805498-G-GCTT 26659351-G-GCTT *
28805499-G-GGA 26659352-G-GGA *
9980754-AGGAAGGAAGGGGACAAAGAAAGAG-A 10143145-AGGAAGGAAGGGGACAAAGAAAGAG-A *
9980795-T-C 10143186-T-C Y*
9980800-T-C 10143191-T-C Y*
9984507-C-G 10146898-C-G Y*
13239912-T-C 11084236-T-C *
13239914-G-A 11084238-G-A *
13395422-T-C 11239746-T-C *
13461990-G-T 11306314-G-T *
13478650-C-A 11322974-C-A BY86006 *
13565519-A-G 11409843-A-G *
13705871-C-T 11550195-C-T *
56760263-G-C *
13283105-CT-C 11127429-CT-C *
13690756-C-G 11535080-C-G *
9227257-CTTG-C 9389648-CTTG-C *
13466424-GT-G 11310748-GT-G *
13730717-T-A 11575041-T-A *
13730728-G-A 11575052-G-A *
13488788-C-A 11333112-C-A *
56678219-G-A *
14565416-A-G 12453616-A-G Y*
9936659-A-G 10099050-A-G Y*
11306663-T- *
13478979-C-T 11323303-C-T *
3895611-C-T 4027570-C-T FT379725 *
13489454-G-T 11333778-G-T *
18760242-TTC-T,TTCTC 16648362-TTC-T,TTCTC 27×TC*
13478984-G-T 11323308-G-T *
56833506-T-TCC *
13465078-C-A 11309402-C-A *
13465085-G-A 11309409-G-A *
13479250-G-A 11323574-G-A *
13479285-A-T 11323609-A-T *
11550434-CATGGT- *
26663972-AAGTGGATTGGAGTGGAATGGAGTGCAATGGACTGGAGTGGATTGGAATGGAT- *
56863442-T-C *
13489311-G-A 11333635-G-A *
13699187-C-G 11543511-C-G *
13489473-CCT-C 11333797-CCT-C *
13730729-G-C 11575053-G-C *
20197726-G- DYZ19 *
13499059-G-A 11343383-G-A *
10022452-C-G 10184843-C-G Y*
11306581-C- *
11556892-A- *
13489626-CCA-C 11333950-CCA-C *
13463686-A-C 11308010-A-C *
13463692-C-A 11308016-C-A *
13463697-G-C 11308021-G-C *
13463746-G-C 11308070-G-C *
11321185-GC- *
13478525-G-A 11322849-G-A *
56706628-CAA- *
11308851-T- *
28814090-T-A 26667943-T-A *
28814093-T-A 26667946-T-A BY26686 *
28814099-T-A 26667952-T-A FT462712 *
13478482-G-C 11322806-G-C *
13478485-C-G 11322809-C-G *
56756756-A-G *
9885635-TC-T 10048026-TC-T 9×C*
3895609-T-C 4027568-T-C *
10041915-T-A 10204306-T-A *
11021497-CACTCCTCCCT-C *
11314478-CCAG- *
13470156-A-T 11314480-A-T *
18401199-CA-C,CAA 16289319-CA-C,CAA P6_Gap 30×A*
19492290-C-CAAAAAAAAAA 17380410-C-CAAAAAAAAAA 37×A*
13489476-G-GCA 11333800-G-GCA *
23759113-TA-T,TAA 21597227-TA-T,TAA 24×A*
7166638-A-AT 7298597-A-AT *
13360479-C-A 11204803-C-A *
13360502-C-T 11204826-C-T *
13451191-T-TCCATTCCATTCCACTGCATTCCACTCCACTC 11295515-T-TCCATTCCATTCCACTGCATTCCACTCCACTC *
13484530-T-TG 11328854-T-TG *
13489287-G-T 11333611-G-T *
56832960-C-CCACTCCA,CCTCCA *
13470498-G-A 11314822-G-A *
13476531-TCA-T 11320855-TCA-T *
21085779-CA-C,CAAA 18923893-CA-C,CAAA 24×A*
13463727-C-CG 11308051-C-CG *
13463788-T-A 11308112-T-A *
13463791-G-A 11308115-G-A *
13463800-G-C 11308124-G-C *
13488479-C-CATAG 11332803-C-CATAG *
13488483-GTC-G 11332807-GTC-G *
13488487-GGC-G 11332811-GGC-G *
19393098-C-CTTTT 17281218-C-CTTTT 30×T*
13438649-C-A 11282973-C-A *
56878705-G-T *
56878706-C-G *
25651211-AG-A 23505064-AG-A P1_b3 *
25651215-A-T 23505068-A-T P1_b3 *
3838601-C-CTTTT 3970560-C-CTTTT 31×T*
13730055-G-A 11574379-G-A *
13730059-T-G 11574383-T-G *
13464972-A-T 11309296-A-T *
22489720-T-G 20327834-T-G DYZ19 *
13489441-A-C 11333765-A-C *
23120561-A-ATT 20958675-A-ATT 11×T*
13470109-CAA-C 11314433-CAA-C *
13462067-A-C 11306391-A-C *
13478806-T-C 11323130-T-C *
13469690-A-G 11314014-A-G *
13489326-T-C 11333650-T-C *
10693228-A- *
8644324-C-CAA,CAA 8776283-C-CAA,CAA 32×A*
56825936-ATTCCATTCAATTGCATTCCATTAGATTGC-A *
3561528-T-TA,TA 3693487-T-TA,TA *
13438225-G-C 11282549-G-C *
4662199-GT-G,G 4794158-GT-G,G 10×T*
13484171-CAG-C 11328495-CAG-C *
16535053-CT-C,CTTT 14423173-CT-C,CTTT 35×T*
9936527-C-T 10098918-C-T Y*
56856795-T-TATATTAAAATTTCA *
56832931-T-TCCTCTGCACTCCAC *
28814012-G-T 26667865-G-T *
28814036-G-T 26667889-G-T *
28814037-G-C 26667890-G-C *
28814072-G-GCTT 26667925-G-GCTT *
13730065-G-A 11574389-G-A *
11021346-CCTCTCT-C *
11021353-ACTGC-A *
10679708-T-TCAGAAGATCTCACTCTGTCACTCAGGTTGGAGTGCAGTCGCATAATCTCAGCTCACATTACATTTCAGGATTG *
13468384-G-GTAAT,T 11312708-G-GTAAT,T *
3039839-C-CTTT 3171798-C-CTTT 22×T*
3181857-C-CAAA 3313816-C-CAAA 20×A*
3462770-T-C 3594729-T-C *
3604621-T-TTTAA,TTTAA 3736580-T-TTTAA,TTTAA 12×TAA*
3738632-T- *
3822962-G-GATAT,GATAT 3954921-G-GATAT,GATAT 26×AT*
4336695-ATTT-A,ATTTTTT 4468654-ATTT-A,ATTTTTT 30×T*
4422690-G-A 4554649-G-A *
4446634-G-T 4578593-G-T *
4474341-T-C 4606300-T-C *
4619776-A- *
5009118-A-C 5141077-A-C *
5138564-AG-A 5270523-AG-A *
5261698-C-CAAAAAAA 5393657-C-CAAAAAAA 48×A*
5270693-CTTTTTT-C,CTTTTT 5402652-CTTTTTT-C,CTTTTT 22×T*
5425093-AT-A 5557052-AT-A 8×T*
5489574-T-TAA 5621533-T-TAA 10×A*
6121411-TG-T 6253370-TG-T *
6121412-G-T 6253371-G-T *
6336354-G-T 6468313-G-T IR3_Dst *
6347741-A-AGAAAGAAGGAAG,AGAAGGAAGGAAG 6479700-A-AGAAAGAAGGAAG,AGAAGGAAGGAAG 9×GAAG*
6347814-G-GAGAA,GAGAA 6479773-G-GAGAA,GAGAA 12×AGAA*
6468917-A-C 6600876-A-C *
6799038-A-T 6930997-A-T Y*
6929890-G-GCCCCCCCCCCC 7061849-G-GCCCCCCCCCCC *
7137221-ACACACACACACGCGCACACACATATATACACATAAATACGCGCACGTGCGCACGCG-A 7269180-ACACACACACACGCGCACACACATATATACACATAAATACGCGCACGTGCGCACGCG-A *
7166640-A-ATT,T 7298599-A-ATT,T 12×T*
7390356-GA-G 7522315-GA-G 9×A*
7534406-G-GTTTTTTTTTTTTTTTTTTTTTTTT 7666365-G-GTTTTTTTTTTTTTTTTTTTTTTTT 19×T*
7646431-T-A 7778390-T-A YY*
7939472-TA-T,TAAA 8071431-TA-T,TAAA 35×A*
7939516-T-A 8071475-T-A YY*
7939518-T-A 8071477-T-A YY*
8581638-A- *
8493440-C-A 8625399-C-A YY*
8524404-G-T 8656363-G-T YY*
8669626-G-GTGCCC 8801585-G-GTGCCC *
8669627-A-C 8801586-A-C Y*
8669637-CTG-C 8801596-CTG-C *
8669643-A-C 8801602-A-C Y*
9304459-G-GGGGGGGGGGGGGGGGGGGGGCCC 9466850-G-GGGGGGGGGGGGGGGGGGGGGCCC *
9330869-C-CAT 9493260-C-CAT *
9524289-C-CTATA 9686680-C-CTATA 8×TA*
9741354-TACAC-T,TAC 9903745-TACAC-T,TAC IR3_Prx 16×AC*
9999280-T- *
9839568-A-AAAAC 10001959-A-AAAAC *
9917883-A-G 10080274-A-G Y*
9917926-ATG-A 10080317-ATG-A *
9948486-A-G 10110877-A-G Y*
9949641-T-G 10112032-T-G Y*
10154558-C- *
10759549-A-G *
10789000-C-T *
10826459-T-C *
10850851-A-T *
10878273-C-G *
10959605-A-T *
10968445-A-T *
10996530-T-C *
10998394-T-C *
11030984-C-T *
13195193-T-G 11039517-T-G *
13242167-C-G 11086491-C-G *
13242184-C-T 11086508-C-T *
13257605-G-A 11101929-G-A *
13443192-A-C 11287516-A-C *
13449753-C-CCATT 11294077-C-CCATT *
13449755-A-AG 11294079-A-AG *
13450015-G-C 11294339-G-C *
13462146-A-AC 11306470-A-AC *
13463787-C-T 11308111-C-T *
13463981-A-C 11308305-A-C *
13464380-C-A 11308704-C-A *
13464384-C-A 11308708-C-A *
13464390-GC-G 11308714-GC-G *
13464393-C-CCCCG 11308717-C-CCCCG *
13464400-G-GAA 11308724-G-GAA *
13464402-GGAACA-G 11308726-GGAACA-G *
11308727-G- *
11308730-C- *
11308731-A- *
13465042-G-T 11309366-G-T *
13466302-T-G,G 11310626-T-G,G *
13468118-G-A 11312442-G-A *
13469162-A-G 11313486-A-G *
13472263-GA-G 11316587-GA-G *
13472265-GA-G 11316589-GA-G *
13476487-A-T 11320811-A-T *
13476700-G-T 11321024-G-T *
13476701-G-T 11321025-G-T *
13476896-C-A 11321220-C-A *
13478504-A-C 11322828-A-C *
13478513-T-A 11322837-T-A *
13478529-C-T 11322853-C-T *
13478825-C-CCT 11323149-C-CCT *
13478828-A-C 11323152-A-C *
13478831-CCA-C 11323155-CCA-C *
13478843-C-G 11323167-C-G *
13478862-C-CT 11323186-C-CT *
13478863-G-GAC 11323187-G-GAC *
13478866-A-AT 11323190-A-AT *
13478870-C-CA 11323194-C-CA *
13478871-C-CT 11323195-C-CT *
13481870-C-G 11326194-C-G *
13483395-A-G 11327719-A-G *
13485094-A-G 11329418-A-G *
13485907-C-A 11330231-C-A *
13488830-A-ATGGAATGC 11333154-A-ATGGAATGC *
13488833-GCCT-G 11333157-GCCT-G *
11333158-C- *
11333159-C- *
13489365-T-TCCCC 11333689-T-TCCCC *
11333708-G- *
13489449-G-A 11333773-G-A *
13489607-G-GGC 11333931-G-GGC *
13489610-TG-T 11333934-TG-T *
13489616-C-CA 11333940-C-CA *
13489821-G-C 11334145-G-C *
13489858-C-A 11334182-C-A *
13489861-G-A 11334185-G-A *
13489871-C-G 11334195-C-G *
13489880-C-A 11334204-C-A *
13500146-G-C 11344470-G-C *
13501851-C-CT 11346175-C-CT 10×T*
13585072-A-T 11429396-A-T *
13692967-ATGT-A 11537291-ATGT-A *
13692971-AAT-A 11537295-AAT-A *
13692983-TA-T 11537307-TA-T *
13692987-AAG-A 11537311-AAG-A *
13692989-G-GCTC 11537313-G-GCTC *
13693000-G-T 11537324-G-T *
13704540-A-G 11548864-A-G *
13707332-C-T 11551656-C-T *
13730013-CA-C 11574337-CA-C *
13730020-G-A 11574344-G-A *
13730038-T-G 11574362-T-G *
13730050-G-A 11574374-G-A *
13737469-G-T 11581793-G-T *
11649663-G-GAATGGAATGGAATGA *
14143412-G-GA,GA 12022706-G-GA,GA 12×A*
14565432-A-C 12453632-A-C Y*
14613459-CT-C,CTTTTTTTT 12501657-CT-C,CTTTTTTTT 26×T*
14712251-C-T 12600318-C-T Y*
15179010-CAAA-C,CAAAA 13067096-CAAA-C,CAAAA 25×A*
15428893-AT-A 13317013-AT-A 9×T*
15906282-T-G 13794402-T-G YY*
16458187-T-G 14346307-T-G YY*
16505988-CT-C,CTT 14394108-CT-C,CTT 31×T*
16692758-A-T 14580878-A-T YY*
16834746-C-CAA,CAA 14722866-C-CAA,CAA 45×A*
17090839-ATT-A,ATTT 14978959-ATT-A,ATTT 29×T*
17802166-TAA-T,TAAA 15690286-TAA-T,TAAA 30×A*
18060263-TATATATATGTACATGTGTATATATATGTACATATATATGTACATATATATATGTACATATATATGTACATATATATATGTAC-T 15948383-TATATATATGTACATGTGTATATATATGTACATATATATGTACATATATATATGTACATATATATGTACATATATATATGTAC-T *
18612759-G-GTATATA,GTATATATA 16500879-G-GTATATA,GTATATATA 15×TA*
18724881-A-AT 16613001-A-AT *
16937050-A- *
19059774-A-G 16947894-A-G YY*
19113723-TAAA-T,TAA 17001843-TAAA-T,TAA 28×A*
19130738-C-CT,CT 17018858-C-CT,CT 33×T*
19293770-CAA-C,CAAAAA 17181890-CAA-C,CAAAAA 29×A*
17357967-C- *
19500653-A-AAGAC,C 17388773-A-AAGAC,C *
20352673-CT-C 18190787-CT-C P5_Dst 10×T*
20842366-AAAC-A 18680480-AAAC-A P4_Dst *
20865390-A-ACAC 18703504-A-ACAC P4_Dst *
20957689-CT-C 18795803-CT-C P4_Dst 8×T*
21197670-G-A 19035784-G-A Y*
21438785-TA-T,TAA 19276899-TA-T,TAA 31×A*
21446243-G-GTTTT 19284357-G-GTTTT *
21569958-TA-AA,T 19408072-TA-AA,T 46×A*
21807058-C-T 19645172-C-T YY*
22012826-A-T 19850940-A-T Y*
22027761-A-G 19865875-A-G YY*
22238364-AGCAAGACCATGAACCTGCCAGAAGGAAGAAACTCTGAACACATCTGAAGGAACAAACTCTGGACATAACACCTTTAAGTGCTATGACACTCACCGTAAAGTTCTGCAGCTTCATTCTTGAAG-A 20076478-AGCAAGACCATGAACCTGCCAGAAGGAAGAAACTCTGAACACATCTGAAGGAACAAACTCTGGACATAACACCTTTAAGTGCTATGACACTCACCGTAAAGTTCTGCAGCTTCATTCTTGAAG-A DYZ19 *
22281750-G-C 20119864-G-C DYZ19 *
22281758-A-T 20119872-A-T DYZ19 *
22288699-G-T 20126813-G-T DYZ19 *
22288985-A-C 20127099-A-C DYZ19 *
22288986-A-C 20127100-A-C DYZ19 *
22288990-G-GT 20127104-G-GT DYZ19 *
22317184-A-C 20155298-A-C DYZ19 *
22317190-T-G 20155304-T-G DYZ19 *
22318687-C-A 20156801-C-A DYZ19 *
22325148-T-A 20163262-T-A DYZ19 *
20163497-GCTCACTTCAAGAATGAAGCTGCAGAATTTAGTGGTGAGCGTTACAGCACTTAAGTTTTTATGTCCAGAGTTTGTTCCTTCAGATAAGTCTAGAGATTCTTCCTTCTGGCAGGTCCATGGTCTTC- DYZ19 *
22328739-G-A 20166853-G-A DYZ19 *
22423245-G-C 20261359-G-C DYZ19 *
22440020-G-A 20278134-G-A DYZ19 *
22448736-T-C 20286850-T-C DYZ19 *
22472829-GTGTTATGTCCAGAGTTTGTTCCTGCAGAAATATCCAGAATTTCTTCCTTCTGGCAGGTTTATGGTCTTGCTCACTTTAAGAATGAAGCTGCAGACCTTACTAGTGAGTGTTACAGCAGTTAAAGT-G 20310943-GTGTTATGTCCAGAGTTTGTTCCTGCAGAAATATCCAGAATTTCTTCCTTCTGGCAGGTTTATGGTCTTGCTCACTTTAAGAATGAAGCTGCAGACCTTACTAGTGAGTGTTACAGCAGTTAAAGT-G DYZ19 *
22483784-T-A 20321898-T-A DYZ19 *
22714086-A-G 20552200-A-G Y*
22739716-CAA-C,CAAA 20577830-CAA-C,CAAA 24×A*
22755755-GA-G 20593869-GA-G 8×A*
22782038-TA-T 20620152-TA-T *
22936288-CT-C,CTTTTTT 20774402-CT-C,CTTTTTT 25×T*
23181452-C-CA 21019566-C-CA *
23181453-C-A,CAA 21019567-C-A,CAA 34×A*
23415339-TA-T 21253453-TA-T *
23476017-TGTTG-T 21314131-TGTTG-T *
23476025-TTTTTTTG-T 21314139-TTTTTTTG-T *
23825064-A-AT,ATT 21663178-A-AT,ATT 25×T*
24108899-C-A 21962752-C-A P3_b1 *
25096448-G-GGAAAGAAA,GGAAAGAAAGAAA 22950301-G-GGAAAGAAA,GGAAAGAAAGAAA g1 20×GAAA*
25997941-TA-T 23851794-TA-T P1_Y1 9×A*
26416278-AAAAAAAAAAAAAAAAAAAAAG-A 24270131-AAAAAAAAAAAAAAAAAAAAAG-A P1_Y1 *
26455900-CTTTT-C 24309753-CTTTT-C P1_Y1 22×T*
26479590-CA-C,CAA 24333443-CA-C,CAA P1_Y1 16×A*
27547266-AT-A 25401119-AT-A P1_Y2 9×T*
28370013-T-G,TAG 26223866-T-G,TAG P1_gr2 *
28488383-C-T 26342236-C-T *
28544269-T-G 26398122-T-G *
26445859-GTGT- *
28678185-A-T 26532038-A-T *
28720132-C-CT,CT 26573985-C-CT,CT 24×T*
28788560-TGGAGGGGAATGGATTGGAATGAAATGGGTTGGAAAGGAATCGAACGGACTGGAGTGGATTGAACTGGAGTGGAGTGGAATGGGACGGAGTGGAAAGTAGTGGAGTGGAGTGGATTGGTGTGGAATGCAGTGGAGTGGAGTGGAGC-T 26642413-TGGAGGGGAATGGATTGGAATGAAATGGGTTGGAAAGGAATCGAACGGACTGGAGTGGATTGAACTGGAGTGGAGTGGAATGGGACGGAGTGGAAAGTAGTGGAGTGGAGTGGATTGGTGTGGAATGCAGTGGAGTGGAGTGGAGC-T *
28818206-G-GTAAT 26672059-G-GTAAT *
28818207-G-GT 26672060-G-GT *
56721201-CAATGGAATGGAATGGAATGGAATGG-C 11×AATGG*
56724340-A-T *
56742641-GGAA-G *
56742645-TGG-T *
56752722-A-T *
56752726-C-T *
56757341-A-C *
56826707-A-T,T *
56831653-C-CCACTCCATCCCAT *
56834405-C-CTCCGT *
56834420-T-TCCTA *
56834423-CAT-C *
56834437-C-CAATTT *
56834505-CTCCATTCCTCTCCATTCCATTCCACTCCACTCCATTCCATACCAT-C *
56854226-T-G *
56856390-C-T *
56877090-T-A *
56878212-C-A *
56882996-C-A *
56883675-G-T *

In the table above, the meaning of the confidence field depends on whether the data comes from an FTDNA kit or an FGC kit. For FTDNA kits, + implies a "PASS" result with just one possible variant, * indicates a "PASS" but with multiple variants, ** indicates "REJECTED" with just a single variant, and *** indicates "REJECTED" with multiple possible variants. 'A*' are heterozygous variants not called by FTDNA, but still pulled from the VCF file. For FGC kits, + indicates over 99% likely genuine (95% for INDELs); * over 95% likely genuine (90% for INDELs); ** about 40% likely genuine; *** about 10% likely genuine. Manual entries read directly from a BAM file will be either + indicating positive, or * indicating that the data show a mixture of possible variants.

For the FTDNA kits, the BED data is encoded in the background color of the cells. Those cells with a white background have coverage, those with a grey background indicate no coverage in the BED file, and those with a pink background indicate the mutation is on the edge of a coverage region. These pink regions often indicate that the individual may be positive for a SNP even if there is no corresponding entry in the vcf file.

The combBED column indicates whether or not the mutation is a SNP and falls in the combBED region defined in Defining a New Rate Constant for Y-Chromosome SNPs based on Full Sequencing Data by Dmitry Adamov, Vladimir Guryanov, Sergey Karzhavin, Vladimir Tagankin, Vadim Urasin.

The McDonald BED column indicates whether or not the mutation is a SNP and falls in the BED region used by Dr. Iain McDonald in the age analysis he does for R-U106 men.