Tree Position

R-P312/S116 > Z290 > L21/S145 > S552 > DF13 > ZZ10 > Z253 > Z2534 > ZZ5 > Z2185 > BY44331 > Z2186 > L1066 > CTS9881 > Z18123 > CTS9251 > CTS4296 > Y8603 > A2072 > A2074 > A2073 > A2075

Unique Mutations

The mutations unique to this man are summarized in the table below. Those with a '+' or '*' confidence level are considered by FamilyTreeDNA or FullGenomesCorp to be high quality SNPs/INDELs. For completeness, all other mutations of lesser confidence are included as well. These additional mutations may be useful for distinguishing between very closely related men.

Occasionally, some of the mutations listed here will be thought to be shared with other men in which case they might appear in upstream blocks on the tree. When this happens, the 'Blocks' field will indicate what block they appear in. Such a situation might arise with BigY men if the BED data suggests another man may be positive for a SNP, even though it doesn't appear in his VCF data. It might also happen if Chromo2 testing or Sanger sequencing of other men not on the tree show the SNP to be shared.

POS-REF-ALT (hg19) POS-REF-ALT (hg38) Blocks Names Region McDonald BED combBED STRKane-BY3
B5592
21536844-A-C 19374958-A-C Y+
58854604-A-T 56736267-T-A +
3561436-T-A 3693395-T-A +
3561438-A-C 3693397-A-C +
14306037-A-G 12185331-A-G Y+
16728221-T-C 14616341-T-C Y+
7966313-A-G 8098272-A-G Y+
23564036-C-A 21402150-C-A YY+
23564038-T-C 21402152-T-C YY+
27078013-G-GAC 24931866-G-GAC P1_r4 24×AC+
22342616-A-T 20180730-A-T DYZ19 +
13348348-C-T 11192672-C-T +
22220030-A-C 20058144-A-C DYZ19 +
14512313-A-G 12400518-A-G Y+
14963612-CAGG-C 12851687-CAGG-C +
8811533-A-G 8943492-A-G Y+
8811570-G-A 8943529-G-A Y+
14123161-T-A 12002455-T-A Y+
21177056-TTATA-T 19015170-TTATA-T 11×TA+
22153477-T-A 19991591-T-A Y+
6671556-T-C 6803515-T-C YY+
3561435-G-C 3693394-G-C +
21536862-G-A 19374976-G-A Y+
28303-A-G +
23067-A-G +
22367171-G-T 20205285-G-T DYZ19 +
22840192-A-C 20678306-A-C Y+
22840197-T-C 20678311-T-C Y+
28288-T-C +
28239-A-C +
22970282-CAAAAAAAAAAA-C 20808396-CAAAAAAAAAAA-C 27×A+
23115-A-G +
23100-G-A +
23078-G-T FGC82936 +
22981-T-C +
3540794-T-A 3672753-T-A +
22367229-T-A 20205343-T-A DYZ19 +
7024513-G-T 7156472-G-T Y+
19471484-G-T 17359604-G-T YY+
14306021-C-G 12185315-C-G Y+
14306022-A-G 12185316-A-G Y+
14306029-G-A 12185323-G-A Y+
22545389-C-A 20383503-C-A Y+
9909140-T-A 10071531-T-A Y+
5106316-T-G 5238275-T-G +
6638472-C-A 6770431-C-A Y+
22153490-C-A 19991604-C-A Y+
16996687-T-A 14884807-T-A Y+
4264579-A-T 4396538-A-T +
22220022-G-A 20058136-G-A DYZ19 +
22220033-T-C 20058147-T-C DYZ19 +
56867492-T-TAAATATAAATA +
18019516-GTATA-G 15907636-GTATA-G 8×TA+
22153497-A-AT 19991611-A-AT +
9909146-T-C 10071537-T-C Y+
4622147-A-G 4754106-A-G +
58906547-T-G 56684324-A-C +
18139892-A-G 16028012-A-G Y+
17523609-T-C 15411729-T-C Y+
21337093-C-A 19175207-C-A Y+
21830190-T-TA 19668304-T-TA 12×A+
22220025-T-A 20058139-T-A DYZ19 +
22220026-G-T 20058140-G-T DYZ19 +
22367198-C-T 20205312-C-T DYZ19 +
17899058-A-G 15787178-A-G Y+
22220053-T-C 20058167-T-C DYZ19 +
13740680-C-T 11585004-C-T +
13740678-G-C 11585002-G-C +
22220056-T-G 20058170-T-G DYZ19 +
56747846-G-T +
21536819-T-A 19374933-T-A Y+
17338173-C-G 15226293-C-G Y+
17269714-C-T 15157834-C-T Y+
58854622-A-ACATTC 56736233-C-CGAATG +
58829313-C-T 56761558-G-A +
28370015-TAG-T 26223868-TAG-T P1_gr2 16×AG+
23519079-A-G 21357193-A-G Y+
28477832-A-G 26331685-A-G +
19113723-TAAAAAA-T 17001843-TAAAAAA-T 28×A+
6597340-TAAAAAAAAAAAA-T 6729299-TAAAAAAAAAAAA-T 28×A+
13478048-C-G 11322372-C-G +
22360385-T-G 20198499-T-G DYZ19 +
4017743-T-A 4149702-T-A +
5743418-T-G 5875377-T-G *
5731221-T-A 5863180-T-A *
5648808-TA-T 5780767-TA-T *
5835678-C-T 5967637-C-T *
5853446-A-T 5985405-A-T *
5911354-TAA-T 6043313-TAA-T *
5920660-A-T 6052619-A-T *
5630621-CT-C 5762580-CT-C *
5725180-G-A 5857139-G-A *
5648741-T-C 5780700-T-C *
5695258-C-T 5827217-C-T *
5933233-CAAA-C,CAAAA 6065192-CAAA-C,CAAAA 18×A*
5692858-A-G 5824817-A-G *
5936887-A-T 6068846-A-T *
6069592-C- *
5657492-C-A 5789451-C-A *
5983050-C-A 6115009-C-A *
5653904-C-T 5785863-C-T *
5967913-GT-G 6099872-GT-G 8×T*
5952397-G-T 6084356-G-T *
5867206-TC-T 5999165-TC-T *
5627518-T-C 5759477-T-C *
9296364-T-C 9458755-T-C Y*
5623212-C-T 5755171-C-T *
4709810-T-A 4841769-T-A *
4981864-TGTTAG-T 5113823-TGTTAG-T *
4981862-TG-T 5113821-TG-T *
4975930-C-A 5107889-C-A *
4971568-T-C 5103527-T-C *
4960796-A-G 5092755-A-G *
4951659-T-A 5083618-T-A *
4882534-T-A 5014493-T-A *
4869617-CTT-C 5001576-CTT-C 10×T*
4839026-C-T 4970985-C-T *
4734396-TG-T 4866355-TG-T *
4709868-C-A 4841827-C-A *
4705927-G-A 4837886-G-A *
5039656-C-T 5171615-C-T *
4688751-G-A 4820710-G-A *
4674439-A-G 4806398-A-G *
4671156-A-G 4803115-A-G *
4641867-G-A 4773826-G-A *
4610653-T-C 4742612-T-C *
4597569-GT-G 4729528-GT-G *
4584612-T-C 4716571-T-C *
4578767-A-T 4710726-A-T *
4571203-C-T 4703162-C-T *
4571186-G-C 4703145-G-C *
4522136-C-T 4654095-C-T *
4486237-A-T 4618196-A-T *
5027087-T-A 5159046-T-A *
5053120-TTTG-T 5185079-TTTG-T 5×TTG*
5591315-G-T 5723274-G-T *
5355261-G-T 5487220-G-T *
5574076-CCT-C 5706035-CCT-C *
5565335-A-T 5697294-A-T *
5565325-A-T 5697284-A-T *
5536070-C-T 5668029-C-T *
5505357-C-T 5637316-C-T *
5480401-G-C 5612360-G-C *
5463870-T-C 5595829-T-C *
5454560-GTT-G 5586519-GTT-G 11×T*
5442498-G-C 5574457-G-C *
5421858-TA-T 5553817-TA-T *
5412891-A-G 5544850-A-G *
5329494-A-T 5461453-A-T *
5078872-G-A 5210831-G-A *
5314641-TA-T 5446600-TA-T *
5296335-A-C 5428294-A-C *
5262803-G-T 5394762-G-T *
5244087-C-A 5376046-C-A *
5238682-TG-T 5370641-TG-T *
5237397-T-G 5369356-T-G *
5233253-A-G 5365212-A-G *
5217901-T-C 5349860-T-C *
5182075-C-T 5314034-C-T *
5175769-C-A 5307728-C-A *
5159039-T-C 5290998-T-C *
5130695-G-A 5262654-G-A *
5421861-G-T 5553820-G-T *
6586762-G-A 6718721-G-A *
5989040-ATT-A 6120999-ATT-A 12×T*
8835398-G-T 8967357-G-T YY*
9770644-T-C 9933035-T-C Y*
9733619-A-T 9896010-A-T IR3_Prx *
9504541-T-A 9666932-T-A *
9492930-T-A 9655321-T-A *
9239420-C-T,T 9401811-C-T,T *
9195681-T-G 9358072-T-G Y*
9169818-T-G 9332209-T-G Y*
9087310-A-G 9249701-A-G Y*
9037850-G-T 9200241-G-T Y*
9008602-CTTAATTTTTTTTTTATTTATCAGACTGGG-C 9170993-CTTAATTTTTTTTTTATTTATCAGACTGGG-C *
9113136-A-T *
8815056-T-A 8947015-T-A Y*
9778926-T-A 9941317-T-A Y*
8791653-G-C 8923612-G-C YY*
8765570-TA-T 8897529-TA-T *
8765545-A-T 8897504-A-T YY*
8725857-T-TAC 8857816-T-TAC 9×AC*
8540124-TTGTG-T 8672083-TTGTG-T 10×TG*
8528785-C-T 8660744-C-T YY*
8325654-T-C 8457613-T-C Y*
8218172-T-C 8350131-T-C YY*
8155743-TTTCCTCA-T 8287702-TTTCCTCA-T *
8155740-T-TATGAGGA 8287699-T-TATGAGGA *
8144424-A-T 8276383-A-T YY*
9773556-G-T 9935947-G-T Y*
9824850-G-A 9987241-G-A Y*
8129254-G-A 8261213-G-A YY*
10767793-TTCCCTTAAATTCCA-T *
10894463-C-CCAT *
10894461-C-CAT *
10894455-T-G *
10894453-T-TGCAC *
10894452-A-AC *
10884958-ATTCCATT-A *
10884954-TTCC-T *
10799464-A-AAG *
10799462-A-T *
10799447-C-CCATTCTACTG *
10767816-C-T *
10767791-CA-C *
9881286-TG-T 10043677-TG-T *
10763139-TCC-T *
10679708-T-TCAGAAGATCTCACTCTGTCACTCAGGTTGGAGTGCAGTCGCATAATCTCAGCTCACATTACATTTCAGGATTG *
10073862-A-C 10236253-A-C *
10050380-C-T 10212771-C-T *
10014670-A-T 10177061-A-T Y*
9976797-G-A 10139188-G-A Y*
9967136-C-T 10129527-C-T Y*
9963460-T-C 10125851-T-C Y*
9963459-G-GCA 10125850-G-GCA *
9956151-A-G 10118542-A-G Y*
9925591-C-T 10087982-C-T Y*
9914108-C-A 10076499-C-A Y*
8143333-C-A 8275292-C-A YY*
7971562-G-A 8103521-G-A YY*
6041998-C-T 6173957-C-T *
6505732-G-A 6637691-G-A *
6863852-C-T 6995811-C-T YY*
6826741-A-G 6958700-A-G YY*
6823972-C-G 6955931-C-G YY*
6802155-GT-G 6934114-GT-G *
6802130-GAA-G 6934089-GAA-G 11×A*
6769171-A-C 6901130-A-C YY*
6733214-G-A 6865173-G-A YY*
6600668-C-A 6732627-C-A *
6586758-T-A 6718717-T-A *
6516705-T-C 6648664-T-C *
6509310-A-G 6641269-A-G *
6495328-A-G 6627287-A-G *
6875187-C-T 7007146-C-T YY*
6490573-G-C 6622532-G-C *
6466180-A-G 6598139-A-G *
6441625-C-T 6573584-C-T *
6419046-ATGTG-A,ATG 6551005-ATGTG-A,ATG 18×TG*
6413252-T-C 6545211-T-C *
6405764-C-T 6537723-C-T *
6405763-A-C 6537722-A-C *
6146261-C-T 6278220-C-T IR3_Dst *
6089212-A-T 6221171-A-T *
6070913-C-T 6202872-C-T *
6043456-C-T 6175415-C-T *
6875152-A-T 7007111-A-T YY*
6892035-G-A 7023994-G-A YY*
7969537-TGGA-T 8101496-TGGA-T *
7337542-A-G 7469501-A-G Y*
7925452-T-C 8057411-T-C YY*
7868786-C-T 8000745-C-T YY*
7868496-AT-A 8000455-AT-A *
7784279-T-A 7916238-T-A YY*
7775950-G-A 7907909-G-A YY*
7573026-T-C 7704985-T-C Y*
7573025-C-T 7704984-C-T Y*
7573003-G-C 7704962-G-C YY*
7522761-A-G 7654720-A-G YY*
7516296-A-G 7648255-A-G Y*
7416801-C-T 7548760-C-T YY*
7337534-T-C 7469493-T-C Y*
6899016-G-A 7030975-G-A YY*
7312601-G-A 7444560-G-A YY*
7234401-T-C 7366360-T-C YY*
7232611-C-A 7364570-C-A YY*
7195422-G-GA 7327381-G-GA *
7158138-T-C 7290097-T-C YY*
7096382-G-A 7228341-G-A YY*
7063052-G-A 7195011-G-A Y*
7027560-A-T 7159519-A-T Y*
7024571-G-A 7156530-G-A Y*
7024542-G-A 7156501-G-A Y*
6997899-G-T 7129858-G-T YY*
6989158-G-A 7121117-G-A YY*
4485348-G-A 4617307-G-A *
4032386-C-T 4164345-C-T *
4476389-T-A 4608348-T-A *
28791433-T-TGG 26645286-T-TGG *
2924386-T-C 3056345-T-C *
13446804-GCCATTCCATTCCATTCCATTCCATTCCATT-G,GCCATTCCATTCCATTCCATT 11291128-GCCATTCCATTCCATTCCATTCCATTCCATT-G,GCCATTCCATTCCATTCCATT 12×CCATT*
13531497-GGAA-G 11375821-GGAA-G *
13481147-C-G 11325471-C-G *
14083949-A-AATAG,AATAGATAG 11963243-A-AATAG,AATAGATAG 12×ATAG*
13470070-C-A 11314394-C-A *
28790599-TGGAGC-T 26644452-TGGAGC-T *
10062623-GA-G 10225014-GA-G *
10062622-A-T 10225013-A-T *
8625977-TA-T 8757936-TA-T 9×A*
10965551-CTCCATTCCAT-C,CTCCAT *
13468594-G-C 11312918-G-C *
13487350-T-G 11331674-T-G *
13468583-GCA-G 11312907-GCA-G *
13468582-A-T 11312906-A-T *
14172757-A-ACAAATCATGC 12052051-A-ACAAATCATGC *
13458757-A-T 11303081-A-T *
13470683-C-G 11315007-C-G *
9211352-A-AACAC 9373743-A-AACAC 22×AC*
13267777-C-CCCA,CCG 11112101-C-CCCA,CCG *
17050099-C-G 14938219-C-G YY15×T*
13484213-A-T 11328537-A-T *
13479669-T-C 11323993-T-C *
13827167-TG-T 11706461-TG-T *
13489230-A-C 11333554-A-C *
13460827-A-G 11305151-A-G *
13484930-G-A 11329254-G-A *
14505342-A-AG 12393547-A-AG *
13475371-A-G 11319695-A-G *
10908294-C-CTA *
11314359-CCT- *
17140470-G-GAATCCACTCAACTACCCCACA 15028590-G-GAATCCACTCAACTACCCCACA *
13474442-C-A 11318766-C-A *
3076069-CTTTTTTTTT-C 3208028-CTTTTTTTTT-C 25×T*
5398122-A-AT 5530081-A-AT 10×T*
23115338-TA-T 20953452-TA-T 9×A*
14505361-C-T 12393566-C-T YY*
14505354-TC-T 12393559-TC-T *
14505348-A-G 12393553-A-G YY*
2996639-G-GAC 3128598-G-GAC 10×AC*
13338579-A-G 11182903-A-G *
10767764-TCCATCCCTTTCCATTCCA-T *
10767760-CCG-C *
10767742-ACTCCAATCCCTTC-A *
10767739-TCC-T *
10767730-CAACTT-C *
10767721-C-T *
10767714-TCCG-T *
10767710-GCA-G *
10025695-C-A 10188086-C-A Y*
10025689-G-C 10188080-G-C Y*
14172759-A-AATTAAAATAATCAT 12052053-A-AATTAAAATAATCAT *
13460805-T-G 11305129-T-G *
13827162-TCAAA-T 11706456-TCAAA-T *
13482040-T-C 11326364-T-C *
56706804-T-A *
13469197-C-G 11313521-C-G *
9933498-G-A 10095889-G-A Y*
11333951-CA- *
14235207-GT-G 12114501-GT-G 9×T*
15963164-G-A 13851284-G-A Y*
28549803-G-T 26403656-G-T *
22488252-T-A 20326366-T-A DYZ19 *
11333937-C- *
10888054-T-C *
13702608-T-TTA 11546932-T-TTA *
13702604-ACT-A 11546928-ACT-A *
13474428-G-A 11318752-G-A *
11113912-CAAAA- *
13473917-C-T 11318241-C-T *
10765743-TCACTGCACTCCACTC- *
22510223-T-C 20348337-T-C DYZ19 *
13466429-A-T 11310753-A-T *
13196263-C-A 11040587-C-A *
56835941-C-CTCCTCTCCAT *
22441643-T-A 20279757-T-A DYZ19 *
22441637-TA-T 20279751-TA-T DYZ19 *
13740252-G-C 11584576-G-C *
13476525-T-TTG 11320849-T-TTG *
13470146-C-G 11314470-C-G *
9469799-G- *
11334089-TA- *
9946068-A-G 10108459-A-G Y*
22505769-G-C 20343883-G-C FT460629 DYZ19 *
13482017-A-C 11326341-A-C *
13687697-T-C,C 11532021-T-C,C *
13470847-C-T 11315171-C-T *
13466821-A-C 11311145-A-C *
13466816-T-A 11311140-T-A *
13466813-C-A 11311137-C-A *
13564681-T-A 11409005-T-A *
13462033-C-A 11306357-C-A *
56834769-G-GTATT *
22288258-A-G 20126372-A-G DYZ19 *
56732037-C-T *
13718972-A-C 11563296-A-C *
11333955-A- *
10654506-CTGTCT-C *
23593388-G-GAA 21431502-G-GAA 10×A*
22475052-G-A 20313166-G-A BY48004 DYZ19 *
22475020-C-T 20313134-C-T DYZ19 *
11297036-ACTACTC- *
11297031-TCTCC- *
13462042-G-C 11306366-G-C *
13369958-T-C 11214282-T-C *
56832539-C-CCAT,T *
28818221-G-C 26672074-G-C *
11747893-A- *
11334056-G- *
13480367-G-T 11324691-G-T *
13460876-A-C 11305200-A-C *
22440115-AC-A 20278229-AC-A DYZ19 *
8158317-T-C 8290276-T-C YY*
4464429-G-GTT 4596388-G-GTT 10×T*
3742594-G-A 3874553-G-A *
3806296-A-G 3938255-A-G *
3802915-T-C 3934874-T-C *
3800509-A-G 3932468-A-G *
3786277-G-C 3918236-G-C *
3786272-C-T 3918231-C-T *
3785923-G-A 3917882-G-A *
3775302-A-G 3907261-A-G *
3766436-C-T 3898395-C-T *
3763094-AT-A 3895053-AT-A 8×T*
3761828-A-G 3893787-A-G *
3757756-T-C 3889715-T-C *
3698840-T-A 3830799-T-A *
3830293-C-A 3962252-C-A *
3688100-A-T 3820059-A-T *
3673573-A-T 3805532-A-T *
3646714-TAA-T 3778673-TAA-T 11×A*
3598223-C-T 3730182-C-T *
3598196-G-T 3730155-G-T *
3584461-C-T 3716420-C-T *
3583522-A-T 3715481-A-T *
3571983-G-A 3703942-G-A *
3571969-C-T 3703928-C-T *
3553700-T-C 3685659-T-C *
3536108-C-G 3668067-C-G *
3522727-C-T 3654686-C-T *
3827167-GT-G 3959126-GT-G *
3847056-TA-T 3979015-TA-T *
3478355-CTTTT-C 3610314-CTTTT-C 14×T*
4183427-G-A 4315386-G-A *
4447481-T-C 4579440-T-C *
4421865-G-A 4553824-G-A *
4375335-T-C 4507294-T-C *
4365190-A-T 4497149-A-T *
4361171-C-T 4493130-C-T *
4342562-TA-T 4474521-TA-T *
4302070-T-C 4434029-T-C *
4252590-C-A 4384549-C-A *
4238542-T-C 4370501-T-C *
4216224-A-T 4348183-A-T *
4196443-C-T 4328402-C-T *
4176767-C-CAA 4308726-C-CAA 12×A*
3854312-C-A 3986271-C-A *
4124152-GC-G 4256111-GC-G *
4038856-G-A 4170815-G-A *
10986939-T-C *
4031423-A-G 4163382-A-G *
4031407-C-T 4163366-C-T *
4031402-A-G 4163361-A-G *
4023160-TA-T 4155119-TA-T 8×A*
3961125-T-A 4093084-T-A *
3957185-T-A 4089144-T-A *
3952780-G-A 4084739-G-A *
3890522-A-T 4022481-A-T *
3884800-CTG-C 4016759-CTG-C *
3482853-C-A 3614812-C-A *
3469159-T-C 3601118-T-C *
13700999-GACAAGAACGTATTATATTTCAATGTAATTTATTCA-G 11545323-GACAAGAACGTATTATATTTCAATGTAATTTATTCA-G *
13476596-G-T 11320920-G-T *
2733922-AT-A 2865881-AT-A *
2694607-G-A 2826566-G-A YY*
2685662-T-G 2817621-T-G YY*
2678837-G-A 2810796-G-A Y*
2669185-C-T 2801144-C-T YY*
13480292-G-T 11324616-G-T *
19025663-G-A 16913783-G-A Y*
13476516-A-G 11320840-A-G *
10763135-C-CAA *
10763106-CATTCCAT-C *
10763101-CAAT-C *
13435849-G-C 11280173-G-C *
2776283-G-T 2908242-G-T YY*
20274510-ATTAAAGGTGTTATGTCCAGAGTTTGTTCCTTCAGATGTGTCCAGAGTTTCTTCCTTCTGGCAGGTTCATGGGCTTGCTCACTTCAAGAATGAAGCTGCAGACCTTTACGGTGAGTGTTACAGCAC- DYZ19 *
11323445-T- *
11323444-A- *
22288261-G-A 20126375-G-A DYZ19 *
13480441-A-T 11324765-A-T *
13470867-C-A 11315191-C-A *
28617328-C-T 26471181-C-T FT161887 *
13436788-G-T 11281112-G-T *
13333898-A-G 11178222-A-G *
9964078-C-T 10126469-C-T Y*
25651212-G-T 23505065-G-T P1_b3 *
22475327-G-A 20313441-G-A BY155319 DYZ19 *
2772147-G-T 2904106-G-T Y*
2788745-A-G 2920704-A-G Y*
3440876-A-T 3572835-A-T *
3192579-C-A 3324538-C-A *
3432399-A-G 3564358-A-G *
3425815-C-A 3557774-C-A *
3415598-T-C 3547557-T-C *
3381470-A-AT 3513429-A-AT *
3363255-T-A 3495214-T-A *
3343375-T-C 3475334-T-C *
3333315-T-A 3465274-T-A *
3330089-G-T 3462048-G-T *
3285871-A-G 3417830-A-G *
3258690-C-T 3390649-C-T *
3222405-T-C 3354364-T-C *
3190251-G-A 3322210-G-A *
2808276-T-C 2940235-T-C YY*
3179871-C-T 3311830-C-T *
3169114-C-T 3301073-C-T *
3119021-G-T 3250980-G-T *
3119010-A-G 3250969-A-G *
3080365-C-A 3212324-C-A *
3074004-G-A 3205963-G-A *
2995229-TTGTG-T 3127188-TTGTG-T 8×TG*
2942267-G-T 3074226-G-T *
2917737-G-A 3049696-G-A Y*
2836062-A-T 2968021-A-T YY*
2817139-CTT-C 2949098-CTT-C *
2815068-A-G 2947027-A-G YY*
10986865-T-TCCACTCCATTCCACTCCATG *
13417463-CA-C 11261787-CA-C *
11014466-C-CAGATAAG *
21240358-ATGTG-A 19078472-ATGTG-A 8×TG*
21556814-C-T 19394928-C-T YY*
21498262-CTAT-C 19336376-CTAT-C *
21496607-G-A 19334721-G-A Y*
21493745-A-T 19331859-A-T YY*
21417390-C-A 19255504-C-A Y*
21295255-C-T 19133369-C-T YY*
21253240-C-T 19091354-C-T YY*
21249497-G-A 19087611-G-A YY*
21249491-T-TAAAG 19087605-T-TAAAG *
21249487-ACTTT-A 19087601-ACTTT-A *
21249482-T-C 19087596-T-C YY*
21236242-C-CAAA 19074356-C-CAAA 15×A*
21607482-T-A 19445596-T-A YY*
21208253-A-G 19046367-A-G Y*
21180242-A-T 19018356-A-T YY*
21167554-TG-T 19005668-TG-T *
21140854-CTTT-C,CTT 18978968-CTTT-C,CTT 15×T*
21121991-GA-G 18960105-GA-G *
21114355-T-C 18952469-T-C YY*
21092721-G-A 18930835-G-A YY*
21056157-A-G 18894271-A-G Y*
20817456-C-A 18655570-C-A P4_Gap *
20810013-T-A 18648127-T-A P4_Gap *
19537637-C-T 17425757-C-T YY*
19537059-CA-C 17425179-CA-C *
21600242-A-C 19438356-A-C Y*
21625934-CAA-C 19464048-CAA-C 10×A*
19485001-G-T 17373121-G-T Y*
21915902-G-A 19754016-G-A YY*
22199207-T-C 20037321-T-C YY*
22128550-T-C 19966664-T-C YY*
22091446-A-T 19929560-A-T YY*
22052217-T-A 19890331-T-A Y*
22028045-A-T 19866159-A-T YY*
22025060-A-T 19863174-A-T YY*
21989232-T-TA 19827346-T-TA *
21978846-G-T 19816960-G-T YY*
21961211-T-A 19799325-T-A YY*
21926404-A-T 19764518-A-T YY*
21918558-G-A 19756672-G-A YY*
21901151-T-C 19739265-T-C YY*
21642710-C-T 19480824-C-T YY*
21888748-A-G 19726862-A-G YY*
21861700-T-C 19699814-T-C YY*
21851186-T-A 19689300-T-A Y*
21802630-A-G 19640744-A-G YY*
21790903-G-T 19629017-G-T Y*
21786370-A-G 19624484-A-G Y*
21744794-T-A 19582908-T-A Y*
21744791-C-T 19582905-C-T Y*
21726158-G-C 19564272-G-C YY*
21713816-C-T 19551930-C-T YY*
21706112-CT-C 19544226-CT-C 8×T*
21690093-A-G 19528207-A-G YY*
19527462-T-C 17415582-T-C YY*
19466689-C-T 17354809-C-T YY*
22208199-A-ATT 20046313-A-ATT 12×T*
18687281-A-G 16575401-A-G YY*
18848507-T-A 16736627-T-A Y*
18836737-CT-C 16724857-CT-C 8×T*
18833298-G-T 16721418-G-T YY*
18760487-G-T 16648607-G-T YY*
18743885-T-A 16632005-T-A YY*
18742531-C-T 16630651-C-T YY*
18717890-A-G 16606010-A-G YY*
18702363-T-TGC 16590483-T-TGC *
18702362-T-G 16590482-T-G Y*
18702356-AAT-A 16590476-AAT-A *
18689933-T-C 16578053-T-C YY*
18657915-T-C 16546035-T-C YY*
18917314-C-T 16805434-C-T YY*
18643638-T-A 16531758-T-A YY*
18635806-TA-T 16523926-TA-T *
18624569-G-A 16512689-G-A Y*
18600603-A-G 16488723-A-G YY*
18577868-A-G 16465988-A-G YY*
18537370-T-G 16425490-T-G P6_Dst *
18491341-A-C 16379461-A-C P6_Dst *
18491335-A-T 16379455-A-T P6_Dst *
18404314-A-G 16292434-A-G P6_Gap *
18391295-T-A 16279415-T-A P6_Gap *
18244326-AT-A 16132446-AT-A *
18244325-A-T 16132445-A-T Y*
18855006-A-T 16743126-A-T YY*
18927332-TG-T 16815452-TG-T *
19437839-G-A 17325959-G-A Y*
19187214-CCA-C 17075334-CCA-C *
19409313-A-G 17297433-A-G YY*
19401501-G-C 17289621-G-C YY*
19381230-C-T 17269350-C-T YY*
19370110-T-A 17258230-T-A YY*
19304177-G-A 17192297-G-A Y*
19263434-G-GGTGA 17151554-G-GGTGA *
19263424-AAGAC-A 17151544-AAGAC-A *
19263420-A-G 17151540-A-G YY*
19203748-C-A 17091868-C-A YY*
19198306-T-C 17086426-T-C YY8×A*
19187217-G-T 17075337-G-T Y*
19187199-GCCTCCCACTT-G 17075319-GCCTCCCACTT-G *
18992887-G-A 16881007-G-A YY*
19187197-GA-G 17075317-GA-G *
19162802-C-A 17050922-C-A YY*
19146782-G-A 17034902-G-A YY*
19146780-A-G 17034900-A-G YY*
19146768-CG-C 17034888-CG-C *
19145683-A-T 17033803-A-T YY*
19085913-G-A 16974033-G-A YY*
19080472-TC-T 16968592-TC-T *
19039171-C-CA 16927291-C-CA *
19025762-C-T 16913882-C-T Y*
19025703-C-T 16913823-C-T Y*
18997614-A-T 16885734-A-T YY*
22199212-G-C 20037326-G-C YY*
22215751-G-A 20053865-G-A Y*
18244316-A-T 16132436-A-T Y*
27701842-A-G 25555695-A-G P1_Y2 *
28548147-C-T 26402000-C-T Y*
28526179-T-C 26380032-T-C *
28508093-C-A 26361946-C-A *
28496343-T-C 26350196-T-C Y*
28496336-A-G 26350189-A-G Y*
28496335-C-G 26350188-C-G Y*
28480739-T-A 26334592-T-A *
28468253-C-CTT 26322106-C-CTT 13×T*
28225454-AT-A 26079307-AT-A P1_b4 9×T*
27997737-A-G 25851590-A-G P1_Y2 *
27840510-G-T 25694363-G-T P1_Y2 *
27690407-AT-A 25544260-AT-A P1_Y2 8×T*
26403181-C- *
27662793-G-A 25516646-G-A P1_Y2 *
25944478-C-T 23798331-C-T P1_Y1 *
25466666-G-T 23320519-G-T P2_r2 *
24928579-A-G 22782432-A-G g1 *
24879630-T-C 22733483-T-C g1 *
24491561-A-G 22345414-A-G *
24470719-C-T 22324572-C-T Y*
24423128-C-A 22276981-C-A Y*
24383303-C-T 22237156-C-T Y*
24381544-C-A 22235397-C-A Y*
24363938-CT-C 22217791-CT-C *
24363786-GT-G 22217639-GT-G *
28548152-C-T 26402005-C-T Y*
26403199-C- *
23841681-A-G 21679795-A-G Y*
56724618-G-A *
56833263-CTCCACTCCAT- *
56832921-T- *
56832068-CACTCCA- *
56829113-CGAGTCCATTCCATTCAAGTCCATTCCATTCCAGGCCATTTCTTTCGAGTCCATTCCATTCTATTCCATTCCATTCCATTCCTTTCGGGACCATTCCATTACTGTCCATTCCATTT-C *
56827998-C-G *
56827992-TCCA-T *
56827991-G-A *
56827987-TC-T *
56756875-A- *
56727848-T-A,G *
56724682-T-A *
56714057-CAATGG-C,GAATGG 4×AATGG*
28569802-A-G 26423655-A-G *
26649894-TTGGAGTGGACTGGAGTGGAATGGAACGGAATGGGCCGGAATGGAATTGAAAGGGGTGAATTGGAATTGAGTGCTGTGGATTGGAGTAGACTGCATTGTAGTGGATTGGAGTGGAAAGAAGTGGAGTGGAATGGAATGGAATGCAATGGAGTGGAGTGGAA- *
28785766-G-T 26639619-G-T *
28722045-T-C 26575898-T-C *
28704552-T-C 26558405-T-C *
28684589-GT-G 26538442-GT-G *
28671872-A-G 26525725-A-G *
28637732-GT-G 26491585-GT-G *
28617299-A-G 26471152-A-G *
28616299-G-T 26470152-G-T *
28609194-C-CTTT 26463047-C-CTTT 11×T*
28588196-A-AT 26442049-A-AT *
28585477-T-A 26439330-T-A *
21752059-A-T *
23792030-T-C 21630144-T-C Y*
20073707-TAAAGGTCTGCAGCTTCATTCTTGAAGTAAGGAAGACCATGAACCTGCCAGAAGGAAGAAATTCTGGACACATCTGAAGGAACAAACTCTGGATATAACAAATTTAAGTGCTGTAACACTCACCGTAAATGTCTGCAGCTTCATTCTTGAAGCTAGCAAGACCATGAACCTGCCAGAAGGAAGAAACTCTGGACACATCTGAAGGAACAAACTCTGGACATAATAC- DYZ19 *
22652177-G-A 20490291-G-A YY*
23001078-T-G 20839192-T-G YY*
22936252-TC-T 20774366-TC-T *
22885725-T-C 20723839-T-C YY*
22840183-G-T 20678297-G-T Y*
22840174-G-A 20678288-G-A Y*
22840157-T-A 20678271-T-A Y*
22747115-A-G 20585229-A-G YY*
22723035-A-G 20561149-A-G YY*
22717333-T-C 20555447-T-C YY*
22711332-A-T 20549446-A-T YY*
22652246-AT-A 20490360-AT-A *
22614253-G-A 20452367-G-A Y*
23007902-T-A 20846016-T-A Y*
22594744-A-G 20432858-A-G YY*
22591216-C-T 20429330-C-T Y*
22579532-G-A 20417646-G-A YY*
22527776-G-A 20365890-G-A Y*
22521842-T-A 20359956-T-A Y*
22506130-A-T 20344244-A-T DYZ19 *
22505777-CTTTAATG-C 20343891-CTTTAATG-C DYZ19 *
22487007-GGTTCATGGTCTTGCTCACTTCCAGAATGAAGCTGCAGACCTTACTGTTGAGTGTTAAGGCACTTAAAGGTGTTATCTACAGAGTTTGTTCTTTCAGATGTGTCCAGACTTTCTTCCTTCTGGC-G 20325121-GGTTCATGGTCTTGCTCACTTCCAGAATGAAGCTGCAGACCTTACTGTTGAGTGTTAAGGCACTTAAAGGTGTTATCTACAGAGTTTGTTCTTTCAGATGTGTCCAGACTTTCTTCCTTCTGGC-G DYZ19 *
22487003-GGC-G 20325117-GGC-G DYZ19 *
22297620-C-T 20135734-C-T DYZ19 *
22287092-AAGGT-A 20125206-AAGGT-A DYZ19 *
22247079-C-T 20085193-C-T DYZ19 *
23007894-A-G 20846008-A-G Y*
23019404-T-A 20857518-T-A Y*
23650038-GTTT-G 21488152-GTTT-G 15×T*
23393419-G-A 21231533-G-A YY*
23621644-G-T 21459758-G-T YY*
23603781-T-A 21441895-T-A YY*
23597428-G-T 21435542-G-T YY*
23544884-A-G 21382998-A-G YY*
23519253-C-T 21357367-C-T Y*
23505926-TA-T 21344040-TA-T *
23503179-GTTTA-G 21341293-GTTTA-G 5×TTTA*
23475000-T-C 21313114-T-C YY*
23474207-C-T 21312321-C-T YY*
23456251-A-G 21294365-A-G YY*
23445641-TAA-T 21283755-TAA-T 11×A*
23386659-G-T 21224773-G-T YY*
23019420-A-G 20857534-A-G Y*
23381968-T-C 21220082-T-C YY*
23350605-C-T 21188719-C-T YY*
23333378-T-C 21171492-T-C Y*
23327701-G-T 21165815-G-T YY*
23257956-A-G 21096070-A-G YY*
23113964-T-C 20952078-T-C YY*
23039604-T-C 20877718-T-C YY*
23019457-A-G 20857571-A-G Y*
23019453-A-C 20857567-A-C Y*
23019442-G-A 20857556-G-A Y*
23019433-A-C 20857547-A-C Y*
23019427-T-G 20857541-T-G Y*
18244317-A-T 16132437-A-T Y*
18228383-G-A 16116503-G-A *
11035834-C-CCAAAA *
13623267-C-G 11467591-C-G *
13992612-C-A 11871906-C-A YY*
13992611-C-A 11871905-C-A YY*
13978951-G-A 11858245-G-A Y*
13978949-G-C 11858243-G-C Y*
13959574-TG-T 11838868-TG-T *
13874174-AT-A 11753468-AT-A *
13745103-T-A 11589427-T-A *
13698424-T-TATGGAATGGAATCGA 11542748-T-TATGGAATGGAATCGA *
13688208-A-AATGGCATGGAATGGAATGGAGTGAAATGGATTGGAATGGGATGGGCCCAAAGTAATGGACTAAAATAAAAGAGACTCAAATAGAATGAATTGTAAAGAAACGGTCTCGAATGTAATTTATTCGAAT 11532532-A-AATGGCATGGAATGGAATGGAGTGAAATGGATTGGAATGGGATGGGCCCAAAGTAATGGACTAAAATAAAAGAGACTCAAATAGAATGAATTGTAAAGAAACGGTCTCGAATGTAATTTATTCGAAT *
13639067-G-T 11483391-G-T *
13635127-GA-G 11479451-GA-G *
13602804-C-T 11447128-C-T *
13992618-T-G 11871912-T-G YY*
13588578-C-T 11432902-C-T *
13587957-G-A 11432281-G-A *
13527075-G-A 11371399-G-A *
13522762-T-A 11367086-T-A *
13507670-A-G 11351994-A-G *
13504385-A-T 11348709-A-T *
13499805-T-TA 11344129-T-TA *
13489030-G-C 11333354-G-C *
13488679-C-T 11333003-C-T *
13488164-C-A 11332488-C-A *
13487929-C-T 11332253-C-T *
13487379-A-C 11331703-A-C *
13992615-G-C 11871909-G-C YY*
13992619-T-G 11871913-T-G YY*
13485991-A-G 11330315-A-G *
14380407-A-G 12259703-A-G YY*
14843559-G-GT 12731625-G-GT *
14826136-T-C 12714203-T-C YY*
14743172-A-G 12631240-A-G Y*
14741296-A-G 12629364-A-G Y*
14740519-T-A 12628587-T-A Y*
14731883-A-AT 12619951-A-AT *
14681188-C-CAA 12569254-C-CAA 13×A*
14552120-A-G 12440321-A-G YY*
12375421-A-G *
14473673-A-T 12352942-A-T YY*
14423823-G-T 12303098-G-T YY*
14376480-A-ATGT 12255776-A-ATGT *
13995743-C-CA 11875037-C-CA *
14376475-CACA-C 12255771-CACA-C *
14328939-G-T 12208233-G-T YY*
14271902-T-C 12151196-T-C Y*
14266332-T-C 12145626-T-C YY*
14235174-T-TGA 12114468-T-TGA *
14235173-C-G 12114467-C-G YY*
14235168-GCT-G 12114462-GCT-G *
14221858-G-A 12101152-G-A YY*
14155302-C-T 12034596-C-T Y*
14080236-C-A 11959530-C-A YY*
14062010-C-CAAAAAAAAAA 11941304-C-CAAAAAAAAAA 34×A*
13995747-C-CA 11875041-C-CA *
13487311-GC-G 11331635-GC-G *
13485974-G-A 11330298-G-A *
14855425-C-T 12743491-C-T YY*
13346070-T-A 11190394-T-A *
13446361-A-T 11290685-A-T *
13444968-G-A 11289292-G-A *
13441800-C-A 11286124-C-A *
13436858-A-G 11281182-A-G *
13417466-G-T 11261790-G-T *
13488457-G-T 11332781-G-T *
13380110-C-T 11224434-C-T *
13362927-CTT-C,CTTT 11207251-CTT-C,CTTT 12×T*
13352792-T-A 11197116-T-A *
13348096-T-C 11192420-T-C *
13347219-ATTT-A 11191543-ATTT-A 13×T*
13346068-T-A 11190392-T-A *
13461122-ATGCCACTATAGGTAGAGCCTAGAAAAGATTTACAT-A 11305446-ATGCCACTATAGGTAGAGCCTAGAAAAGATTTACAT-A *
13342642-C-T 11186966-C-T *
13335500-T-A 11179824-T-A *
13333253-A-G 11177577-A-G *
13325236-C-T 11169560-C-T *
13214879-C-T 11059203-C-T *
13196256-TCCA-T 11040580-TCCA-T *
13196252-CCA-C 11040576-CCA-C *
11035853-G- *
11035852-TGGC-T *
11035851-A-AATT *
11035844-G-C *
11035835-T-C *
13461100-A-T 11305424-A-T *
13461160-CCTAGGTGATCAGTGCAGAGATACATCGCAATGCCCCTGTAGGCAGGGCCTTGACAAGTGGTATATCACCTGGGTGAT-C 11305484-CCTAGGTGATCAGTGCAGAGATACATCGCAATGCCCCTGTAGGCAGGGCCTTGACAAGTGGTATATCACCTGGGTGAT-C *
13485758-T-G 11330082-T-G *
11314845-G- *
13484966-T-A 11329290-T-A *
13484227-TCAGC-T 11328551-TCAGC-T *
13482072-C-A 11326396-C-A *
13480876-G-A 11325200-G-A *
13480278-A-G 11324602-A-G *
13479222-G-C,T 11323546-G-C,T *
11320854-C- *
13475428-C-T 11319752-C-T *
13475421-T-G 11319745-T-G *
13470729-G-A 11315053-G-A *
13470688-G-T 11315012-G-T *
13470520-TGG-T 11314844-TGG-T *
11305566-GCAGGGATATGTCACAAAGCACCCAGTAGGCAGATCCTAGAGAAGAGTTATATCACCTGGGTGATCAGTGCAGAGATATGTCACAAGCCCACTT- *
13470161-G-GCTA 11314485-G-GCTA *
13470143-C-G 11314467-C-G *
13470045-A-G 11314369-A-G *
13470020-A-G 11314344-A-G *
13469680-G-A 11314004-G-A *
13468432-G-T 11312756-G-T *
13468402-A-AGTTACTTCACTTGG 11312726-A-AGTTACTTCACTTGG *
13468399-G-GACA 11312723-G-GACA *
13468384-G-GTAAT,T 11312708-G-GTAAT,T *
13468071-A-C 11312395-A-C *
13465122-C-T 11309446-C-T *
13461612-A-C 11305936-A-C *
14850052-CT-C 12738118-CT-C *
14930714-T-A 12818779-T-A YY*
18181614-A-G 16069734-A-G YY*
17034880-C-A 14923000-C-A YY*
17246579-C-T 15134699-C-T Y*
17242637-A-T 15130757-A-T YY*
17224740-T-C 15112860-T-C YY*
17223356-T-A 15111476-T-A YY*
17223349-T-A 15111469-T-A YY*
17164110-G-A 15052230-G-A Y*
17163085-G-A 15051205-G-A Y*
17140473-T-A 15028593-T-A YY*
17110288-A-C 14998408-A-C YY*
17080956-C-T 14969076-C-T YY*
17056503-T-A 14944623-T-A YY*
16989322-T-C 14877442-T-C YY*
17323039-GGGAGAGAGGGAGGGACGGGGGAGGGAGGGGAGAAGATGGTGTGAGAGAGAGAGAGGGAGAGAGGAAAATGAAAAGAAGATGCAAGACAGAGAGAGAAGGAGGGAAGGAAATGAAAAGAAGGTGCAAGAGAGAGAGGGAGAGAGGGAGGAAA-G 15211159-GGGAGAGAGGGAGGGACGGGGGAGGGAGGGGAGAAGATGGTGTGAGAGAGAGAGAGGGAGAGAGGAAAATGAAAAGAAGATGCAAGACAGAGAGAGAAGGAGGGAAGGAAATGAAAAGAAGGTGCAAGAGAGAGAGGGAGAGAGGGAGGAAA-G *
16974657-G-A 14862777-G-A Y*
16966213-A-G 14854333-A-G YY*
16917799-G-T 14805919-G-T YY*
16915281-A-G 14803401-A-G YY*
16905734-G-A 14793854-G-A YY*
16905656-A-G 14793776-A-G YY*
16872730-T-C 14760850-T-C YY*
16868382-CT-C 14756502-CT-C *
16868380-C-CT 14756500-C-CT *
16842881-G-C 14731001-G-C Y*
16835693-C-CTT 14723813-C-CTT 10×T*
16832835-C-T 14720955-C-T YY*
17277481-TCA-T,TCACA 15165601-TCA-T,TCACA 20×CA*
17344583-T-C 15232703-T-C YY*
16805268-T-A 14693388-T-A YY*
17790206-G-A 15678326-G-A YY*
18157351-C-T 16045471-C-T Y*
18146822-A-T 16034942-A-T YY*
18144514-T-C 16032634-T-C YY*
18134662-T-A 16022782-T-A Y*
18066230-A-T 15954350-A-T YY*
17963145-TAA-T 15851265-TAA-T *
17907329-C-T 15795449-C-T YY*
17903872-G-A 15791992-G-A YY*
17899612-T-A 15787732-T-A Y*
17881278-C-A 15769398-C-A YY*
17872639-C-T 15760759-C-T YY17×T*
17780919-T-A 15669039-T-A YY*
17391340-A-C 15279460-A-C YY*
17780909-GTAGCCTT-G 15669029-GTAGCCTT-G *
17780900-A-ATGTGT 15669020-A-ATGTGT *
17780895-GACACA-G 15669015-GACACA-G *
17755474-C-T 15643594-C-T YY*
17718856-TA-T 15606976-TA-T *
17718851-A-AT 15606971-A-AT *
17686220-A-T 15574340-A-T YY*
17662026-G-A 15550146-G-A YY*
17648397-T-C 15536517-T-C YY*
17638909-C-T 15527029-C-T Y*
17448969-G-A 15337089-G-A YY*
17430557-T-C 15318677-T-C Y*
16814430-C-T 14702550-C-T Y*
16804038-T-A 14692158-T-A YY*
14949334-T-A 12837408-T-A YY*
15213087-A-G 13101173-A-G Y*
15505751-C-T 13393871-C-T YY*
15448314-A-G 13336434-A-G YY*
15435498-T-C 13323618-T-C YY*
15392846-A-G 13280966-A-G YY*
15378154-T-C 13266274-T-C Y*
15378150-C-A 13266270-C-A Y*
15378148-T-C 13266268-T-C Y*
15378132-A-G 13266252-A-G Y*
15374849-T-C 13262969-T-C YY*
15308597-A-T 13196699-A-T YY*
15277194-TAA-T 13165283-TAA-T *
15199528-G-A 13087614-G-A YY*
15571994-A-T 13460114-A-T YY*
15150571-G-A 13038658-G-A Y*
15143852-GT-G 13031939-GT-G *
15124270-A-G 13012357-A-G YY*
15082319-G-A 12970409-G-A Y*
15070725-C-T 12958816-C-T YY*
15047202-T-A 12935292-T-A YY*
15007104-TAA-T 12895189-TAA-T 11×A*
14997317-T-C 12885402-T-C YY*
14984651-G-A 12872719-G-A YY*
14949367-G-A 12837441-G-A YY*
14949360-A-C 12837434-A-C YY*
14949337-CACCATAATG-C 12837411-CACCATAATG-C *
15517637-T-A 13405757-T-A YY*
15598470-T-A 13486590-T-A Y*
16800881-T-A 14689001-T-A YY*
16313790-C-T 14201910-C-T YY*
16776646-G-A 14664766-G-A YY*
16767955-C-A 14656075-C-A YY*
16720830-G-A 14608950-G-A Y*
16717490-T-C 14605610-T-C YY*
16679902-G-A 14568022-G-A YY*
16581757-T-A 14469877-T-A YY*
16535053-C-CTT,CTT 14423173-C-CTT,CTT 35×T*
16517021-C-A 14405141-C-A YY*
16498435-T-G 14386555-T-G Y*
16364808-G-A 14252928-G-A YY*
16340770-T-C 14228890-T-C YY*
16302280-A-G 14190400-A-G YY*
15647345-G-A 13535465-G-A Y*
16233783-G-A 14121903-G-A YY*
16187049-C-T 14075169-C-T YY*
16087845-G-A 13975965-G-A Y*
16076087-C-T 13964207-C-T Y*
15989445-G-A 13877565-G-A YY*
15953433-T-C 13841553-T-C YY*
15841169-TAGAG-T 13729289-TAGAG-T *
15821485-G-T 13709605-G-T YY*
15794110-T-C 13682230-T-C Y*
15782131-G-A 13670251-G-A YY*
15758379-C-T 13646499-C-T YY*
15750585-T-C 13638705-T-C YY*
13484142-C-G 11328466-C-G *
28808023-T-TGAG 26661876-T-TGAG *
13273844-G-T 11118168-G-T *
13489246-G-C 11333570-G-C *
13461329-C-A 11305653-C-A *
16660506-C-CT 14548626-C-CT 9×T*
13474549-CT-C 11318873-CT-C *
22676769-T-TA 20514883-T-TA 10×A*
13692273-A-G 11536597-A-G *
13486591-T-C 11330915-T-C *
13474612-G-A 11318936-G-A *
13469886-C-T 11314210-C-T *
10062586-G-A 10224977-G-A *
13461296-A-G 11305620-A-G *
8703659-ATTTTT-A 8835618-ATTTTT-A 18×T*
13333852-C-A 11178176-C-A *
13347726-A-C 11192050-A-C *
22288255-G-T 20126369-G-T DYZ19 *
58998191-C-G 56852044-C-G A8825 *
13595444-C-T 11439768-C-T *
13595434-T-C 11439758-T-C *
13532016-G-A 11376340-G-A *
7002936-G-A 7134895-G-A FTA3055 Y*
7002927-T-A 7134886-T-A Y*
13470715-G-A 11315039-G-A BY210315 *
13461638-T-A 11305962-T-A *
13487944-G-T 11332268-G-T *
13479202-C-T 11323526-C-T *
58869256-C-T 56721615-G-A *
7002944-G-A 7134903-G-A Y*
13252394-AT-A 11096718-AT-A 11×T*
25296840-T-TA 23150693-T-TA P2_r1 12×A*
13445496-A-G 11289820-A-G *
13489060-G-T 11333384-G-T *
13489103-T-A 11333427-T-A *
58893731-T-C 56697140-A-G *
22316807-G-C 20154921-G-C BY25068 DYZ19 *
28549561-G-T 26403414-G-T *
58984744-G-A 56838597-G-A *
13446017-C-T 11290341-C-T *
58984741-CT-C 56838594-CT-C *
9958108-C-A 10120499-C-A FT376096 Y*
25624529-G-GT 23478382-G-GT P1_b3 12×T*
6672275-T-TA 6804234-T-TA 9×A*
22359645-T-A 20197759-T-A DYZ19 *
22508760-G-A 20346874-G-A DYZ19 *
13740797-A-G 11585121-A-G *
22254518-A-T 20092632-A-T DYZ19 *
22254515-A-G 20092629-A-G DYZ19 *
22254503-C-G 20092617-C-G BY22441 DYZ19 *
22254494-C-A 20092608-C-A DYZ19 *
22444166-G-A 20282280-G-A DYZ19 *
16095827-C-A 13983947-C-A Y*
13462185-G-C 11306509-G-C *
6646237-A-AT 6778196-A-AT 9×T*
22476821-G-A 20314935-G-A DYZ19 *
13474399-T-A 11318723-T-A *
4370594-TACAC-T 4502553-TACAC-T 19×AC*
22505733-T-G 20343847-T-G DYZ19 *
13462021-G-C 11306345-G-C *
9962121-T-G 10124512-T-G Y*
9962289-G-A 10124680-G-A Y*
58876842-C-A 56714029-G-T *
13489215-C-A 11333539-C-A *
13488369-C-T 11332693-C-T *
13488365-G-A 11332689-G-A *
9941646-A-G 10104037-A-G Y*
58974884-TC-T 56828737-TC-T *
10075716-G-T 10238107-G-T FT427320 *
10075712-G-T 10238103-G-T *
10075709-A-G 10238100-A-G *
13468458-C-T 11312782-C-T *
58893713-G-T 56697158-C-A *
13345990-A-G 11190314-A-G FGC50080 *
24274001-CAA-C 22127854-CAA-C P3_b1 11×A*
13460526-A-G 11304850-A-G *
58982062-A-ATTCCT 56835915-A-ATTCCT *
58858865-CCCATT-C 56731955-CAATGG-C 10×CCATT*
13393449-ATT-A 11237773-ATT-A 12×T*
4621294-C-G 4753253-C-G *
4621284-G-C 4753243-G-C *
4621239-C-T 4753198-C-T *
4621231-G-A 4753190-G-A *
4621225-C-A 4753184-C-A *
13489221-G-A 11333545-G-A *
22476799-A-G 20314913-A-G BY25201 DYZ19 *
13488557-G-A 11332881-G-A *
13461096-G-T 11305420-G-T *
22241689-T-A 20079803-T-A DYZ19 *
23856959-AT-A 21695073-AT-A 9×T*
22480260-G-C 20318374-G-C DYZ19 *
22446710-C-T 20284824-C-T DYZ19 *
5721422-T-C 5853381-T-C *
22487889-G-A 20326003-G-A DYZ19 *
22487884-T-G 20325998-T-G DYZ19 *
22508544-C-T 20346658-C-T DYZ19 *
22508539-G-A 20346653-G-A DYZ19 *
22508449-G-T 20346563-G-T DYZ19 *
13254611-T-TGTGTG 11098935-T-TGTGTG *
13196304-C-A 11040628-C-A *
13488426-C-G 11332750-C-G BY86208 *
7105351-GA-G 7237310-GA-G 11×A*
22366410-T-G 20204524-T-G DYZ19 *
22254547-T-G 20092661-T-G DYZ19 *
13480973-C-T 11325297-C-T FGC13253 *
10025295-T-A 10187686-T-A Y*
22475881-G-A 20313995-G-A DYZ19 *
13487914-G-A 11332238-G-A *
13489044-G-A 11333368-G-A *
13489016-C-T 11333340-C-T *
13488759-C-T 11333083-C-T *
13489664-G-T 11333988-G-T *
16050914-CTTT-C 13939034-CTTT-C *
16050910-CT-C 13939030-CT-C *
13740790-T-A 11585114-T-A *
13468958-C-A 11313282-C-A *
22508592-G-T 20346706-G-T BY225478 DYZ19 *
4981838-GGTGT-G 5113797-GGTGT-G 14×GT*
9211247-AAC-A 9373638-AAC-A 18×AC*
13196330-A-T 11040654-A-T *
18577860-A-G 16465980-A-G YY*
18611646-TA-T 16499766-TA-T 9×A*
22679397-A-AT 20517511-A-AT 10×T*
56833346-C-T *
13468599-T-G 11312923-T-G *
13478361-G-A 11322685-G-A *
9951545-A-G 10113936-A-G Y*
13468033-G-A 11312357-G-A *
13468125-C-T 11312449-C-T *
23552738-C-CA 21390852-C-CA 9×A*
6837861-T-TA 6969820-T-TA 10×A*
13480412-C-A 11324736-C-A *
13214883-T-C 11059207-T-C *
13466301-G-T 11310625-G-T *
15431764-CT-C 13319884-CT-C 8×T*
13447137-CATTCCATTCCATTCCATTCT-C 11291461-CATTCCATTCCATTCCATTCT-C *
9951537-T-A 10113928-T-A Y*
9951463-C-G 10113854-C-G Y*
13461124-G-A 11305448-G-A *
5934597-A-AT 6066556-A-AT 9×T*
13462038-G-C 11306362-G-C *
10888034-T-A *
13463226-T-A 11307550-T-A *
13463222-G-A 11307546-G-A *
28617314-A-C 26471167-A-C *
13486861-C-A 11331185-C-A *
21889822-TA-T 19727936-TA-T 9×A*
10651691-A-G *
56826729-G-GTCCAT 4×TCCAT*
56860876-G-A *
27561716-C-CAA 25415569-C-CAA P1_Y2 16×A*
28549311-C-T 26403164-C-T *
21414510-A-AT 19252624-A-AT 10×T*
5252939-C-CA 5384898-C-CA 10×A*
9901684-CTT-C 10064075-CTT-C 12×T*
7328351-TAAA-T 7460310-TAAA-T 14×A*
28818962-G-A 26672815-G-A *
11035776-G-C *
13488928-C-T 11333252-C-T *
13488921-G-A 11333245-G-A *
19263448-T-A 17151568-T-A YY*
14071354-CTTTTTT-C,CTTTTT 11950648-CTTTTTT-C,CTTTTT 25×T*
4534038-AT-A 4665997-AT-A *
4903276-T-TA 5035235-T-TA 10×A*
23398947-GT-G 21237061-GT-G 9×T*
10686520-C-CCACTCCACTCCATTCCACTCCATTG *
4269122-G-GTT 4401081-G-GTT 15×T*
23201563-G-T 21039677-G-T Y*
10062593-G-A 10224984-G-A *
3201648-G-GA 3333607-G-GA 10×A*
13466313-A-C 11310637-A-C *
21855022-T-TA 19693136-T-TA 10×A*
10829714-C-A *
4485715-CTGTG-C 4617674-CTGTG-C 16×TG*
4687534-G-A 4819493-G-A *
28657147-GAAA-G 26511000-GAAA-G 14×A*
7237263-G-GAA 7369222-G-GAA 11×A*
13301535-T-G 11145859-T-G *
13486530-G-A 11330854-G-A *
10888026-C-G *
10763127-A-G *
10763126-C-T *
13486845-C-A 11331169-C-A *
10888043-A-T *
28708179-G-GT 26562032-G-GT 9×T*
7925833-G-GTTT 8057792-G-GTTT 11×T*
56847660-G-T *
5442529-TA-T 5574488-TA-T 10×A*
15964642-C-CTT 13852762-C-CTT 14×T*
6956695-C-CA 7088654-C-CA 9×A*
13488800-A-G 11333124-A-G *
16345113-G-A 14233233-G-A YY*
14864191-T-. 12752257-C-T *
13461043-A-T 11305367-A-T *
13460833-G-A 11305157-G-A *
13460821-T-A 11305145-T-A *
21969257-T-A 19807371-T-A YY*
58905097-T-A 56685774-A-T *
22476841-C-T 20314955-C-T DYZ19 *
13488491-G-T 11332815-G-T *
6595244-TCA-T 6727203-TCA-T 15×CA*
13486590-C-A 11330914-C-A *
17944647-G-GT 15832767-G-GT 10×T*
13479615-C-A 11323939-C-A *
13480332-G-C 11324656-G-C *
19102899-C-A 16991019-C-A YY*
23455611-CTAAA-C 21293725-CTAAA-C 5×TAAA*
56847853-T-C *
10780670-C-T *
56841238-T-C *
28673407-A-AT 26527260-A-AT 9×T*
13470862-G-T 11315186-G-T *
28763341-G-A 26617194-G-A *
13488692-T-A 11333016-T-A *
13480442-G-C 11324766-G-C *
58833951-T-A 56756920-A-T *
4658822-G-GA 4790781-G-GA 9×A*
13487927-G-T 11332251-G-T *
19721344-AT-A 17609464-AT-A P5_Prx 8×T*
18717876-TAAA-T 16605996-TAAA-T 16×A*
13488693-C-A 11333017-C-A *
4723901-TTG-T 4855860-TTG-T 8×TG*
16749737-TTTTTG-T 14637857-TTTTTG-T *
13637234-G-T 11481558-G-T *
23054258-G-GA 20892372-G-GA 9×A*
13486833-T-C 11331157-T-C *
13488801-A-C 11333125-A-C *
10942753-T-C *
10950494-CTCCAT-C *
9917182-G-T 10079573-G-T Y*
9917180-T-C 10079571-T-C Y*
9917172-G-A 10079563-G-A Y*
9917165-A-C 10079556-A-C Y*
9917147-T-A 10079538-T-A Y*
8272134-AT-A 8404093-AT-A 10×T*
13196320-A-C 11040644-A-C *
4030776-A-AT 4162735-A-AT 10×T*
10064277-G-C 10226668-G-C *
5595190-T-G 5727149-T-G *
5082124-A-G 5214083-A-G *
4405072-T-G 4537031-T-G *
3194426-C-G 3326385-C-G *
5634122-T-A 5766081-T-A *
13745416-A-T 11589740-A-T *
19098301-T-C 16986421-T-C Y*
13469216-T-A 11313540-T-A *
13564609-T-C 11408933-T-C FGC15049 *
13465386-G-C 11309710-G-C *
13393100-A-C 11237424-A-C *
10064281-C-A 10226672-C-A *
7195536-A-T 7327495-A-T S9943 YY*
13595418-T-G 11439742-T-G *
13460553-A-G 11304877-A-G *
13299483-G-A 11143807-G-A *
13299500-T-C 11143824-T-C *
13745377-A-T 11589701-A-T *
13745274-C-G 11589598-C-G *
18560153-G-GT 16448273-G-GT 38:26092490T>TA 8×T*
7587994-G-GA 7719953-G-GA 10×A*
4134484-C-CAA 4266443-C-CAA 18×A*
26400702-C-T 24254555-C-T P1_Y1 *
22475279-A-C 20313393-A-C BY43982 DYZ19 *
13282587-A-G 11126911-A-G *
5966753-A-C 6098712-A-C *
9509568-C-T 9671959-C-T *
13470183-G-A 11314507-G-A *
13302939-A-T 11147263-A-T *
13423071-A-G 11267395-A-G *
13415364-G-T 11259688-G-T *
13407110-C-G 11251434-C-G *
13406876-A-G 11251200-A-G *
13362513-AC-A 11206837-AC-A *
13354947-T-G 11199271-T-G *
13354933-G-C 11199257-G-C *
13346004-C-T 11190328-C-T *
13338555-A-G 11182879-A-G *
13304853-G-A 11149177-G-A *
13304280-CAAAT-C 11148604-CAAAT-C *
13302634-G-A 11146958-G-A *
9509573-T-A 9671964-T-A *
13277998-C-T 11122322-C-T *
13277992-G-A 11122316-G-A *
13264729-T-A 11109053-T-A Z37138 *
13264294-C-T 11108618-C-T *
13252626-C-T 11096950-C-T *
13242396-T-C 11086720-T-C *
13242372-G-C 11086696-G-C *
10075634-T-C 10238025-T-C *
10062563-G-C 10224954-G-C *
10057128-A-G 10219519-A-G *
9995971-T-C 10158362-T-C Y*
9942602-C-T 10104993-C-T Y*
13282580-A-G 11126904-A-G *
28580784-T-C 26434637-T-C CTS12350 *
13439252-A-G 11283576-A-G *
22503072-G-T 20341186-G-T DYZ19 *
10025187-C-G 10187578-C-G Y*
13470722-A-G 11315046-A-G *
22475030-G-T 20313144-G-T BY223268 DYZ19 *
7307479-T-TTA 7439438-T-TTA 8×TA*
28790613-A-G 26644466-A-G *
58974132-T-A 56827985-T-A *
13480643-C-A 11324967-C-A *
9958280-T-A 10120671-T-A Y*
13463884-G-T 11308208-G-T *
13463883-G-T 11308207-G-T *
13489299-G-A 11333623-G-A *
13458762-A-T 11303086-A-T *
13463232-G-T 11307556-G-T *
22491087-A-T 20329201-A-T DYZ19 *
22490722-C-T 20328836-C-T DYZ19 *
13718696-GAATGGAATGGAATCA-G 11563020-GAATGGAATGGAATCA-G *
22510612-G-A 20348726-G-A DYZ19 *
13866670-G-A 11745964-G-A *
24205482-ATG-A 22059335-ATG-A P3_b1 15×TG*
13745448-T-G 11589772-T-G *
13745446-A-C 11589770-A-C *
13485749-C-G 11330073-C-G *
22270017-G-A 20108131-G-A DYZ19 *
22270016-A-C 20108130-A-C DYZ19 *
16715034-GGT-G 14603154-GGT-G 10×GT*
10025203-C-T 10187594-C-T Y*
6941484-TTCTC-T 7073443-TTCTC-T 13×TC*
13510281-T-C 11354605-T-C *
9149547-G-GAA 9311938-G-GAA 11×A*
6776606-AAC-A 6908565-AAC-A 9×AC*
22509112-C-A 20347226-C-A DYZ19 *
13484666-G-T 11328990-G-T *
13715153-A-C 11559477-A-C *
13485025-T-G 11329349-T-G *
15255769-GGTGTGTGT-G 13143855-GGTGTGT-G 24×GT*
16057666-CTTTT-C 13945786-CTTTT-C 15×T*
13484523-T-G 11328847-T-G *
19103869-G-GT 16991989-G-GT 10×T*
13734111-G-A 11578435-G-A *
8716918-AT-A 8848877-AT-A 10×T*
58876743-CTCATT-C 56714122-GAATGA-G *
13485041-G-C 11329365-G-C *
13958584-C-CA 11837878-C-CA 9×A*
10025263-G-A 10187654-G-A Y*
10025277-T-C 10187668-T-C Y*
19098286-A-T 16986406-A-T Y*
13484526-C-A 11328850-C-A *
13423091-A-T 11267415-A-T *
10043459-G-A 10205850-G-A *
13688911-G-A 11533235-G-A *
22505681-A-T 20343795-A-T DYZ19 *
3074007-G-A 3205966-G-A 13×A*
22466041-G-T 20304155-G-T FT458642 DYZ19 *
7542819-G-GA 7674778-G-GA 10×A*
13476405-G-A 11320729-G-A *
13439250-T-G 11283574-T-G *
13451155-T-TTCCATTACAC 11295479-T-TTCCATTACAC *
13476926-C-T 11321250-C-T *
13515549-T-A 11359873-T-A *
13718569-T-C 11562893-T-C BY211352 *
13692047-T-A 11536371-T-A *
13692030-T-C 11536354-T-C *
13598033-G-A 11442357-G-A *
13592968-C-T 11437292-C-T *
13566336-C-G 11410660-C-G *
13565182-A-G 11409506-A-G *
13564612-G-A 11408936-G-A *
13563885-A-G 11408209-A-G *
13563875-T-G 11408199-T-G *
13524270-C-A 11368594-C-A *
13514513-G-A 11358837-G-A FT333355 *
15791519-C-T 13679639-C-T Y5549 FGC32240 YY*
13488362-C-A 11332686-C-A BY46510 *
13485419-T-C 11329743-T-C *
13480452-A-C 11324776-A-C *
13474755-A-C 11319079-A-C *
13473832-G-A 11318156-G-A *
13461315-A-T 11305639-A-T *
13451234-CTCCAT-C 11295558-CTCCAT-C *
13446248-A-T 11290572-A-T *
13415434-G-A 11259758-G-A *
13415400-T-C 11259724-T-C *
13404362-C-T 11248686-C-T *
13403991-C-A 11248315-C-A *
14375114-AAG-A 12254410-AAG-A *
16673462-G-T 14561582-G-T Y*
13399269-T-C 11243593-T-C *
13474788-T-A 11319112-T-A *
13463234-C-T 11307558-C-T *
17003410-G-GTA 14891530-G-GTA *
24080169-TA-T 21934022-TA-T P3_b1 11×A*
22476803-A-C 20314917-A-C DYZ19 *
23557682-GA-G 21395796-GA-G 10×A*
22473342-G-T 20311456-G-T DYZ19 *
13460822-G-T 11305146-G-T *
8199579-TA-T 8331538-TA-T 10×A*
16646648-CGTGT-C 14534768-CGTGT-C 19×GT*
25698641-ATG-A 23552494-ATG-A P1_b3 8×TG*
10075704-T-C 10238095-T-C *
58990046-A-C 56843899-A-C *
19496199-A-AT 17384319-A-AT 9×T*
13496647-G-A 11340971-G-A *
59029675-G-A 56883528-G-A *
59014004-C-T 56867857-C-T *
59007016-A-C 56860869-A-C *
28709497-C-T 26563350-C-T *
22512117-C-A 20350231-C-A DYZ19 *
22508092-G-T 20346206-G-T BY225433 DYZ19 *
22475863-A-C 20313977-A-C DYZ19 *
22475851-A-G 20313965-A-G DYZ19 *
22475053-T-G 20313167-T-G Z23635 DYZ19 *
22207577-GA-G 20045691-GA-G 8×A*
21927924-T-A 19766038-T-A Y31874Z8252 FGC7775 YY*
13399280-T-C 11243604-T-C *
13399159-G-A 11243483-G-A *
13497485-T-C 11341809-T-C *
22476834-T-G 20314948-T-G DYZ19 *
10064180-G-A 10226571-G-A *
10064169-T-G 10226560-T-G *
58866121-T-C 56724750-A-G *
13468133-T-C 11312457-T-C *
13437877-T-G 11282201-T-G *
13472096-G-T 11316420-G-T *
6273754-G-A 6405713-G-A FGC47151 IR3_Dst *
58983155-CTGCACTCCACTCAAT-C 56837008-CTGCACTCCACTCAAT-C *
58974887-ATTCC-A 56828740-ATTCC-A *
28709481-A-G 26563334-A-G *
22476835-T-A 20314949-T-A Z16229 DYZ19 *
22475874-T-A 20313988-T-A DYZ19 *
10064274-G-T 10226665-G-T *
22475865-T-A 20313979-T-A DYZ19 *
18992894-T-C 16881014-T-C CTS9618 PF3786 V3671 YY*
14667840-AC-A 12555906-AC-A *
14646409-C-T 12534473-C-T PF3712 CTS3076 YY*
14198038-GCA-G 12077332-GCA-G 8×CA*
13635933-C-T 11480257-C-T ZS7777 *
13635107-C-G 11479431-C-G *
13635105-C-T 11479429-C-T *
13524761-C-T 11369085-C-T *
13524752-G-T 11369076-G-T *
13519432-T-G 11363756-T-G *
13508603-G-A 11352927-G-A *
10064260-C-T 10226651-C-T BY3656 *
13480927-C-A 11325251-C-A *
13314946-G-A 11159270-G-A *
5632507-T-C 5764466-T-C *
13302791-A-G 11147115-A-G *
13285803-C-T 11130127-C-T *
13265530-G-T 11109854-G-T *
13265412-A-AT 11109736-A-AT *
13264717-G-T 11109041-G-T ZS7975 *
13262844-C-T 11107168-C-T *
13260145-A-T 11104469-A-T *
13259400-T-G 11103724-T-G *
9962099-T-A 10124490-T-A Y*
9941730-G-C 10104121-G-C Y*
9941192-A-G 10103583-A-G Y*
6605909-C-A 6737868-C-A *
5567660-G-A 5699619-G-A *
22316789-G-T 20154903-G-T A5965 DYZ19 *
5345475-G-A 5477434-G-A Z4807 *
4439006-C-T 4570965-C-T FT320656 *
2933060-C-G 3065019-C-G BY57300 *
7206562-C-CT 7338521-C-CT 10×T*
9954759-C-T 10117150-C-T Y*
9954751-G-A 10117142-G-A BY82145 Y*
9954750-T-G 10117141-T-G FGC25949 FT125378 Y*
22475695-A-G 20313809-A-G BY46154 DYZ19 *
22475023-C-A 20313137-C-A DYZ19 *
22475014-T-G 20313128-T-G DYZ19 *
13473949-A-G 11318273-A-G *
58998258-A-G 56852111-A-G *
13482366-A-T 11326690-A-T *
13489032-G-A,C 11333356-G-A,C *
13473473-C-A 11317797-C-A *
13451161-T-TCCA 11295485-T-TCCA *
13607821-ATT-A 11452145-ATT-A 10×T*
13489886-C-G 11334210-C-G *
13489697-GTGCCC-G 11334021-GTGCCC-G *
13489625-ACCAC-A 11333949-ACCAC-A *
13489556-T-A 11333880-T-A *
13484960-C-T 11329284-C-T *
13484662-C-A 11328986-C-A *
13480879-G-T 11325203-G-T *
13474281-A-C 11318605-A-C *
13472110-T-C 11316434-T-C *
13461996-G-A 11306320-G-A *
13449956-C-CCCGTT 11294280-C-CCCGTT *
22447435-C-G 20285549-C-G DYZ19 *
13406875-T-A 11251199-T-A *
13196196-T-A 11040520-T-A FT258103 *
10693240-A-AC *
10693203-TCTCTCCATTCCATTCCATTCCATTAGATTCCATTCC-T *
10693152-TCCACACCACTACACTCCACTACACTACACTCCCTGCCATTCCATC-T *
10693067-TGCACTCCATTCCACTCCACTCCACTCCACCCCACTCCACTCCATTAAATCCCAATCCATTCCATTCCACTCCATC-T *
10693054-TTCA-T *
13566828-A-G 11411152-A-G *
13481452-A-G 11325776-A-G *
13466797-T-C 11311121-T-C *
13407107-T-A 11251431-T-A *
13407103-A-T 11251427-A-T *
13711745-AATGGAACGGAATGGAATTAAATGGAACGGAATGGAATGGC-A 11556069-AATGGAACGGAATGGAATTAAATGGAACGGAATGGAATGGC-A *
28780939-T-C 26634792-T-C *
9945343-T-C 10107734-T-C Y*
13487975-C-A 11332299-C-A *
13462060-G-A 11306384-G-A *
13460615-A-T 11304939-A-T *
56884636-C-CA *
22255932-TGCTCAGTTCAAGAAAGAATGAAGCTGCAGACATTTACGGTGAGTGTTACAGCACTTAAAGTTGTTATATCCAGAGTTTGTTCCTTCAGATGTGTCCACAGTTTTTTTCTTCTGGCAGTTTCATGGTCTA-T 20094046-TGCTCAGTTCAAGAAAGAATGAAGCTGCAGACATTTACGGTGAGTGTTACAGCACTTAAAGTTGTTATATCCAGAGTTTGTTCCTTCAGATGTGTCCACAGTTTTTTTCTTCTGGCAGTTTCATGGTCTA-T DYZ19 *
13707133-G-C 11551457-G-C *
13707121-T-G 11551445-T-G *
13707076-T-TG 11551400-T-TG *
13695331-G-A 11539655-G-A BY88908 *
13695328-A-G 11539652-A-G *
13688233-A-AACGTG 11532557-A-AACGTG *
13489801-GCCCC-G 11334125-GCCCC-G *
13487953-C-A 11332277-C-A *
28813084-G-T 26666937-G-T BY55623 *
13486543-T-A 11330867-T-A *
13484954-C-T 11329278-C-T *
13478506-G-A 11322830-G-A *
13476660-A-G 11320984-A-G *
13470610-C-T 11314934-C-T *
13460513-GC-G 11304837-GC-G *
13454570-T-G 11298894-T-G *
10693383-C-CACTCCACTCCACTCCAT *
9933478-AGGATTGCCTTG-A 10095869-AGGATTGCCTTG-A *
56841251-A-AT *
56831433-G-GCATTCCATCCCACTC *
28813877-C-T 26667730-C-T *
10908296-C-T *
9909033-A-T 10071424-A-T Y*
22256103-A-T 20094217-A-T DYZ19 *
4020761-TAA-T 4152720-TAA-T 12×A*
13923752-TA-T 11803046-TA-T 8×A*
13489910-C-A 11334234-C-A *
13480303-C-A 11324627-C-A *
21135869-CT-C 18973983-CT-C 9×T*
13480351-T-A 11324675-T-A *
13439050-A-G 11283374-A-G *
56823040-G-A *
13718942-C-T 11563266-C-T *
13492395-A-AG 11336719-A-AG *
28812778-G-A 26666631-G-A *
28812777-G-T 26666630-G-T *
13476558-C-T 11320882-C-T *
13476528-C-G 11320852-C-G *
13947662-CAAAA-C 11826956-CAAAA-C 15×A*
28792816-G-T 26646669-G-T *
22475305-G-T 20313419-G-T DYZ19 *
13443755-C-G 11288079-C-G *
13470046-C-T 11314370-C-T *
13476532-CA-C 11320856-CA-C *
13260081-A-T 11104405-A-T *
28780935-C-T 26634788-C-T *
22447488-G-T 20285602-G-T DYZ19 *
13718252-A-G 11562576-A-G *
13590731-A-G 11435055-A-G *
13590730-C-T 11435054-C-T *
13348109-G-C 11192433-G-C *
22288244-C-A 20126358-C-A DYZ19 *
22476829-T-G 20314943-T-G DYZ19 *
13390134-C-T 11234458-C-T *
22475883-T-A 20313997-T-A DYZ19 *
9995053-G-C 10157444-G-C Y*
9995047-G-A 10157438-G-A Y*
22508701-G-A 20346815-G-A DYZ19 *
10062553-AG-A 10224944-AG-A *
5007689-CA-C,CAA 5139648-CA-C,CAA 22×A*
3174374-CT-C,CTT 3306333-CT-C,CTT 18×T*
13476609-T-A,G 11320933-T-A,G *
13479242-G-A 11323566-G-A *
13479211-G-A 11323535-G-A *
13476529-TC-T 11320853-TC-T *
17332750-CAAAAA-C,CAAAAAA 15220870-CAAAAA-C,CAAAAAA 22×A*
2844487-GA-G 2976446-GA-G 8×A*
22193279-C-A 20031393-C-A Y*
28586262-C-A 26440115-C-A *
14491206-C-CA 12370475-C-CA *
14491198-AT-A 12370467-AT-A *
13244129-G-A 11088453-G-A *
22446683-G-T 20284797-G-T DYZ19 *
22475895-C-T 20314009-C-T BY47356 DYZ19 *
14646262-C-G 12534326-C-G YY*
13482272-T-A 11326596-T-A *
20104256-G-GGA 17992376-G-GGA P5_Dst 22×GA*
9943642-G-T 10106033-G-T Y*
13479068-G-T 11323392-G-T *
7483638-TAA-T 7615597-TAA-T IR1_L 23×A*
13480974-C-T 11325298-C-T *
22256106-T-G 20094220-T-G DYZ19 *
13590701-G-A 11435025-G-A *
22129230-GA-G 19967344-GA-G *
13475337-A-AAG 11319661-A-AAG *
13475325-T-G 11319649-T-G *
9946145-CTA-C 10108536-CTA-C *
22048230-CA-C,C 19886344-CA-C,C 15×A*
13480952-A-T 11325276-A-T *
13480951-C-G 11325275-C-G *
16015497-A-T 13903617-A-T Y*
10062592-C-CAA 10224983-C-CAA *
13489885-C-CG 11334209-C-CG *
9320496-TA-T,T 9482887-TA-T,T 10×A*
6091720-AT-A,A 6223679-AT-A,A 28×T*
56833367-A-ATTCCATTCCATTCTACTCCATTCCATTCCG *
22440111-G-T 20278225-G-T DYZ19 *
56711018-A-T *
13487755-AACCCCC-A 11332079-AACCCCC-A *
13476652-A-C 11320976-A-C *
13476303-GAGATATGTCACAATGCCCCCATGGGCAGAGCCTAGAATAAAGTCCCATCAGCTGGGTGATCAGTGTAGAGATATGTCACAAAGCCCTGTAA-G 11320627-GAGATATGTCACAATGCCCCCATGGGCAGAGCCTAGAATAAAGTCCCATCAGCTGGGTGATCAGTGTAGAGATATGTCACAAAGCCCTGTAA-G *
13468588-C-G 11312912-C-G *
10888049-C-CCTCACTCCAG *
13489750-G-GCCT 11334074-G-GCCT *
13479044-C-A 11323368-C-A *
13479027-C-A 11323351-C-A *
13479023-C-A 11323347-C-A *
13468962-G-A 11313286-G-A *
13468473-G-C 11312797-G-C *
13475338-GTT-G 11319662-GTT-G *
22484119-C-G 20322233-C-G DYZ19 *
9938128-C-T 10100519-C-T Y*
13465169-C-T 11309493-C-T *
22446741-T-A 20284855-T-A DYZ19 *
13374073-A-C 11218397-A-C *
13374072-A-T 11218396-A-T *
13244139-G-T 11088463-G-T *
13734821-G-C 11579145-G-C *
13449142-A-AGTC 11293466-A-AGTC *
56884030-G-A *
22466062-G-T 20304176-G-T DYZ19 *
22466033-A-G 20304147-A-G DYZ19 *
13473913-C-A 11318237-C-A *
13473910-G-T 11318234-G-T *
13390081-T-C 11234405-T-C *
22508404-T-TAATGAAGCTGCAGACCTTACTGGTGAGTGTTACAGCACTTAAAGGTGTTATGTCCAGAGTTTGTTCCTTCAGATGTGTCCAGAGTGTCTTCTTTCTGGCAGGTTCATGGTCTTGCTCACTTCACC 20346518-T-TAATGAAGCTGCAGACCTTACTGGTGAGTGTTACAGCACTTAAAGGTGTTATGTCCAGAGTTTGTTCCTTCAGATGTGTCCAGAGTGTCTTCTTTCTGGCAGGTTCATGGTCTTGCTCACTTCACC DYZ19 *
13700983-GAACTGGAAGT-G 11545307-GAACTGGAAGT-G *
13487946-G-C 11332270-G-C *
10025687-T-C 10188078-T-C Y*
9992607-A-G 10154998-A-G Y*
22474771-TCACTTCAAGAACGAAGCTGCAGACCTTTGCGGTGAGTGATACAACACCGAAAGGTGTTATATCCAGAGTTTGTTCCTTCAGATGTGTCCAGAGTTTCTTCCTTCTGTCAGGTTCACGGTCTTGC-T 20312885-TCACTTCAAGAACGAAGCTGCAGACCTTTGCGGTGAGTGATACAACACCGAAAGGTGTTATATCCAGAGTTTGTTCCTTCAGATGTGTCCAGAGTTTCTTCCTTCTGTCAGGTTCACGGTCTTGC-T DYZ19 *
22474769-GC-G 20312883-GC-G DYZ19 *
22235565-AAACTTTTAAGTGCTGTAACACTCAC-A 20073679-AAACTTTTAAGTGCTGTAACACTCAC-A DYZ19 *
13490676-A-G 11335000-A-G *
13479218-C-T 11323542-C-T *
13478483-T-TTC 11322807-T-TTC *
13470060-G-A 11314384-G-A *
10994451-CCATTA-C *
10908299-CCT-C *
13479580-T-A 11323904-T-A *
22256109-A-G 20094223-A-G DYZ19 *
10057167-T-G 10219558-T-G *
22511793-A-G 20349907-A-G BY225774 DYZ19 *
22511792-G-C 20349906-G-C DYZ19 *
22511759-C-A 20349873-C-A DYZ19 *
22505752-G-A 20343866-G-A DYZ19 *
13707423-GAATGGAATGGAATCA-G 11551747-GAATGGAATGGAATCA-G *
13479066-T-A 11323390-T-A *
13460517-C-G 11304841-C-G *
13451165-T-C,TCCACTCCAC 11295489-T-C,TCCACTCCAC *
13451164-A-AC 11295488-A-AC *
13451162-C-CCACTCCACTCCACTGCACTT 11295486-C-CCACTCCACTCCACTGCACTT *
13436740-TTA-T 11281064-TTA-T *
10057157-A-G 10219548-A-G *
56850025-A-G *
22484115-G-A 20322229-G-A BY224553 DYZ19 *
14646228-A-G 12534292-A-G YY*
14646227-C-T 12534291-C-T YY*
13740226-T-A 11584550-T-A *
13479085-C-T 11323409-C-T *
13466450-G-A 11310774-G-A *
13340852-A-G 11185176-A-G *
13205596-AT-A,A 11049920-AT-A,A *
56833893-G-GTCCACT,T *
56833892-C-CTCCATTCCA *
22484094-G-A 20322208-G-A DYZ19 *
22484076-T-C 20322190-T-C DYZ19 *
22511802-G-A 20349916-G-A DYZ19 *
56850026-TCA-T *
13272462-A-G 11116786-A-G *
13471852-T-TCA 11316176-T-TCA *
10624743-A-G *
14363164-ATTTT-A 12242459-ATTTT-A 16×T*
13470618-GA-G 11314942-GA-G *
13489874-T-A 11334198-T-A *
13469971-G-A 11314295-G-A *
22508781-A-T 20346895-A-T DYZ19 *
22508768-C-T 20346882-C-T DYZ19 *
13482243-G-C 11326567-G-C *
13482187-A-G 11326511-A-G *
13480773-C-A 11325097-C-A *
13479579-C-A 11323903-C-A *
13478733-A-T 11323057-A-T *
13489907-C-T 11334231-C-T *
10965251-T-C *
26488166-TAA-T 24342019-TAA-T P1_Y1 15×A*
13475372-T-A 11319696-T-A *
13470054-G-T 11314378-G-T *
13449960-T-TTCCATTCCATACCATTCCATTCCATTGCATTCCACTCCATTCCACTCCACTCCAATCAACTCCGCTCCACTCCACTCCACTTCACTCCAATCCACTCCAC 11294284-T-TTCCATTCCATACCATTCCATTCCATTGCATTCCACTCCATTCCACTCCACTCCAATCAACTCCGCTCCACTCCACTCCACTTCACTCCAATCCACTCCAC *
13406891-G-A 11251215-G-A *
13351354-T-C 11195678-T-C *
10829717-T-C *
28813170-TCAAATGGAATG-T 26667023-TCAAATGGAATG-T *
13484941-C-G 11329265-C-G *
13469191-C-A 11313515-C-A *
13269594-CAAA-C 11113918-CAAA-C *
10965253-G-C *
13590702-C-T 11435026-C-T *
13525748-A-G 11370072-A-G *
28804041-G-C 26657894-G-C *
13488495-G-A 11332819-G-A *
58858906-C-G 56731965-G-C *
13252783-G-GT 11097107-G-GT 11×T*
13532037-G-A 11376361-G-A *
3349229-CAAAAA-C 3481188-CAAAAA-C 22×A*
13480916-C-A 11325240-C-A *
16945576-T-C 14833696-T-C YY*
13467998-G-C 11312322-G-C *
13482068-A-G 11326392-A-G *
13482064-C-T 11326388-C-T *
7236789-CAA-C 7368748-CAA-C 13×A*
9951062-C-CA 10113453-C-CA 9×A*
13438425-T-A 11282749-T-A *
13441704-T-C 11286028-T-C *
13268112-A-G 11112436-A-G *
13196234-A-T 11040558-A-T *
13698483-G-T 11542807-G-T *
4686573-CAAAA-C 4818532-CAAAA-C 15×A*
23042062-C-CT 20880176-C-CT 9×T*
13461051-C-G 11305375-C-G *
8119086-C-A 8251045-C-A YY*
15556926-C-A 13445046-C-A YY*
10984544-C-A *
6129765-G-GT 6261724-G-GT 10×T*
23395817-G-T 21233931-G-T YY*
17056677-G-A 14944797-G-A YY*
22488242-T-G 20326356-T-G DYZ19 *
13698610-C-A 11542934-C-A *
13480865-C-T 11325189-C-T *
13480922-C-G 11325246-C-G *
13464494-T-C 11308818-T-C *
7761203-C-A 7893162-C-A YY*
13214904-A-G 11059228-A-G *
56763589-T-C *
13478412-C-A 11322736-C-A *
13487342-C-T 11331666-C-T *
13462036-G-C 11306360-G-C *
13487956-G-A 11332280-G-A *
28780940-G-T 26634793-G-T *
28617306-G-A 26471159-G-A *
56724874-T-A *
13468439-G-A 11312763-G-A *
11026246-A-AC *
10829713-C-A *
13462016-C-T 11306340-C-T *
27264837-TAA-T 25118690-TAA-T P1_g3 12×A*
13474562-C-T 11318886-C-T *
23516455-A-G 21354569-A-G YY*
16842880-T-C 14731000-T-C Y*
13480395-C-T 11324719-C-T *
19045687-CTTT-C,CTT 16933807-CTTT-C,CTT 17×T*
23304360-C-A 21142474-C-A YY*
22723058-T-TA 20561172-T-TA 10×A*
5497125-T-C 5629084-T-C *
13576122-C-CTT 11420446-C-CTT 14×T*
25080053-C-A 22933906-C-A g1 20×A*
10909682-C-T FT436252 *
7217717-T-C 7349676-T-C Y*
13466451-A-G 11310775-A-G *
13715022-G-C 11559346-G-C *
13498288-C-T 11342612-C-T *
13486578-C-T 11330902-C-T *
9985135-G-A 10147526-G-A Y*
56854792-C-G *
22008233-G-A 19846347-G-A YY*
13489179-G-T 11333503-G-T *
21549183-GT-G,GTT 19387297-GT-G,GTT 17×T*
13698482-G-T 11542806-G-T *
5923503-G-GT 6055462-G-GT 9×T*
13374084-C-G 11218408-C-G *
10020964-ACT-A 10183355-ACT-A *
13498392-A-T 11342716-A-T *
28799792-G-A 26653645-G-A *
13482349-G-T 11326673-G-T *
13469077-T-A 11313401-T-A *
13698461-T-G 11542785-T-G *
19127858-C-CAA 17015978-C-CAA 17×A*
14488618-C-A 12367887-C-A YY*
8533867-CAA-C 8665826-CAA-C 13×A*
3134396-A-AT 3266355-A-AT 9×T*
56843895-G-T *
11034908-A-T *
5969151-C-A 6101110-C-A *
19163178-TA-T 17051298-TA-T 8×A*
13482328-A-G 11326652-A-G *
28812773-G-A 26666626-G-A A4535 *
9207198-G-GA 9369589-G-GA 10×A*
23597906-ATATT-A 21436020-ATATT-A 5×TATT*
13708683-T-A 11553007-T-A *
5418148-GAA-G 5550107-GAA-G 14×A*
13474553-T-A 11318877-T-A *
13469970-G-C 11314294-G-C *
5364687-G-GTT 5496646-G-GTT 12×T*
13480295-C-A 11324619-C-A *
10894465-G-C *
13698568-G-A 11542892-G-A *
58876785-C-A 56714086-G-T *
58876784-C-A 56714087-G-T *
22510208-C-G 20348322-C-G DYZ19 *
22510157-T-C 20348271-T-C DYZ19 *
10767823-C-T *
56727858-C-G *
13460883-A-G 11305207-A-G *
28806419-G-T 26660272-G-T *
28806418-G-T 26660271-G-T *
7886496-GA-G 8018455-GA-G *
13460847-C-A 11305171-C-A *
13480416-G-C 11324740-G-C *
14566770-CAAA-C 12454970-CAAA-C 13×A*
13314853-T-C 11159177-T-C FGC81665 *
13389941-G-A 11234265-G-A *
13269599-A-C 11113923-A-C *
13262836-C-A 11107160-C-A *
15175701-C-T 13063787-C-T YY*
18606231-G-A 16494351-G-A YY*
5612184-C-A 5744143-C-A FGC69301 *
3194380-A-AT 3326339-A-AT 9×T*
28813021-G-A 26666874-G-A *
18765469-T-A 16653589-T-A YY*
17379962-C-G 15268082-C-G YY*
13485757-C-T 11330081-C-T *
13465219-C-A 11309543-C-A *
13514442-C-T 11358766-C-T *
13480921-G-C,T 11325245-G-C,T *
10047939-C-T 10210330-C-T *
10047953-T-A 10210344-T-A *
10047935-C-A 10210326-C-A *
10047948-G-A 10210339-G-A *
13245065-G-GTCTTGCTC 11089389-G-GTCTTGCTC *
22444150-G-C 20282264-G-C DYZ19 *
28792815-T-G 26646668-T-G *
22444099-C-G 20282213-C-G FT456762 DYZ19 *
13690155-A-C 11534479-A-C *
13590560-G-A 11434884-G-A *
13506616-A-G 11350940-A-G *
13489228-G-T 11333552-G-T *
13489203-C-T 11333527-C-T *
13434973-T-A 11279297-T-A *
13245147-T-G 11089471-T-G *
13245130-G-T 11089454-G-T *
10908302-G-A *
10039721-C-G 10202112-C-G *
9980343-A-T 10142734-A-T Y*
18765472-T-A 16653592-T-A YY*
13488399-G-T 11332723-G-T *
9909093-T-C 10071484-T-C Y*
13595227-G-T 11439551-G-T *
13470643-G-T 11314967-G-T *
4439007-G-A 4570966-G-A *
28813052-G-T 26666905-G-T *
13444829-T-C 11289153-T-C *
13734378-A-T 11578702-A-T *
13709953-T-TTAATA 11554277-T-TTAATA 4×GAATG*
13595233-A-G 11439557-A-G *
13513400-A-G 11357724-A-G *
13370192-G-A 11214516-G-A *
9946151-A-G 10108542-A-G Y*
27461936-TTGTG-T,TTG 25315789-TTGTG-T,TTG P1_Y2 27×TG*
13395042-C-T 11239366-C-T *
15499049-TA-T 13387169-TA-T 10×A*
10062643-C-G 10225034-C-G *
10062638-A-T 10225029-A-T *
10062628-T-G 10225019-T-G *
13462049-C-T 11306373-C-T *
13478527-G-T 11322851-G-T *
13478526-G-T 11322850-G-T *
21394405-C-T 19232519-C-T Y*
13482338-A-G 11326662-A-G *
4158086-AT-A 4290045-AT-A 10×T*
3016070-C-T 3148029-C-T *
16282398-C-CAA 14170518-C-CAA 24×A*
3873186-CA-C,CAA 4005145-CA-C,CAA 15×A*
9909108-A-C 10071499-A-C Y*
28816464-G-C 26670317-G-C *
22475280-G-T 20313394-G-T DYZ19 *
15718003-A-T 13606123-A-T YY*
9936675-C-G 10099066-C-G Y*
6732853-T-A 6864812-T-A YY*
6732850-T-A 6864809-T-A YY*
4123962-G-A 4255921-G-A *
13487921-T-G 11332245-T-G *
3301243-T-TTA 3433202-T-TTA 8×TA*
13476593-A-T 11320917-A-T *
13467601-T-A 11311925-T-A *
5552459-T-TA 5684418-T-TA 11×A*
13470088-C-T 11314412-C-T *
4439012-T-G 4570971-T-G *
23007895-A-G 20846009-A-G Y*
9951552-A-G 10113943-A-G Y*
13473864-C-A 11318188-C-A *
56862621-CTTT-C,CT 14×T*
13461999-T-A 11306323-T-A *
13462191-A-C 11306515-A-C *
13523622-C-CAAA 11367946-C-CAAA *
13461071-T-A 11305395-T-A *
14219726-A-AG 12099020-A-AG *
13698579-A-G 11542903-A-G *
10763137-A-T *
13476642-C-A 11320966-C-A *
18577872-T-C 16465992-T-C YY*
6603793-CT-C 6735752-CT-C 10×T*
9936695-T-C 10099086-T-C Y*
10062556-C-A 10224947-C-A *
22484047-C-G 20322161-C-G DYZ19 *
13514483-T-G 11358807-T-G *
22484034-T-A 20322148-T-A DYZ19 *
22366412-C-A 20204526-C-A DYZ19 *
14951423-T-A 12839497-T-A YY*
13745304-A-G 11589628-A-G 7×GAATG*
13689194-CTGAATCAAAT-C 11533518-CTGAATCAAAT-C *
13590554-C-T 11434878-C-T *
13539196-G-T 11383520-G-T *
13533794-A-G 11378118-A-G *
13533793-A-G 11378117-A-G *
13524750-C-T 11369074-C-T *
13514506-A-C 11358830-A-C *
13514493-T-G 11358817-T-G *
13502936-A-C 11347260-A-C *
10651713-A-T *
13488382-G-C 11332706-G-C *
13487911-C-G 11332235-C-G *
13487904-G-A 11332228-G-A *
13482161-A-T 11326485-A-T *
13481476-C-A 11325800-C-A *
13480963-G-A 11325287-G-A *
13439340-C-T 11283664-C-T *
13439247-A-G 11283571-A-G *
13439235-T-G 11283559-T-G *
13436739-G-C 11281063-G-C *
10823124-T-C *
10654531-C-CCTA *
56886578-C-A *

In the table above, the meaning of the confidence field depends on whether the data comes from an FTDNA kit or an FGC kit. For FTDNA kits, + implies a "PASS" result with just one possible variant, * indicates a "PASS" but with multiple variants, ** indicates "REJECTED" with just a single variant, and *** indicates "REJECTED" with multiple possible variants. 'A*' are heterozygous variants not called by FTDNA, but still pulled from the VCF file. For FGC kits, + indicates over 99% likely genuine (95% for INDELs); * over 95% likely genuine (90% for INDELs); ** about 40% likely genuine; *** about 10% likely genuine. Manual entries read directly from a BAM file will be either + indicating positive, or * indicating that the data show a mixture of possible variants.

For the FTDNA kits, the BED data is encoded in the background color of the cells. Those cells with a white background have coverage, those with a grey background indicate no coverage in the BED file, and those with a pink background indicate the mutation is on the edge of a coverage region. These pink regions often indicate that the individual may be positive for a SNP even if there is no corresponding entry in the vcf file.

The combBED column indicates whether or not the mutation is a SNP and falls in the combBED region defined in Defining a New Rate Constant for Y-Chromosome SNPs based on Full Sequencing Data by Dmitry Adamov, Vladimir Guryanov, Sergey Karzhavin, Vladimir Tagankin, Vadim Urasin.

The McDonald BED column indicates whether or not the mutation is a SNP and falls in the BED region used by Dr. Iain McDonald in the age analysis he does for R-U106 men.

Age Analysis Information (work in progress)

AllMcDonaldYFull
Kit: B55921497451491127128041626
Used in age calculations1497451491127128041626
Counts of SNPs445268
Variant counts last updated 2022-07-30 03:53:37.



Big Tree Main Page