Tree Position

R-P312/S116 > Z40481 > ZZ11 > U152/S28 > L2/S139 > Z367/S255 > L20/S144 > Z46420 > S3856 > S1505 > BY3579 > BY3555

Unique Mutations

The mutations unique to this man are summarized in the table below. Those with a '+' or '*' confidence level are considered by FamilyTreeDNA or FullGenomesCorp to be high quality SNPs/INDELs. For completeness, all other mutations of lesser confidence are included as well. These additional mutations may be useful for distinguishing between very closely related men.

Occasionally, some of the mutations listed here will be thought to be shared with other men in which case they might appear in upstream blocks on the tree. When this happens, the 'Blocks' field will indicate what block they appear in. Such a situation might arise with BigY men if the BED data suggests another man may be positive for a SNP, even though it doesn't appear in his VCF data. It might also happen if Chromo2 testing or Sanger sequencing of other men not on the tree show the SNP to be shared.

POS-REF-ALT (hg19) POS-REF-ALT (hg38) Blocks Names Region McDonald BED combBED STRYDW-Kane-Dante
7EK9X73D
9668873-C-T 9831264-C-T IR3_Prx +
10961464-A-G +
2984958-A-C 3116917-A-C +
22319293-C-CAA 20157407-C-CAA DYZ19 +
13734143-AATGTC-A 11578467-AATGTC-A +
8950-C-G FGC78348 +
56677924-G-T +
56728971-G-A +
15865946-CTTTTTTTTTTTTTTTTTTT-C 13754066-CTTTTTTTTTTTTTTTTTTT-C 37×T+
5410169-AT-A 5542128-AT-A +
10961473-A-T +
10961457-ATTCCTC-A +
10961480-TCTACTCCATTCCACTCAATA-T +
6347777-GGAAA-G 6479736-GGAAA-G 9×GAAA+
22503111-G-C 20341225-G-C DYZ19 +
13446527-CTCCAT-C 11290851-CTCCAT-C 16×TCCAT+
17066435-C-A 14954555-C-A Y+
28802866-C-G 26656719-C-G FGC62033 +
17161841-T-C 15049961-T-C Y+
10756717-T-TCTGAA +
28802867-T-TTGA 26656720-T-TTGA +
10756701-A-T +
13370-GGTTCATGGTCTTGCTCACTTCAAGAATGAAGCTGCAGACCTTTACGGTGAGTGTTACAACACTTAAAGGTGTTATGTCCAGAGTTTGTTCCTCTGGATGTGTCCAGAGTTTCGTCCTTCTGGCAA-G +
11023178-C-T +
14755-G-GTCAT +
56769016-A-C +
56858432-AGAAAGAAG-A 5×GAAAGAAG+
11028340-T-TTCACCATTCCATTGCATTCCATTCCATCCAATTCTATTCCA +
14751-TGGGG-T +
11023215-C-G +
10000546-G-A 10162937-G-A Y+
16480214-TATA-T 14368334-TATA-T +
11023183-TGCCATTTCAC-T +
23092976-G-A 20931090-G-A Y+
22425919-C-T 20264033-C-T DYZ19 *
10082061-A-T 10244452-A-T *
28810261-G-C 26664114-G-C *
10934294-T-TA *
23828091-G-C 21666205-G-C Y*
10082071-A-T 10244462-A-T *
13470972-G-C 11315296-G-C *
10784110-AT-A *
23828088-G-C 21666202-G-C Y*
10784115-T-TA *
22509122-T-C 20347236-T-C DYZ19 *
23828089-A-G 21666203-A-G Y*
13482870-A-T 11327194-A-T *
22425914-G-A 20264028-G-A DYZ19 *
13482865-T-G 11327189-T-G *
10934296-AT-A *
13721161-G-T 11565485-G-T *
25995033-A-C,C 23848886-A-C,C P1_Y1 *
9914562-TTTTGA-T 10076953-TTTTGA-T *
9967017-A-G,T 10129408-A-G,T *
10877660-T-TTC *
13700470-AGAATGTAATGGAATGGAATG-A 11544794-AGAATGTAATGGAATGGAATG-A *
13487288-G-A 11331612-G-A *
13489727-C-A 11334051-C-A *
10921420-C-A *
10921425-C-G *
10932771-ATTCCC-A *
10877662-A-ATAC *
10969318-G-GGAGC *
13489722-C-A 11334046-C-A *
22811759-G-GCT 20649873-G-GCT *
9943990-T-TTGTCC 10106381-T-TTGTCC *
9943987-A-ACCAT 10106378-A-ACCAT *
9943978-G-A 10106369-G-A Y*
9943965-A-G 10106356-A-G Y*
56842340-CT-C *
56733903-A-G *
22811760-GTTA-G 20649874-GTTA-G *
22811715-T-C 20649829-T-C Y*
11030781-CCA-C *
22811714-T-C 20649828-T-C Y*
22480275-A-G 20318389-A-G BY25231 DYZ19 *
19025637-T-C 16913757-T-C Y*
11660002-G-T *
13706935-A-G 11551259-A-G *
13706931-T-G 11551255-T-G *
13706927-A-G 11551251-A-G *
9943999-A-T 10106390-A-T Y*
11030785-TCC-T *
13486001-CGA-C 11330325-CGA-C *
10872598-T-C *
13477128-C-A 11321452-C-A *
13477108-C-G 11321432-C-G *
13477096-AAG-A 11321420-AAG-A *
13461176-A-G 11305500-A-G *
13332273-C-T 11176597-C-T *
10999599-C-G *
10969313-ACAAT-A *
10872597-A-G *
13465448-T-A 11309772-T-A *
10872588-T-G *
10800352-C-T *
10791942-C-T *
9968022-C-T 10130413-C-T Y*
3857802-C-G 3989761-C-G *
13680993-T-G 11525317-T-G *
13531773-AAAAC-A 11376097-AAAAC-A *
10790977-T-G *
9986369-G-T 10148760-G-T Y*
13461705-C-G 11306029-C-G *
2830489-C-A 2962448-C-A YY*
2924386-T-C 3056345-T-C *
2916604-TA-T 3048563-TA-T *
2891238-CAAACTAAGTGT-C 3023197-CAAACTAAGTGT-C *
2856298-T-TCGATGTACAGGGTCTTTACCCGGAAAAGCTTCGCCGCAATAAAGAACGGGACCGCGACACCCGCACCGGC 2988257-T-TCGATGTACAGGGTCTTTACCCGGAAAAGCTTCGCCGCAATAAAGAACGGGACCGCGACACCCGCACCGGC *
2852894-C-G 2984853-C-G YY*
2843216-GTGGATAGCACT-G 2975175-GTGGATAGCACT-G *
2836882-C-T 2968841-C-T YY*
2811198-T-C 2943157-T-C YY*
2958831-CACT-C 3090790-CACT-C *
2784387-A-G 2916346-A-G YY*
2755075-A-G 2887034-A-G YY*
2689042-T-C 2821001-T-C Y*
22143677-T-TA 19981791-T-TA *
22143672-GT-G 19981786-GT-G *
13722911-T-G 11567235-T-G *
13473172-C-G 11317496-C-G *
13470625-C-A 11314949-C-A *
2955378-CATATAT-C 3087337-CATATAT-C 9×AT*
3007377-G-A 3139336-G-A *
13384755-A-T 11229079-A-T *
3349083-AT-A 3481042-AT-A *
3503401-A-G 3635360-A-G *
3503400-C-T 3635359-C-T FT317477 *
3472716-TA-T 3604675-TA-T *
3454531-TTAAAGATA-T 3586490-TTAAAGATA-T *
3446502-A-G 3578461-A-G *
3444580-A-C 3576539-A-C *
3367837-ATTT-A 3499796-ATTT-A *
3349061-T-C 3481020-T-C *
3007413-CAG-C 3139372-CAG-C *
3288919-CTAATACATAAT-C 3420878-CTAATACATAAT-C *
3206772-A-G 3338731-A-G *
3198990-T-C 3330949-T-C *
3164135-TA-T 3296094-TA-T *
3162024-C-A 3293983-C-A *
3076106-G-A 3208065-G-A *
3076069-CTTTTTTTT-C,CTTTTTTT 3208028-CTTTTTTTT-C,CTTTTTTT 25×T*
3023546-AC-A 3155505-AC-A *
13450267-A-ACCATTCTATTCCATTTCATT 11294591-A-ACCATTCTATTCCATTTCATT *
13356663-G-GA 11200987-G-GA *
13462775-CCAGG-C 11307099-CCAGG-C *
13503020-TTC-T 11347344-TTC-T *
13676188-C-G 11520512-C-G *
13476913-AGCACTT-A 11321237-AGCACTT-A *
11318185-GC- *
56692427-C-A *
56692421-T-C *
13707146-TA-T 11551470-TA-T *
13695202-G-A 11539526-G-A *
13489875-C-G 11334199-C-G *
22510388-G-A 20348502-G-A DYZ19 *
13484911-G-A 11329235-G-A *
13579402-C-CCT 11423726-C-CCT *
9986368-A-C 10148759-A-C Y*
22509308-G-T 20347422-G-T DYZ19 *
22509305-A-G 20347419-A-G DYZ19 *
22508132-T-G 20346246-T-G DYZ19 *
13706562-T-A 11550886-T-A *
13477182-G-C 11321506-G-C *
22510355-T-A 20348469-T-A DYZ19 *
9909214-C-G 10071605-C-G Y*
14532372-G-C 12420573-G-C Y*
10942798-T-TTG *
14532368-CGA-C 12420569-CGA-C *
24475917-T-TCGCCGTCAAG 22329770-T-TCGCCGTCAAG *
13858050-G-C 11737344-G-C *
13473422-G-A 11317746-G-A *
13473421-T-C 11317745-T-C *
11014887-C-CTACTGCA *
10942800-A-ATTC *
10942796-C-G *
13403464-T-A 11247788-T-A *
9964347-TC-T 10126738-TC-T *
9964344-TGC-T 10126735-TGC-T *
17299921-C-CATAG,CATAGATAG 15188041-C-CATAG,CATAGATAG 12×ATAG*
12899386-AAATAATAAT-A,AAAT 16×AAT*
13465718-C-T 11310042-C-T BY85728 *
13465713-A-T 11310037-A-T *
13465689-T-A 11310013-T-A *
13460527-G-A 11304851-G-A *
13579403-GCA-G 11423727-GCA-G *
13480154-T-C 11324478-T-C *
13488464-C-T 11332788-C-T *
26666825-AAGTGGATTGGAGTGGAATGGAGTGCAATGGACTGGAGTGGAGTGGAATGGAT- *
3795112-CA-C 3927071-CA-C 12×A*
11334057-C- *
13472296-C-CAA 11316620-C-CAA *
13472294-T-A 11316618-T-A *
13472245-C-A 11316569-C-A *
13464338-C-A 11308662-C-A *
13464329-G-A 11308653-G-A *
22505766-C-G 20343880-C-G DYZ19 *
10796909-T-A *
10846979-A-T *
56886029-GA-G *
28799005-G-A 26652858-G-A *
28787322-T-A 26641175-T-A *
28784678-T-C 26638531-T-C *
13576704-C-T 11421028-C-T *
13576692-T-C 11421016-T-C *
11332064-C- *
9231587-AACAC-A 9393978-AACAC-A 18×AC*
13479157-G-C 11323481-G-C *
13473904-T-A 11318228-T-A *
11333959-ACC- *
56732037-C-T *
11333955-A- *
13489010-CCA-C 11333334-CCA-C *
13465315-G-A 11309639-G-A *
13463180-C-CTT 11307504-C-CTT *
9924486-A-ACT 10086877-A-ACT *
9924480-TTC-T 10086871-TTC-T *
11333957-C- *
13484920-G-A 11329244-G-A *
13462584-G-A 11306908-G-A *
13462557-A-C 11306881-A-C *
10763207-C-CATT *
10763204-TG-T *
10763175-T-TC *
26656449-T- *
13489789-A-C 11334113-A-C *
13489473-CCT-C 11333797-CCT-C *
13479014-T-G 11323338-T-G *
13433596-AAG-A 11277920-AAG-A *
56832197-CCAT-C *
11333951-CA- *
10038414-A-C 10200805-A-C *
9805028-G-GCA 9967419-G-GCA *
9805022-AGG-A 9967413-AGG-A *
4809309-C-T 4941268-C-T *
2786282-T-C 2918241-T-C Y*
13712749-GAATGGAATGGAATGA-G 11557073-GAATGGAATGGAATGA-G *
11333956-CCCA- *
13488711-ACG-A 11333035-ACG-A *
10038418-G-A 10200809-G-A *
11333031-CGT- *
13487906-G-T 11332230-G-T *
13340823-A-T 11185147-A-T *
56834249-GTTCCA- 4×TTCCA*
13482825-G-T 11327149-G-T *
13482796-T-G 11327120-T-G *
13474627-A-T 11318951-A-T *
13474610-A-T 11318934-A-T *
10038417-T-C 10200808-T-C *
10657603-T-A *
13266399-CA-C 11110723-CA-C *
10930299-C-T *
10954357-A-T *
10930347-T-TGC *
10930342-TCCA-T *
10930331-TTCCACTC-T *
10930325-ATTC-A *
10930308-CCACTG-C *
10930306-T-A *
10930286-TTCTAC-T *
10771398-CTGTTCCTATA-C *
10930276-CCCAAT-C *
10821507-C-T *
10771430-T-TG *
10771422-TCCTCTC-T *
10771420-T-A *
10771415-C-G *
10771413-C-T *
10771410-C-A *
56832194-ATT-A *
13476877-G-T 11321201-G-T *
13488044-C-CGT 11332368-C-CGT *
13471626-A-C 11315950-A-C *
13475918-AAG-A 11320242-AAG-A *
13475917-T-G 11320241-T-G *
13475915-A-ACG 11320239-A-ACG *
13475525-GA-G 11319849-GA-G *
13472891-A-G 11317215-A-G *
13472276-A-C,T 11316600-A-C,T *
13471646-C-G 11315970-C-G *
13471440-G-A 11315764-G-A *
13477271-C-A 11321595-C-A *
13471159-T-C 11315483-T-C *
13471114-C-G 11315438-C-G *
13471096-C-T 11315420-C-T *
13471081-G-T 11315405-G-T *
13471066-A-ATGCC 11315390-A-ATGCC *
13470910-A-C 11315234-A-C *
13470230-G-T 11314554-G-T *
13465314-G-C 11309638-G-C *
13476907-C-G 11321231-C-G *
13477356-C-T 11321680-C-T *
13462815-C-G 11307139-C-G *
13480167-A-T 11324491-A-T *
11332083-C- *
13487532-C-G 11331856-C-G *
13487529-A-G 11331853-A-G *
13487478-A-T 11331802-A-T *
13487265-C-T 11331589-C-T *
13487263-A-T 11331587-A-T *
13487245-G-T 11331569-G-T *
3549778-A-G 3681737-A-G FT15410 *
13477358-C-T 11321682-C-T *
13479463-G-A 11323787-G-A *
13478623-C-T 11322947-C-T *
13478615-T-C 11322939-T-C *
13477731-A-G 11322055-A-G *
13477519-C-A 11321843-C-A BY85977 *
13477404-C-A 11321728-C-A *
13477390-G-A 11321714-G-A *
13477372-G-A 11321696-G-A *
13463557-C-T 11307881-C-T *
13462732-G-A 11307056-G-A BY85634 *
22463964-A-T 20302078-A-T DYZ19 *
4976054-C-T 5108013-C-T *
10916370-A-T *
10912508-G-C *
10905837-C-CAA *
10753017-C-CTGTTT *
7142016-C-CCGGCCAAGGGCCTGCCACTGGTGAGCTGGACCGAA 7273975-C-CCGGCCAAGGGCCTGCCACTGGTGAGCTGGACCGAA *
7142011-G-GTCAGGAGGTCATCGACGGTGTCGGA 7273970-G-GTCAGGAGGTCATCGACGGTGTCGGA *
4976064-C-T 5108023-C-T *
29798-C-A *
10992831-C-CTG *
56886107-C-CAAAAAAAAAACTT *
56877854-CAAAAA-C,CAAAA 18×A*
56771265-A-T *
28814636-A-T 26668489-A-T *
23293602-A-G,G 21131716-A-G,G *
11562640-GAATGGAATGGAATGA- *
13458735-C-G 11303059-C-G *
6402235-TTCGTCGGTGTCGTAAAATACCAATGTATATGTTATATTCGTACGTGCCGTAAAATACCGACGTATATGTTATATTCTTCCGTGTCGTAAAATACCGACGTATTTGTTATAA-T 6534194-TTCGTCGGTGTCGTAAAATACCAATGTATATGTTATATTCGTACGTGCCGTAAAATACCGACGTATATGTTATATTCTTCCGTGTCGTAAAATACCGACGTATTTGTTATAA-T *
10975826-A-ACCCC *
10992832-CAG-C *
13462725-G-A 11307049-G-A *
13462604-C-G 11306928-C-G *
13462658-G-T 11306982-G-T *
13462656-A-T 11306980-A-T *
13462654-C-T 11306978-C-T *
13462637-C-T 11306961-C-T *
13462621-A-G 11306945-A-G *
13462620-C-T 11306944-C-T *
13462618-A-C 11306942-A-C *
13462603-C-T 11306927-C-T *
13462174-A-C 11306498-A-C *
13462600-C-A 11306924-C-A *
13462598-C-G 11306922-C-G *
13462577-G-A 11306901-G-A *
13462553-G-T 11306877-G-T *
13462545-G-A 11306869-G-A *
13462541-G-T 11306865-G-T *
13462534-G-A 11306858-G-A *
13462532-C-T 11306856-C-T *
3522648-CTCCAAA-C 3654607-CTCCAAA-C *
3652829-TCGGCAGCAAATGCAGTC-T 3784788-TCGGCAGCAAATGCAGTC-T *
3555210-G-A 3687169-G-A *
7306286-A-AG 7438245-A-AG *
7489821-A-T 7621780-A-T IR1_L *
7474056-C-G 7606015-C-G IR1_L *
7453667-T-C 7585626-T-C IR1_L *
7441771-G-A 7573730-G-A Y*
7403722-A-ATTCCCGATTCCTGACTTGGGTATGTGGAACGTCAGCATCGGCGTGGGCGCCATGATGGTGAGTATGCTG 7535681-A-ATTCCCGATTCCTGACTTGGGTATGTGGAACGTCAGCATCGGCGTGGGCGCCATGATGGTGAGTATGCTG *
7403720-A-ACGCAGGGCC 7535679-A-ACGCAGGGCC *
7362401-CT-C 7494360-CT-C *
7306282-AAC-A 7438241-AAC-A *
7507246-TAGGGAAC-T 7639205-TAGGGAAC-T *
7306280-T-A 7438239-T-A YY*
7306276-TAA-T 7438235-TAA-T *
7306273-A-AGACG 7438232-A-AGACG *
7270271-C-A 7402230-C-A YY*
7264645-TAA-T 7396604-TAA-T *
7264300-A-G 7396259-A-G Y*
7264274-A-G 7396233-A-G Y*
7264265-T-A 7396224-T-A Y*
7505280-A-G 7637239-A-G IR1_L *
7522155-T-G 7654114-T-G YY*
7211622-CACACT-C 7343581-CACACT-C *
7702267-T-TATCGAGACGCTCTCTTTCTCGTTAAAAAGAGACTCCTTATGCCTGTTTACTTA 7834226-T-TATCGAGACGCTCTCTTTCTCGTTAAAAAGAGACTCCTTATGCCTGTTTACTTA *
7817279-C-A 7949238-C-A YY*
7817277-A-T 7949236-A-T YY*
7805022-G-A 7936981-G-A FT362702 YY*
7780449-GT-G 7912408-GT-G *
7743878-GAGT-G 7875837-GAGT-G *
7729430-GTTTGTT-G 7861389-GTTTGTT-G *
7715673-CAAAACTAAA-C 7847632-CAAAACTAAA-C *
7701882-TGCCTCCCTATGAAGAAGA-T 7833841-TGCCTCCCTATGAAGAAGA-T *
7569135-CTAGCTGTGGTA-C 7701094-CTAGCTGTGGTA-C *
7695439-TGGTCA-T 7827398-TGGTCA-T *
7693638-C-T 7825597-C-T YY*
7681924-T-A 7813883-T-A YY14×A*
7666956-A-G 7798915-A-G FT198256 YY*
7640292-T-A 7772251-T-A YY*
7627613-TA-T 7759572-TA-T *
7579182-T-C 7711141-T-C YY*
7579177-C-G 7711136-C-G YY*
7264261-A-AT 7396220-A-AT *
7143729-T-C 7275688-T-C Y*
7824535-ATGG-A 7956494-ATGG-A *
6720973-T-C 6852932-T-C Y*
6721111-TC-T 6853070-TC-T *
6721101-G-A 6853060-G-A Y*
6721089-C-G 6853048-C-G Y*
6721081-G-T 6853040-G-T Y*
6721023-G-A 6852982-G-A Y*
6721017-T-C 6852976-T-C Y*
6721005-TG-T 6852964-TG-T *
6720972-G-A 6852931-G-A Y*
6737029-C-T 6868988-C-T YY*
6674504-G-T 6806463-G-T YY*
6668417-CT-C 6800376-CT-C *
6659453-A-G 6791412-A-G YY*
6612807-C-G 6744766-C-G *
6607288-A-C 6739247-A-C *
6598869-A-G 6730828-A-G *
6595070-CT-C 6727029-CT-C *
6526817-A-G 6658776-A-G *
6721120-G-A 6853079-G-A Y*
6746024-T-A 6877983-T-A YY*
7133350-A-G 7265309-A-G YY*
7004190-C-T 7136149-C-T Y*
7111641-CA-C 7243600-CA-C *
7101171-A-G 7233130-A-G Y*
7084028-C-T 7215987-C-T YY*
7060212-T-C 7192171-T-C Y*
7025291-A-T 7157250-A-T Y*
7024150-C-T 7156109-C-T Y*
7020637-G-A 7152596-G-A Y*
7016850-AGTTTCATGCAAAACTCATGCCTG-A 7148809-AGTTTCATGCAAAACTCATGCCTG-A *
7003112-A-T 7135071-A-T Y*
6820326-CTCCCATTATT-C 6952285-CTCCCATTATT-C *
7003105-C-A 7135064-C-A Y*
6989373-C-A 7121332-C-A YY*
6984523-G-A 7116482-G-A Y*
6984522-A-C 7116481-A-C Y*
6961218-CCCTAGA-C 7093177-CCCTAGA-C *
6945534-T-C 7077493-T-C YY*
6877411-T-C 7009370-T-C YY*
6875610-G-A 7007569-G-A YY*
7817281-G-GAGTAAATTTGGAATATCTCCGTCACTCAAACAATAACGA 7949240-G-GAGTAAATTTGGAATATCTCCGTCACTCAAACAATAACGA *
7845814-G-T 7977773-G-T YY*
6483653-GA-G 6615612-GA-G 10×A*
8994848-GTC-G 9157239-GTC-G *
9141271-C-CCTTTCG 9303662-C-CCTTTCG *
9141270-G-GTAA 9303661-G-GTAA *
9135033-GT-G 9297424-GT-G *
9038587-GAGAAATCCCTAATTTT-G 9200978-GAGAAATCCCTAATTTT-G *
9032236-TATTGATTCTTCCTA-T 9194627-TATTGATTCTTCCTA-T *
9021966-GACACATACACACAGGGAGGGAAAGA-G 9184357-GACACATACACACAGGGAGGGAAAGA-G *
9013150-C-G 9175541-C-G Y*
9124273-C-T *
9141276-G-GTATT 9303667-G-GTATT *
9124269-AC-A *
9124267-GT-G *
8908749-C-T 9040708-C-T *
8905122-TAGGAAATTGC-T 9037081-TAGGAAATTGC-T *
8890296-AAGAAAGG-A 9022255-AAGAAAGG-A *
8848884-T-C 8980843-T-C YY*
8844902-TGATACAAACCTTGTGATATCTCAC-T 8976861-TGATACAAACCTTGTGATATCTCAC-T *
8743627-ATCTACCAC-A 8875586-ATCTACCAC-A *
9141273-CGG-C 9303664-CGG-C *
9141279-T-TCA 9303670-T-TCA *
8691719-T-C 8823678-T-C YY*
9141308-C-CGT 9303699-C-CGT *
9157902-A-G 9320293-A-G *
9141319-C-CCGG 9303710-C-CCGG *
9141316-A-AGC 9303707-A-AGC *
9141315-T-A 9303706-T-A Y*
9141313-G-A 9303704-G-A Y*
9141310-C-CTTGG 9303701-C-CTTGG *
9141309-C-CGT 9303700-C-CGT *
9141306-C-T 9303697-C-T Y*
9141281-C-CT 9303672-C-CT *
9141303-CA-C 9303694-CA-C *
9141300-C-T 9303691-C-T Y*
9141296-CAG-C 9303687-CAG-C *
9141291-C-CAA 9303682-C-CAA *
9141289-T-TTG 9303680-T-TTG *
9141288-C-G 9303679-C-G Y*
9141285-C-G 9303676-C-G Y*
9141284-T-TA 9303675-T-TA *
8700383-G-A 8832342-G-A YY*
8644509-CTATATCTATATCTATATCTAT-C 8776468-CTATATCTATATCTATATCTAT-C *
7866244-T-C 7998203-T-C BY68323 Y*
8079502-A-G 8211461-A-G YY*
8079537-A-G 8211496-A-G YY*
8079536-C-T 8211495-C-T YY*
8079528-A-G 8211487-A-G YY*
8079527-C-T 8211486-C-T YY*
8079518-AT-A 8211477-AT-A *
8079513-G-A 8211472-G-A YY*
8079512-T-C 8211471-T-C YY*
8063656-TGTATATG-T 8195615-TGTATATG-T *
8111680-CTAAAACACCAAAAGCAATG-C 8243639-CTAAAACACCAAAAGCAATG-C *
8050622-CA-C 8182581-CA-C *
7939268-A-G 8071227-A-G YY*
7939240-A-C 8071199-A-C YY*
7927537-CA-C 8059496-CA-C *
7907621-A-G 8039580-A-G YY*
7897046-T-C 8029005-T-C Y*
7886037-C-T 8017996-C-T Y*
7870713-AGAATGTG-A 8002672-AGAATGTG-A *
8093917-CTGTTCCTG-C 8225876-CTGTTCCTG-C *
8143949-AGTAATTAG-A 8275908-AGTAATTAG-A *
8641370-AGGTTC-A 8773329-AGGTTC-A *
8482889-CTATTGTT-C 8614848-CTATTGTT-C *
8585165-T-A 8717124-T-A YY*
8581575-TG-T 8713534-TG-T *
8581507-A-ACTTCTTATG 8713466-A-ACTTCTTATG *
8581504-G-GCCACTACCCTGCGC 8713463-G-GCCACTACCCTGCGC *
8581502-G-GCACAAGGGTAAAGATAAAACGTAA 8713461-G-GCACAAGGGTAAAGATAAAACGTAA *
8567006-G-GTTTGCTCCTCATCGTGTGGGATGTTCTTCTTGCAGGCGCATACGCTATCGACCTTGTTTTCTCCGGGGTAGGGGCGTTCACGTTCTTGAC 8698965-G-GTTTGCTCCTCATCGTGTGGGATGTTCTTCTTGCAGGCGCATACGCTATCGACCTTGTTTTCTCCGGGGTAGGGGCGTTCACGTTCTTGAC *
8498998-C-CTT 8630957-C-CTT 11×T*
8496868-GCA-G 8628827-GCA-G *
8392433-TACAAACTATAACTAAAGTGAGAA-T 8524392-TACAAACTATAACTAAAGTGAGAA-T *
8153568-T-G 8285527-T-G YY*
8369182-TCATGTTAC-T 8501141-TCATGTTAC-T *
8355861-T-C 8487820-T-C YY*
8355252-CT-C 8487211-CT-C *
8328873-A-G 8460832-A-G BY71720 YY*
8307719-TAAGTTTGATCATCATG-T 8439678-TAAGTTTGATCATCATG-T *
8265691-GA-G 8397650-GA-G *
8242441-A-G 8374400-A-G YY*
8178481-AT-A 8310440-AT-A *
6511690-AT-A 6643649-AT-A *
6463076-TC-T 6595035-TC-T *
3565038-CT-C 3696997-CT-C *
4511509-A-G 4643468-A-G *
4597998-G-A 4729957-G-A FT39145 *
4593462-C-T 4725421-C-T *
4587293-A-T 4719252-A-T 10×T*
4582670-AT-A 4714629-AT-A *
4581307-T-TCCTCCTGATTCGCCTTATTTCCTGCAAATCGGCAAACTCTTTATTGAGGA 4713266-T-TCCTCCTGATTCGCCTTATTTCCTGCAAATCGGCAAACTCTTTATTGAGGA *
4554458-C-T 4686417-C-T *
4546731-A-G 4678690-A-G *
4496580-G-GTTGTTTTGTT 4628539-G-GTTGTTTTGTT 4×TTGTT*
4602086-A-G 4734045-A-G *
4489411-CA-C 4621370-CA-C 8×A*
4486033-TATAACAAAATA-T 4617992-TATAACAAAATA-T *
4482562-T-C 4614521-T-C *
4450594-TA-T 4582553-TA-T *
4450590-C-CA 4582549-C-CA *
4437477-CT-C 4569436-CT-C *
4382004-GT-G 4513963-GT-G *
4353313-C-T 4485272-C-T *
4600311-A-G 4732270-A-G *
4607261-ATGGAGCAT-A 4739220-ATGGAGCAT-A *
4323822-GA-G 4455781-GA-G *
4895607-T-C 5027566-T-C *
5053241-CTCCCAAAT-C 5185200-CTCCCAAAT-C *
5031444-C-T 5163403-C-T *
4983833-G-C 5115792-G-C *
4976804-AAAAAG-A 5108763-AAAAAG-A 4×AAAAG*
4967020-ATTAC-A 5098979-ATTAC-A *
4937673-T-TA 5069632-T-TA *
4909308-C-T 5041267-C-T *
4885215-CT-C 5017174-CT-C 8×T*
4638286-ACTGC-A 4770245-ACTGC-A *
4867017-G-T 4998976-G-T *
4848351-A-AAT,T 4980310-A-AAT,T 16×AT*
4843298-T-C 4975257-T-C *
4818523-ATTGAATC-A 4950482-ATTGAATC-A *
4800202-C-A 4932161-C-A *
4749320-TATATCATG-T 4881279-TATATCATG-T *
4659471-A-G 4791430-A-G *
4654298-T-A 4786257-T-A *
4342519-A-G 4474478-A-G *
4272447-ACAAGCATTTG-A 4404406-ACAAGCATTTG-A *
5056209-A-G 5188168-A-G *
3685456-GACCTGAT-G 3817415-GACCTGAT-G *
3915653-GA-G 4047612-GA-G *
3896134-T-C 4028093-T-C *
3886062-G-A 4018021-G-A *
3831542-AGAGTATTTTGAAGAATTAAT-A 3963501-AGAGTATTTTGAAGAATTAAT-A *
3756548-GAGA-G 3888507-GAGA-G *
3732585-CT-C 3864544-CT-C *
3695139-C-T 3827098-C-T *
3676517-T-G 3808476-T-G *
3966044-A-G 4098003-A-G *
3656973-CTGG-C 3788932-CTGG-C *
13466890-G-C 11311214-G-C *
3638231-AT-A 3770190-AT-A 8×T*
3615153-TACAAACC-T 3747112-TACAAACC-T *
3594135-CAAT-C 3726094-CAAT-C *
3593743-CT-C 3725702-CT-C *
3574380-ACAAATGTTAGATTTTTTTTGAC-A 3706339-ACAAATGTTAGATTTTTTTTGAC-A *
3574246-AT-A 3706205-AT-A 8×T*
3938043-TATAGACAC-T 4070002-TATAGACAC-T *
3974026-T-C 4105985-T-C *
4271731-C-A 4403690-C-A *
4160006-AATATC-A 4291965-AATATC-A *
4263211-C-T 4395170-C-T FT141643 *
4248197-A-G 4380156-A-G *
4224752-G-C 4356711-G-C *
4200302-T-C 4332261-T-C *
4195309-CT-C 4327268-CT-C *
4195297-GGTGCGATCTC-G 4327256-GGTGCGATCTC-G *
4181911-GA-G 4313870-GA-G 8×A*
4176142-A-T 4308101-A-T *
4154204-A-G 4286163-A-G *
3991507-T-C 4123466-T-C *
4147517-TAG-T 4279476-TAG-T *
4114581-G-T 4246540-G-T *
4065395-A-G 4197354-A-G *
4061992-GT-G 4193951-GT-G 9×T*
4061379-G-C 4193338-G-C FT93625 *
4048389-CA-C 4180348-CA-C *
4036741-C-T 4168700-C-T *
4023950-A-T 4155909-A-T *
5055579-ACAGCCT-A 5187538-ACAGCCT-A *
5110470-A-AG 5242429-A-AG *
6460740-G-A 6592699-G-A *
5747681-G-A 5879640-G-A FT73286 *
5845510-TA-T 5977469-TA-T *
5838921-TGA-T 5970880-TGA-T *
5831408-A-G 5963367-A-G *
5816448-ACATGT-A 5948407-ACATGT-A *
5799228-A-G 5931187-A-G *
5771953-GCTCTGCAGA-G 5903912-GCTCTGCAGA-G *
5769434-C-T 5901393-C-T *
5719136-A-G 5851095-A-G *
5894421-CA-C 6026380-CA-C *
5702646-G-T 5834605-G-T *
5690644-TGTCAGCAAATGTGATAATAA-T 5822603-TGTCAGCAAATGTGATAATAA-T *
5683111-TC-T 5815070-TC-T *
5680836-T-C 5812795-T-C *
5669148-GAATGCATCT-G 5801107-GAATGCATCT-G *
5664544-T-C 5796503-T-C *
5640738-G-A 5772697-G-A *
5632738-CG-C 5764697-CG-C *
5852600-G-C 5984559-G-C *
5904961-TATCTAGA-T 6036920-TATCTAGA-T *
5575834-T-C 5707793-T-C *
6144995-CGAAGGATGTGTTGA-C 6276954-CGAAGGATGTGTTGA-C IR3_Dst *
6459331-CCA-C 6591290-CCA-C *
6428523-T-TCTGTC 6560482-T-TCTGTC *
6403079-CGTGAAATACCGACGTAT-C 6535038-CGTGAAATACCGACGTAT-C *
6369451-CT-C 6501410-CT-C *
6180208-T-C 6312167-T-C IR3_Dst *
6154336-A-G 6286295-A-G IR3_Dst *
6153312-TGTTAGTAAA-T 6285271-TGTTAGTAAA-T IR3_Dst *
6074309-A-G 6206268-A-G *
5905377-TTTACTAAAC-T 6037336-TTTACTAAAC-T *
6037953-C-T 6169912-C-T FT90508 *
5975208-CT-C 6107167-CT-C *
5973617-A-T 6105576-A-T FT66851 *
5940820-GA-G 6072779-GA-G 8×A*
5940431-T-A 6072390-T-A *
5915596-T-C 6047555-T-C *
5912533-T-C 6044492-T-C *
5906054-C-A 6038013-C-A *
5623173-ACTGCTTT-A 5755132-ACTGCTTT-A *
5560678-C-T 5692637-C-T *
5146965-CCATGG-C 5278924-CCATGG-C *
5281518-A-G 5413477-A-G *
5398191-G-A 5530150-G-A *
5369514-TA-T 5501473-TA-T *
5366348-G-A 5498307-G-A *
5342632-GTA-G 5474591-GTA-G *
5325616-T-A 5457575-T-A *
5307414-TG-T 5439373-TG-T *
5303721-A-G 5435680-A-G *
5281515-G-T 5413474-G-T *
5405542-G-GCCAAGCTTTTGTACAGTAATGA 5537501-G-GCCAAGCTTTTGTACAGTAATGA *
5281496-A-G 5413455-A-G *
5281495-C-G 5413454-C-G *
5272686-A-G 5404645-A-G *
5225266-A-ACG 5357225-A-ACG *
5219810-T-C 5351769-T-C *
5189965-TGCATTCCAGACTG-T 5321924-TGCATTCCAGACTG-T *
5181963-A-G 5313922-A-G *
5167664-TAAGGAATG-T 5299623-TAAGGAATG-T *
5405540-A-AATCGTCTTCTCTGTTTCATCGATAACAC 5537499-A-AATCGTCTTCTCTGTTTCATCGATAACAC *
5406833-G-A 5538792-G-A *
5540459-A-ATTT 5672418-A-ATTT 12×T*
5502289-CTT-C 5634248-CTT-C *
5532862-T-C 5664821-T-C *
5532854-A-G 5664813-A-G *
5531002-C-T 5662961-C-T *
5530985-G-A 5662944-G-A *
5530966-G-C 5662925-G-C *
5521099-C-T 5653058-C-T *
5506267-G-GA 5638226-G-GA *
5505603-G-T 5637562-G-T *
5489909-TTACAACATATATA-T 5621868-TTACAACATATATA-T *
5411466-CT-C 5543425-CT-C *
5474460-G-C 5606419-G-C *
5474448-A-G 5606407-A-G *
5473542-T-C 5605501-T-C *
5465368-GTA-G 5597327-GTA-G *
5452345-T-C 5584304-T-C *
5433985-A-G,G 5565944-A-G,G *
5427097-TAATGA-T 5559056-TAATGA-T *
5418501-G-T 5550460-G-T *
13474609-C-G 11318933-C-G *
13748254-A-G 11592578-A-G *
13463228-G-T 11307552-G-T *
9944517-C-A 10106908-C-A Y*
10005498-G-A 10167889-G-A Y*
10005497-C-T 10167888-C-T Y*
10004353-CA-C 10166744-CA-C *
10004341-T-A 10166732-T-A Y*
10004323-C-A 10166714-C-A Y*
9962569-C-T 10124960-C-T Y*
9944521-A-T 10106912-A-T Y*
9778815-ATTT-A 9941206-ATTT-A *
10006038-G-T 10168429-G-T Y*
7579151-T-G 7711110-T-G YY*
7579136-C-T 7711095-C-T YY*
7142014-C-CCG 7273973-C-CCG *
7142008-A-ACGCCACCGT 7273967-A-ACGCCACCGT *
7142007-C-CG 7273966-C-CG *
7142005-A-G 7273964-A-G Y*
7142002-C-CTCGAGCTTCTCGTCTTCT 7273961-C-CTCGAGCTTCTCGTCTTCT *
4218576-G-A 4350535-G-A *
10005621-C-A 10168012-C-A Y*
10006042-A-G 10168433-A-G Y*
13486487-T-A 11330811-T-A *
10918440-T-C *
13356783-G-A 11201107-G-A *
13356769-A-G 11201093-A-G *
13356766-G-C 11201090-G-C *
13356752-G-A 11201076-G-A *
10918462-T-G *
10918458-T-A *
10918444-T-C *
10918438-G-C *
10006051-G-T 10168442-G-T Y*
10883427-T-C *
10772673-C-CGGATGAT *
10772671-C-CATT *
10010312-C-CG 10172703-C-CG *
10010308-C-A 10172699-C-A Y*
10010285-A-T 10172676-A-T Y*
10009225-G-A 10171616-G-A BY82834 Y*
10006058-A-C 10168449-A-C Y*
13489907-C-T 11334231-C-T *
13489748-G-C 11334072-G-C *
13356815-A-G 11201139-A-G *
10093959-C-G 10256350-C-G *
10775713-C-T *
10775677-GCACTCCATTTCATGCCATTCTGTTCC-G *
10775667-CCATTCAACT-C *
10667704-T-TTCCGC *
10093977-C-A 10256368-C-A *
10093968-G-T 10256359-G-T *
10093964-T-A 10256355-T-A *
10093939-T-C 10256330-T-C *
10775720-C-T *
10093925-C-CT 10256316-C-CT *
10093920-T-A 10256311-T-A *
10093918-C-A 10256309-C-A FT427532 *
10093916-G-A 10256307-G-A *
10093910-G-C 10256301-G-C *
10093903-GT-G 10256294-GT-G *
9963962-T-G 10126353-T-G Y*
56861825-A-ACAAACAAAC *
10775717-G-C *
13323495-A-C 11167819-A-C *
56850094-G-GATCACTCAGGTGATGGGTCTATTTTCTATACTCTGCCTAGAGGTGGATTCGTGACATAATCTCTGTACTA *
13488038-TCC-T 11332362-TCC-T *
28793494-TGG-T 26647347-TGG-T *
28587125-A-G 26440978-A-G *
13857866-T-TTG 11737160-T-TTG *
13857863-AAC-A 11737157-AAC-A *
13488740-C-G 11333064-C-G *
13488706-CCG-C 11333030-CCG-C *
13488092-GC-G 11332416-GC-G *
13482191-G-T 11326515-G-T *
13434613-A-T 11278937-A-T *
13476859-CTG-C 11321183-CTG-C *
13473439-A-G 11317763-A-G *
13469358-G-C 11313682-G-C *
13469149-C-G 11313473-C-G *
13464743-T-G 11309067-T-G *
13453916-T-G 11298240-T-G *
13434645-A-G 11278969-A-G *
13434638-C-T 11278962-C-T *
13356808-A-C 11201132-A-C *
13356835-T-A 11201159-T-A *
21909107-T-TCTTA 19747221-T-TCTTA *
13471805-C-T 11316129-C-T *
13472289-GCC-G 11316613-GCC-G *
13471886-C-T 11316210-C-T *
13471856-GGA-G 11316180-GGA-G *
13471852-T-TCA 11316176-T-TCA *
13471836-G-A 11316160-G-A *
13471821-C-G 11316145-C-G *
13471811-G-A 11316135-G-A *
13471793-C-T 11316117-C-T *
13472323-A-G,T 11316647-A-G,T *
13471773-G-T 11316097-G-T *
13471748-G-T 11316072-G-T *
13471746-C-G 11316070-C-G *
13471724-GGC-G 11316048-GGC-G *
13471722-C-CTT 11316046-C-CTT *
13471706-G-C 11316030-G-C *
13471677-G-C 11316001-G-C *
13471676-G-A 11316000-G-A *
13472320-C-T 11316644-C-T *
13472334-G-A,C 11316658-G-A,C *
13471069-C-T 11315393-C-T *
13476630-T-G 11320954-T-G *
13477157-C-T 11321481-C-T *
13476865-G-GC 11321189-G-GC *
13476853-C-A 11321177-C-A *
13476800-C-G 11321124-C-G *
13476744-G-T 11321068-G-T *
13476685-G-C 11321009-G-C *
13476665-C-A 11320989-C-A *
13476608-C-A 11320932-C-A *
13472366-CGTGT-C 11316690-CGTGT-C *
13476578-C-A 11320902-C-A *
13474620-T-A 11318944-T-A *
13473462-C-G 11317786-C-G *
13473459-A-T 11317783-A-T *
13473458-T-A 11317782-T-A *
13472414-G-C 11316738-G-C *
13472374-T-TACCC 11316698-T-TACCC *
13472371-G-C 11316695-G-C *
13471667-C-T 11315991-C-T *
13471064-GAA-G 11315388-GAA-G *
13356853-C-G 11201177-C-G *
13462673-C-T 11306997-C-T *
13462865-C-T 11307189-C-T *
13462859-G-A 11307183-G-A *
13462858-T-C 11307182-T-C *
13462851-C-T 11307175-C-T *
13462843-T-C 11307167-T-C *
13462828-G-C 11307152-G-C *
13462680-C-A 11307004-C-A *
13462666-G-T 11306990-G-T *
13462892-C-CT 11307216-C-CT *
13462659-G-T 11306983-G-T *
13462657-A-G 11306981-A-G *
13462120-G-C 11306444-G-C *
13461711-G-A 11306035-G-A *
13461695-G-C 11306019-G-C *
13448484-C-CATTGCATTGA 11292808-C-CATTGCATTGA *
13443763-T-C 11288087-T-C *
13443602-G-T 11287926-G-T *
13462867-C-T 11307191-C-T *
13462903-C-T 11307227-C-T *
13471060-GAT-G 11315384-GAT-G *
13463974-G-T 11308298-G-T *
13469985-GT-G 11314309-GT-G *
13466573-G-A 11310897-G-A *
13466562-T-A 11310886-T-A *
13465423-C-T 11309747-C-T *
13465354-T-G 11309678-T-G *
13465137-CCAGG-C 11309461-CCAGG-C *
13464069-C-G 11308393-C-G *
13464020-C-G 11308344-C-G *
13463815-C-G 11308139-C-G *
13462910-G-A 11307234-G-A BY210272 *
13463804-C-T 11308128-C-T *
13463652-C-A 11307976-C-A *
13463651-T-A 11307975-T-A *
13463623-G-A 11307947-G-A *
13463508-G-T 11307832-G-T *
13462941-C-T 11307265-C-T *
13462927-C-G 11307251-C-G *
13462923-T-C 11307247-T-C *
56826920-T-TCC *
21909104-G-T 19747218-G-T YY*
13477164-G-A 11321488-G-A *
13348781-A-AT 11193105-A-AT *
13469903-C-T 11314227-C-T *
13463870-T-A 11308194-T-A *
13463836-C-CAGCCT 11308160-C-CAGCCT *
13460535-C-G 11304859-C-G *
13460521-T-C 11304845-T-C *
13460520-A-T 11304844-A-T *
13446800-CCGTGCCA-C 11291124-CCGTGCCA-C *
13348778-G-A 11193102-G-A *
13470133-T-C 11314457-T-C *
13254610-T-TG 11098934-T-TG *
13205596-AT-A,A 11049920-AT-A,A *
10982970-C-G *
10982966-C-T *
10982944-T-G *
10982943-T-G *
10982938-T-C *
10982924-T-A *
13469947-T-A 11314271-T-A *
13470155-CAG-C 11314479-CAG-C *
10982904-T-C *
13489700-C-G 11334024-C-G *
13676180-A-T 11520504-A-T *
13676176-T-C 11520500-T-C *
13561827-G-A 11406151-G-A *
13489926-C-T 11334250-C-T *
13489900-A-C 11334224-A-C *
13489886-C-T 11334210-C-T *
13489854-C-A 11334178-C-A *
13486096-C-G 11330420-C-G *
13470781-G-T 11315105-G-T *
13486094-T-A 11330418-T-A *
13483777-CTG-C 11328101-CTG-C *
13483773-GT-G 11328097-GT-G *
13478072-C-T 11322396-C-T *
13478052-G-C 11322376-G-C *
13478031-C-G 11322355-C-G *
13478025-CA-C 11322349-CA-C *
13471621-C-T 11315945-C-T *
10982907-A-G *
10982901-C-G *
13678071-T-A 11522395-T-A *
22448671-GTT-G 20286785-GTT-G DYZ19 *
56830639-A-ATTCCACTC *
56830638-T-TCC *
56828334-C-CA,CATTCTTTGCA *
56763642-GAATGA-G *
56763627-GGATGGCATCA-G *
56744473-AATG-A *
56744470-TGG-T *
22448667-C-CTG 20286781-C-CTG DYZ19 *
56832170-T-C *
13715221-T-TTA 11559545-T-TTA *
13715217-AAC-A 11559541-AAC-A *
13705480-GGAATGGAATGGAA-G 11549804-GGAATGGAATGGAA-G *
13636943-G-C 11481267-G-C *
13489904-A-T 11334228-A-T *
13489862-C-T 11334186-C-T *
13489762-C-T 11334086-C-T *
13489216-GC-G 11333540-GC-G *
56832098-C-CA *
56878253-G-GCA,GCACACACACACACA 9×CA*
10982886-CACTCT-C *
9992812-C-A 10155203-C-A Y*
10936963-A-T *
10914918-T-C *
10905908-G-T *
10882078-C-CCCATTCCACCCCATT,T *
10768984-ATTCCG-A *
10668330-T-TTCCACTCC *
10005601-A-C 10167992-A-C Y*
10005595-T-C 10167986-T-C Y*
9985849-T-A 10148240-T-A Y*
2786242-A-G 2918201-A-G YY*
9964469-C-T 10126860-C-T Y*
9964208-GGAAAAAA-G 10126599-GGAAAAAA-G *
9962394-A-G 10124785-A-G Y*
8533867-C-CAA 8665826-C-CAA 13×A*
2856292-C-CCGTCATCGTCGGCAG 2988251-C-CCGTCATCGTCGGCAG *
2786289-T-G 2918248-T-G Y*
2786278-G-A 2918237-G-A Y*
2786244-C-T 2918203-C-T YY*
13678069-T-G 11522393-T-G *
13678074-G-A 11522398-G-A BY88099 *
21909103-G-GA 19747217-G-GA *
22511802-G-A 20349916-G-A DYZ19 *
10936922-C-A *
10936920-T-A *
10926308-C-T FT436790 *
10081970-G-A 10244361-G-A *
56714395-T-C *
28792302-A-G 26646155-A-G *
28792294-G-A 26646147-G-A *
22511793-A-G 20349907-A-G BY225774 DYZ19 *
10936929-C-A *
22511792-G-C 20349906-G-C DYZ19 *
22505752-G-A 20343866-G-A DYZ19 *
13701719-G-T 11546043-G-T *
13701679-C-G,T 11546003-C-G,T *
13518168-AGG-A 11362492-AGG-A *
13489673-G-C 11333997-G-C *
13481731-CG-C 11326055-CG-C *
13481727-G-T 11326051-G-T *
10936924-T-A *
10936935-T-A *
13472475-CCT-C 11316799-CCT-C *
13691272-TG-T 11535596-TG-T *
21909100-C-CCTAT 19747214-C-CCTAT *
21909092-C-CG 19747206-C-CG *
21909091-A-ATAT 19747205-A-ATAT *
13709523-T-C 11553847-T-C *
13707347-C-G 11551671-C-G *
13700763-GGAGGCGAAAGGAAAA-G 11545087-GGAGGCGAAAGGAAAA-G *
13691280-A-G 11535604-A-G *
13470917-C-CTGAT 11315241-C-CTGAT *
10936939-T-G *
13470912-ACCAC-A 11315236-ACCAC-A *
13450907-A-C 11295231-A-C *
13323492-GA-G 11167816-GA-G *
13261364-AT-A 11105688-AT-A *
10993061-C-T *
10936953-A-T *
10936952-A-T *
10936949-C-T *
13480164-G-C 11324488-G-C *
13465444-CAAG-C 11309768-CAAG-C *
13678079-G-A 11522403-G-A *
9986970-G-A 10149361-G-A Y*
10625181-G-A *
10625170-T-G *
10057167-T-G 10219558-T-G *
10057157-A-G 10219548-A-G *
9992005-T-G 10154396-T-G Y*
9992004-C-T 10154395-C-T Y*
9991996-G-T 10154387-G-T Y*
9963959-T-G 10126350-T-G Y*
10625200-A-T *
9957979-A-C 10120370-A-C Y*
56829190-A-ACTCCATTCCATTCCCTTCTTTTCCATTCCATTCCT *
28793589-G-T 26647442-G-T *
28786708-G-GGAATGGAATA 26640561-G-GGAATGGAATA *
13712566-CTAA-C 11556890-CTAA-C *
13711573-A-G 11555897-A-G *
13689019-A-T 11533343-A-T *
13678081-A-G 11522405-A-G *
10625194-C-G *
10625201-A-G *
13428034-A-C 11272358-A-C *
10952504-CCAT-C *
13428033-G-A 11272357-G-A *
13380164-G-GT 11224488-G-GT *
13364407-A-G 11208731-A-G *
13364406-T-A 11208730-T-A *
13267936-CATTTTTTTATTTTTAGTAGAGATAGGGTATCACCATGTTGGG-C 11112260-CATTTTTTTATTTTTAGTAGAGATAGGGTATCACCATGTTGGG-C *
13223277-GAAGGAGGAGAGGGAGAGA-G 11067601-GAAGGAGGAGAGGGAGAGA-G *
13194067-C-G 11038391-C-G *
10964213-T-TTGCCATTGCA *
10952501-ATT-A *
10625205-T-C *
10952484-C-G *
10951102-C-G *
10930219-C-T *
10627141-T-TGC *
10627137-ATT-A *
10627134-T-A *
10625243-A-G *
10625213-G-C *
13477161-T-G 11321485-T-G *
13477178-C-T 11321502-C-T *
11307508-A- *
13477329-G-T 11321653-G-T *
13490094-C-T 11334418-C-T *
13487364-A-T 11331688-A-T *
13478895-T-A 11323219-T-A *
13478838-G-A 11323162-G-A *
13478833-A-AC 11323157-A-AC *
13478829-C-CCA 11323153-C-CCA *
13478817-TCCA-T 11323141-TCCA-T *
13477320-C-T 11321644-C-T *
18030517-T-TATTCTCTTTGCCCCAGCCACAGA 15918637-T-TATTCTCTTTGCCCCAGCCACAGA *
13477310-G-C 11321634-G-C *
13477306-G-C 11321630-G-C *
13477298-G-T 11321622-G-T *
13477291-C-A 11321615-C-A *
13477286-G-C 11321610-G-C *
13475771-A-T 11320095-A-T *
13469878-T-A 11314202-T-A *
13469871-G-A 11314195-G-A *
13715153-A-G 11559477-A-G *
9924391-T-A 10086782-T-A Y*
13247723-C-T 11092047-C-T *
22252001-T-A 20090115-T-A DYZ19 *
28805544-A-G 26659397-A-G *
28805534-A-G 26659387-A-G *
28805525-T-A 26659378-T-A *
28805519-T-A 26659372-T-A BY227413 *
28805518-C-G 26659371-C-G *
28805516-T-A 26659369-T-A *
28805178-G-GGAATGGAATGGAAAGGAATC 26659031-G-GGAATGGAATGGAAAGGAATC *
22252000-G-C 20090114-G-C DYZ19 *
10905597-C-A *
22251989-G-C 20090103-G-C DYZ19 *
13851347-A-ACG 11730641-A-ACG *
13851345-T-TGGA 11730639-T-TGGA *
13489751-C-G 11334075-C-G *
13489664-G-A 11333988-G-A *
13489662-T-A 11333986-T-A *
11021484-T-G *
11021477-CATTCA-C *
13469145-T-G 11313469-T-G *
11034892-A-C *
28805548-G-GAAT 26659401-G-GAAT *
22229214-A-T 20067328-A-T DYZ19 *
13466868-T-C 11311192-T-C *
13463837-GTTTTC-G 11308161-GTTTTC-G *
13399383-CA-C 11243707-CA-C *
9986789-A-G 10149180-A-G Y*
9986788-C-T 10149179-C-T Y*
9986775-GAAGT-G 10149166-GAAGT-G *
8176331-C-G 8308290-C-G Y*
13718970-G-C 11563294-G-C *
13477597-G-A 11321921-G-A *
13479041-T-G 11323365-T-G *
13476752-A-G 11321076-A-G *
13462148-C-A 11306472-C-A *
56826011-C-A,CATTCGATTGCA *
56826007-G-GCA,T *
13446829-T-G 11291153-T-G *
10010279-T-C 10172670-T-C Y*
28734639-G-C 26588492-G-C Y*
13466884-T-C 11311208-T-C *
22475545-C-T 20313659-C-T DYZ19 *
11034890-T-TC *
13479034-C-A 11323358-C-A *
11025541-T-G *
10975824-T-TC *
10929622-C-CACTCTGGTTG *
10929621-C-G *
9916102-C-G 10078493-C-G Y*
2856296-C-CGGGCGGTCAAAACA 2988255-C-CGGGCGGTCAAAACA *
13470896-C-T 11315220-C-T *
13469889-G-A 11314213-G-A *
22475557-G-T 20313671-G-T DYZ19 *
28808023-T-TGAG 26661876-T-TGAG *
22486541-G-C 20324655-G-C DYZ19 *
22463953-C-T 20302067-C-T DYZ19 *
22436903-G-C 20275017-G-C DYZ19 *
13466814-T-A 11311138-T-A *
13463862-C-T 11308186-C-T *
10604276-T-A *
10604261-G-A *
28805546-T-TGG 26659399-T-TGG *
56677992-T-TGGAATTGA *
28587207-G-A 26441060-G-A *
13356657-T-TGAA 11200981-T-TGAA *
13468042-C-T 11312366-C-T *
10627152-C-A *
10627143-CCCCAA-C *
28819021-T-C 26672874-T-C *
13712569-A-AGG 11556893-A-AGG *
13476747-C-T 11321071-C-T *
56842344-C- *
13356656-C-A 11200980-C-A *
13479100-G-A 11323424-G-A *
11333028-T- *
13479197-T-A 11323521-T-A *
13463955-C-CT 11308279-C-CT *
11295257-TTCTAC- *
11295115-G- *
56866866-C-CAA *
56862122-T-A *
28814603-A-AAC 26668456-A-AAC *
11314894-G- *
13479108-C-T 11323432-C-T *
28814593-T-A 26668446-T-A *
9397759-G-GAAACGT 9560150-G-GAAACGT *
13196267-CCACTCCAGTCCAACTTCATTTCATTG-C 11040591-CCACTCCAGTCCAACTTCATTTCATTG-C *
9916153-T-A 10078544-T-A Y*
9916147-T-G 10078538-T-G Y*
7451043-TA-T 7583002-TA-T IR1_L 13×A*
28797186-T-TGG 26651039-T-TGG *
28797185-G-GGAA 26651038-G-GGAA *
28583198-C-T 26437051-C-T *
13518170-G-GAAAA 11362494-G-GAAAA *
11333950-CCA- *
13481061-G-C 11325385-G-C *
11306663-T- *
5281490-C-G 5413449-C-G *
5281489-C-T 5413448-C-T *
5281480-T-A 5413439-T-A *
56867492-T-TAAATATAAATA *
13636965-T-G 11481289-T-G *
11333952-A- *
28814602-A-ATTG 26668455-A-ATTG *
28793490-GGAA-G 26647343-GGAA-G *
10787188-C-CTTTGCATTCCATTCCATTCCACTCG *
13585557-A-G 11429881-A-G *
13585594-G-GA 11429918-G-GA *
13585587-AGC-A 11429911-AGC-A *
13585584-GCT-G 11429908-GCT-G *
13585582-C-CCA 11429906-C-CCA *
13585581-G-A 11429905-G-A *
13585562-GCGGGC-G 11429886-GCGGGC-G *
13585559-A-C 11429883-A-C *
13585549-CGGCG-C 11429873-CGGCG-C *
13585599-C-G 11429923-C-G *
13470900-A-T 11315224-A-T *
13470892-C-T 11315216-C-T *
13448886-C-CTCCACTCCAGTCCTTTCCATTCCACTCCAATCCATTCCAT 11293210-C-CTCCACTCCAGTCCTTTCCATTCCACTCCAATCCATTCCAT *
10881494-A-T *
10881492-C-T *
10872576-TGTTCCTTTTC-T *
10827232-T-A *
10827219-C-G *
13585598-C-G 11429922-C-G *
21151201-T-TTTGTTCTAGTGGCTTTCCTTCCAAAAGAGGAAGCAAAAGTTCAAGAGAAAAAAGCTTTTA 18989315-T-TTTGTTCTAGTGGCTTTCCTTCCAAAAGAGGAAGCAAAAGTTCAAGAGAAAAAAGCTTTTA *
24491020-T-A 22344873-T-A *
17918322-TCAAC-T 15806442-TCAAC-T *
24475919-T-TG 22329772-T-TG *
24475914-C-CGGCAGCAAAGAAA 22329767-C-CGGCAGCAAAGAAA *
24475904-CT-C 22329757-CT-C *
17918349-CCATGAAAAAGTGG-C 15806469-CCATGAAAAAGTGG-C *
17918344-T-C 15806464-T-C YY*
17918336-TAAAAAAA-T 15806456-TAAAAAAA-T *
17918334-A-G 15806454-A-G YY*
17918328-A-T 15806448-A-T YY*
17918320-A-ATCTT 15806440-A-ATCTT *
21151204-G-GGGAGAGATA 18989318-G-GGGAGAGATA *
13482753-G-A 11327077-G-A *
13478491-G-C 11322815-G-C *
13478490-G-C 11322814-G-C *
13478463-C-G 11322787-C-G *
13466538-C-T 11310862-C-T *
10668329-C-CCA *
5524993-T-TA 5656952-T-TA *
21151208-T-TTGTAGATATCAAGGATGGGTTACACTA 18989322-T-TTGTAGATATCAAGGATGGGTTACACTA *
28734638-T-C 26588491-T-C Y*
22510038-T-C 20348152-T-C DYZ19 *
13477214-T-C 11321538-T-C *
13868763-GTGGAACAGAATTGAATGGAATAGAATCGAATGGATTGGAATTGATTGGAATAGACAGGAATGCAATGGACTTGAATGGAATTTACTGGAACAAAATGGAATCAAACGGATTGGAACTGAACGAAACAGAATGGAATGTAATGGAATGGCCTCGAATGGAATGGAGTTGAATGGAAGGGAATCGA-G 11748057-GTGGAACAGAATTGAATGGAATAGAATCGAATGGATTGGAATTGATTGGAATAGACAGGAATGCAATGGACTTGAATGGAATTTACTGGAACAAAATGGAATCAAACGGATTGGAACTGAACGAAACAGAATGGAATGTAATGGAATGGCCTCGAATGGAATGGAGTTGAATGGAAGGGAATCGA-G *
13503053-C-T 11347377-C-T *
28785991-G-C 26639844-G-C *
28785985-G-A 26639838-G-A *
28785976-G-C 26639829-G-C *
13477881-C-T 11322205-C-T *
28814615-T-G 26668468-T-G *
56835940-A-ACTCCACTCAATTCCACTCCACGCAATTCCACTCCACTCAATTCCACTCCACTCTG *
13489929-G-C 11334253-G-C *
5338660-G-GT 5470619-G-GT 9×T*
13489874-T-A 11334198-T-A *
13479138-C-A 11323462-C-A *
56832158-T-TTCC *
56832157-C-CCA *
56706537-T-C *
28814694-G-GAT 26668547-G-GAT *
22813269-C-T 20651383-C-T YY*
22813268-C-A 20651382-C-A YY*
5384472-A-G 5516431-A-G *
3271443-CCCT-C 3403402-CCCT-C *
22813255-A-G 20651369-A-G YY*
13476680-TG-T 11321004-TG-T *
5281459-T-C 5413418-T-C *
5281457-T-G 5413416-T-G *
5281448-C-T 5413407-C-T *
5281446-G-A 5413405-G-A *
5281445-A-C 5413404-A-C *
56826956-C-CCATGG *
13486053-A-T 11330377-A-T *
13476675-AAGC-A 11320999-AAGC-A *
4466077-C-T 4598036-C-T FT92830 *
13465183-G-C 11309507-G-C *
13443606-T-A 11287930-T-A *
13435803-T-C 11280127-T-C *
13435787-ACTGTCATCGT-A 11280111-ACTGTCATCGT-A *
13340202-T-C 11184526-T-C *
13272462-A-G 11116786-A-G *
13251792-CAGAT-C 11096116-CAGAT-C *
10998936-G-GAACTCCAAAC *
22813261-A-G 20651375-A-G YY*
22813248-A-G 20651362-A-G FT51486 YY*
5281465-T-G 5413424-T-G *
13479579-C-A 11323903-C-A *
13484861-T-A 11329185-T-A *
13482268-C-T 11326592-C-T *
13482243-G-C 11326567-G-C *
13482223-A-T 11326547-A-T *
13481791-A-T 11326115-A-T *
13481045-C-G 11325369-C-G *
13480773-C-A 11325097-C-A *
13479223-A-G 11323547-A-G *
13486432-A-T 11330756-A-T *
13479168-A-T 11323492-A-T *
13479153-C-G 11323477-C-G *
13479152-C-T 11323476-C-T *
13479038-G-A 11323362-G-A *
13479005-C-G 11323329-C-G *
13477338-A-T 11321662-A-T *
13477268-C-A 11321592-C-A *
13477238-C-A 11321562-C-A *
13486395-A-T 11330719-A-T *
13488190-A-T 11332514-A-T *
22813242-G-C 20651356-G-C YY*
17918311-A-ACGGGCTTCTT 15806431-A-ACGGGCTTCTT *
22813234-T-G 20651348-T-G YY*
22813233-C-T 20651347-C-T YY*
22813226-A-T 20651340-A-T YY*
22508768-C-T 20346882-C-T DYZ19 *
21909097-A-ATCCGGCAAGT 19747211-A-ATCCGGCAAGT *
21909094-A-AAAAGTCCTAGG 19747208-A-AAAAGTCCTAGG *
17918316-A-AG 15806436-A-AG *
17918315-A-AG 15806435-A-AG *
16216726-C-T 14104846-C-T YY*
13488258-C-T 11332582-C-T *
16216723-C-T 14104843-C-T YY*
12372815-ATT-A,AT *
13702709-T-C 11547033-T-C *
13693712-TGGAATGGAAC-T 11538036-TGGAATGGAAC-T *
13691798-T-TATGGAATGGAATGGAATGGAATGGA,TGGA 11536122-T-TATGGAATGGAATGGAATGGAATGGA,TGGA *
13636951-T-A 11481275-T-A *
13636944-ATGAT-A 11481268-ATGAT-A *
13488265-G-A 11332589-G-A *
5281462-C-T 5413421-C-T *
5281466-A-G 5413425-A-G *
22475729-A-G 20313843-A-G DYZ19 *
13480749-T-G 11325073-T-G *
13487656-C-T 11331980-C-T *
13487652-T-C 11331976-T-C *
13487602-C-T 11331926-C-T *
13482927-A-T 11327251-A-T *
13482887-C-T 11327211-C-T *
13481808-C-T 11326132-C-T *
13481771-G-A 11326095-G-A *
13480746-C-A 11325070-C-A *
13488576-TCC-T 11332900-TCC-T *
13478594-C-T 11322918-C-T *
13478581-G-A 11322905-G-A *
13478575-T-A 11322899-T-A *
13478574-C-CA 11322898-C-CA *
13478507-C-CGG 11322831-C-CGG *
13478481-G-C 11322805-G-C *
13477539-A-C 11321863-A-C *
13477534-G-A 11321858-G-A *
13487665-A-AGCTGTGAAACGC 11331989-A-AGCTGTGAAACGC *
13489291-CAG-C 11333615-CAG-C *
13477414-T-C 11321738-T-C *
13358706-G-A 11203030-G-A *
22472945-CAG-C 20311059-CAG-C DYZ19 *
22472942-C-CAT 20311056-C-CAT DYZ19 *
13489885-C-CG 11334209-C-CG *
13478455-G-C 11322779-G-C *
13469153-A-G 11313477-A-G *
13464401-T-G 11308725-T-G *
13448927-T-TCCA 11293251-T-TCCA *
13358701-A-G 11203025-A-G *
13531417-C-T 11375741-C-T *
8436189-GA-G 8568148-GA-G 9×A*
56842137-C-T *
27967357-G-T,T 25821210-G-T,T P1_Y2 *
23038448-C-A 20876562-C-A Y*
22255903-T-G 20094017-T-G DYZ19 *
19209854-C-T 17097974-C-T YY*
13678383-T-G 11522707-T-G *
13678381-C-A 11522705-C-A *
13477437-C-G 11321761-C-G *
13477401-C-T 11321725-C-T *
5281468-T-C 5413427-T-C *
10006464-T-TC 10168855-T-TC *
10784093-C-G *
10784091-T-A *
10784088-C-G *
10625572-CAGATTCTACAAAAACTGTGTTTGCAAGATGCTCAATCGAAAGAAATGTTCAATTCTGAGATGAATGCACACATCACAGAGAAGTTTCTCAGAATGATTCTTTCTAGTTATTATGTGAAGATATTTCGTTATTCACCATATGCCTCAAAGCAATCTTAATGTCCTCTTGT-C *
10625260-T-A *
10624485-G-T *
10624483-T-TA *
10006463-C-G 10168854-C-G Y*
10821494-C-A *
10006451-G-A 10168842-G-A Y*
10006450-C-T 10168841-C-T Y*
10006448-C-G 10168839-C-G Y*
10006439-A-C 10168830-A-C Y*
10006436-G-C 10168827-G-C Y*
10006409-C-T 10168800-C-T FT376106 Y*
10006391-C-T 10168782-C-T Y*
9962564-G-A 10124955-G-A Y*
10784096-T-C *
10821533-G-A *
13476303-GAGATATGTCACAATGCCCCCATGGGCAGAGCCTAGAATAAAGTCCCATCAGCTGGGTGATCAGTGTAGAGATATGTCACAAAGCCCTGTAA-G 11320627-GAGATATGTCACAATGCCCCCATGGGCAGAGCCTAGAATAAAGTCCCATCAGCTGGGTGATCAGTGTAGAGATATGTCACAAAGCCCTGTAA-G *
13470215-C-A 11314539-C-A *
13473503-G-T 11317827-G-T *
13473500-GCA-G 11317824-GCA-G *
13471230-G-A 11315554-G-A *
13471226-G-C 11315550-G-C *
13470908-C-CTATT 11315232-C-CTATT *
13470905-A-C 11315229-A-C *
13470886-A-C 11315210-A-C *
13470219-A-G 11314543-A-G *
13470192-C-T 11314516-C-T *
13195036-C-G 11039360-C-G *
13470183-G-T 11314507-G-T *
13469480-G-T 11313804-G-T *
13467598-A-T 11311922-A-T *
13463679-C-T 11308003-C-T *
13463663-C-G 11307987-C-G *
13463601-C-CT 11307925-C-CT *
13463580-C-T 11307904-C-T *
13463573-C-CA 11307897-C-CA *
9381685-C-T 9544076-C-T Y*
13839677-ACTCG-A 11718971-ACTCG-A *
9397761-A-ATCC 9560152-A-ATCC *
17340167-C-T 15228287-C-T YY*
17450460-TCTATTTTGGTAC-T 15338580-TCTATTTTGGTAC-T *
17429385-A-G 15317505-A-G Y*
17401131-A-G 15289251-A-G YY*
17385349-G-C 15273469-G-C YY*
17385347-GT-G 15273467-GT-G *
17385329-G-A 15273449-G-A YY*
17369256-CCATAGAA-C 15257376-CCATAGAA-C *
17312057-G-A 15200177-G-A YY*
17541187-G-T 15429307-G-T Y*
17305927-AGCTGCTG-A 15194047-AGCTGCTG-A *
17294231-A-G 15182351-A-G YY*
17286493-C-T 15174613-C-T YY*
17266185-TATGTG-T 15154305-TATGTG-T *
17265495-A-C 15153615-A-C Y*
17258530-T-C 15146650-T-C Y*
17244127-T-C 15132247-T-C Y*
17238144-A-G 15126264-A-G YY*
17499441-A-G 15387561-A-G Y*
17565077-C-T 15453197-C-T YY*
17192624-C-CA 15080744-C-CA 8×A*
17684469-TCATA-T 15572589-TCATA-T *
17801399-A-G 15689519-A-G YY*
17799684-G-GTATGATCAGGACGATGTGAGACTGTATGGTGGCGATATAGAAGCTACAGTAATTCCCATTAAAGGACTCAGTATCGTAGCAA 15687804-G-GTATGATCAGGACGATGTGAGACTGTATGGTGGCGATATAGAAGCTACAGTAATTCCCATTAAAGGACTCAGTATCGTAGCAA *
17756583-T-C 15644703-T-C YY*
17736656-T-G 15624776-T-G YY*
17717646-G-C 15605766-G-C YY*
17707005-A-G 15595125-A-G YY*
17694535-C-T 15582655-C-T YY*
17680696-GACT-G 15568816-GACT-G *
17576498-A-ATCGTCGATTGTACCGATACGTTTGCGACTAAATATCTGATTGCCGATGCCGCCGAGATAACCGGTATTCC 15464618-A-ATCGTCGATTGTACCGATACGTTTGCGACTAAATATCTGATTGCCGATGCCGCCGAGATAACCGGTATTCC *
17662884-A-T 15551004-A-T YY*
17659789-T-C 15547909-T-C YY*
17644379-T-C 15532499-T-C YY*
17638178-CAACG-C 15526298-CAACG-C *
17622949-T-C 15511069-T-C YY*
17616760-G-T 15504880-G-T YY*
17609595-CATTGCTGT-C 15497715-CATTGCTGT-C *
17581079-A-G 15469199-A-G YY*
17226682-GTCAGAT-G 15114802-GTCAGAT-G *
17172554-A-AGAAAATTTCCTCTCTTCATCGCCGCAGCTCATTGCCGTTTACCGACAGGAGATT 15060674-A-AGAAAATTTCCTCTCTTCATCGCCGCAGCTCATTGCCGTTTACCGACAGGAGATT *
17850166-TGTGGGGTGGGG-T 15738286-TGTGGGGTGGGG-T *
16536552-G-T 14424672-G-T YY*
16788273-TGATG-T 14676393-TGATG-T *
16707951-T-C 14596071-T-C Y*
16666363-ATGAACC-A 14554483-ATGAACC-A *
16607581-G-A 14495701-G-A YY*
16595867-G-A 14483987-G-A YY*
16589030-TCACA-T 14477150-TCACA-T *
16550348-G-A 14438468-G-A YY*
16535893-C-CA 14424013-C-CA *
16813548-G-A 14701668-G-A YY*
16530366-T-C 14418486-T-C YY*
16519439-T-C 14407559-T-C YY*
16509579-AC-A 14397699-AC-A *
16496167-C-T 14384287-C-T YY*
16487846-GGCGGT-G 14375966-GGCGGT-G *
16483295-A-AT 14371415-A-AT *
16461762-CATAGGTA-C 14349882-CATAGGTA-C *
16440222-T-C 14328342-T-C YY*
16799312-TAATA-T 14687432-TAATA-T *
16825926-G-A 14714046-G-A YY*
17172553-C-CCGT 15060673-C-CCGT *
17012595-C-T 14900715-C-T YY*
17170789-T-C 15058909-T-C YY*
17156108-C-A 15044228-C-A YY*
17112062-G-A 15000182-G-A YY*
17075346-AT-A 14963466-AT-A *
17053410-AT-A 14941530-AT-A *
17037895-T-C 14926015-T-C YY*
17012598-T-A 14900718-T-A YY*
17012593-C-CGTCA 14900713-C-CGTCA *
16834513-C-T 14722633-C-T YY*
17012592-G-C 14900712-G-C YY*
17006023-G-A 14894143-G-A YY*
17005719-G-A 14893839-G-A YY*
17005415-T-A 14893535-T-A YY*
17003868-T-TCGCTACGTTTATGTCTCGGTACCAGTACCGGAATACAACGTGTATTAAACCCGCGTATCTTA 14891988-T-TCGCTACGTTTATGTCTCGGTACCAGTACCGGAATACAACGTGTATTAAACCCGCGTATCTTA *
17003866-T-TGGACGC 14891986-T-TGGACGC *
16980070-GCTATCAC-G 14868190-GCTATCAC-G *
16834523-G-A 14722643-G-A YY*
17802964-A-G 15691084-A-G YY*
17862525-GTTTGT-G 15750645-GTTTGT-G *
16419089-G-A 14307209-G-A YY*
18848079-T-A 16736199-T-A Y*
18958766-CT-C 16846886-CT-C *
18929059-T-C 16817179-T-C YY*
18927510-T-C 16815630-T-C YY*
18927488-C-CAT 16815608-C-CAT *
18927485-ATT-A 16815605-ATT-A *
18913686-A-G 16801806-A-G YY*
18876752-C-T 16764872-C-T Y*
18848075-T-C 16736195-T-C Y*
19025723-C-A 16913843-C-A Y*
18848054-G-A 16736174-G-A Y*
18839830-CCCTGG-C 16727950-CCCTGG-C *
18810276-G-T 16698396-G-T YY*
18761053-C-CAGTCCATGAGATTCCTGAGTTTAAAGGAGGAGTGAATGCAGTTCAAGCAGCCTCAAACGAGGTTCCAGA 16649173-C-CAGTCCATGAGATTCCTGAGTTTAAAGGAGGAGTGAATGCAGTTCAAGCAGCCTCAAACGAGGTTCCAGA *
18761049-C-CGCTGTTGAGG 16649169-C-CGCTGTTGAGG *
18761045-G-GAAAAACCAGAGTTTACGGGTGGAGT 16649165-G-GAAAAACCAGAGTTTACGGGTGGAGT *
18743512-GTA-G 16631632-GTA-G 4×TATC*
18743503-CCTATCTA-C 16631623-CCTATCTA-C *
19018562-G-T 16906682-G-T Y*
19071309-T-C 16959429-T-C Y*
18659352-G-A 16547472-G-A YY*
19210050-A-T 17098170-A-T Y*
19294308-GTGGACTTATTA-G 17182428-GTGGACTTATTA-G *
19291569-AT-A 17179689-AT-A 10×T*
19286902-C-G 17175022-C-G YY*
19281437-A-T 17169557-A-T YY*
19268206-C-T 17156326-C-T YY*
19259575-C-T 17147695-C-T YY*
19259411-G-A 17147531-G-A YY*
19205060-CATATCACTTT-C 17093180-CATATCACTTT-C *
19079665-T-TGTCGATTAAAGACAATATCCG 16967785-T-TGTCGATTAAAGACAATATCCG *
19172694-CATTACA-C 17060814-CATTACA-C *
19170477-CTT-C 17058597-CTT-C 11×T*
19151256-AAC-A 17039376-AAC-A *
19146301-TTATTGTGG-T 17034421-TTATTGTGG-T *
19123605-AC-A 17011725-AC-A *
19103902-G-A 16992022-G-A YY*
19092554-C-T 16980674-C-T YY*
19091527-C-T 16979647-C-T YY*
18743501-CA-C 16631621-CA-C *
18637977-A-AGAAGCATTTGTAGT 16526097-A-AGAAGCATTTGTAGT *
17872020-ACAAAATGCAGGATCAAAGTGATAT-A 15760140-ACAAAATGCAGGATCAAAGTGATAT-A *
18030510-C-CTCCAGACGGTAGCAGGCACGATCTGCGAGCCGCCGGA 15918630-C-CTCCAGACGGTAGCAGGCACGATCTGCGAGCCGCCGGA *
18087004-T-C 15975124-T-C YY*
18064552-AT-A 15952672-AT-A *
18055519-TTG-T 15943639-TTG-T *
18055478-G-A 15943598-G-A Y*
18055477-T-C 15943597-T-C Y*
18055475-T-C 15943595-T-C Y*
18030513-A-AACTCGCTTATCTGCTGATGCCACACTTCCCGGCTCTCAGGTG 15918633-A-AACTCGCTTATCTGCTGATGCCACACTTCCCGGCTCTCAGGTG *
17985051-T-TCGAAGATGGACGAACCCCAGAGCATGGCCTCATCCATGATGTTGATGTGAGGGTTGTACCAGCGCCAGTCCTTGACTGCGCCGTTTCCGTCATACCCC 15873171-T-TCGAAGATGGACGAACCCCAGAGCATGGCCTCATCCATGATGTTGATGTGAGGGTTGTACCAGCGCCAGTCCTTGACTGCGCCGTTTCCGTCATACCCC *
18144307-CATCA-C 16032427-CATCA-C *
17940097-A-G 15828217-A-G YY*
17940093-C-T 15828213-C-T YY*
17940078-T-C 15828198-T-C YY*
17908940-CTATCATTCTCTATCAT-C 15797060-CTATCATTCTCTATCAT-C *
17897765-TTGGTG-T 15785885-TTGGTG-T *
17892194-T-C 15780314-T-C YY*
17880810-CT-C 15768930-CT-C *
17876764-G-A 15764884-G-A YY*
18120126-T-C 16008246-T-C Y*
18162384-CTATTTTATTCATTTATTATTCATTTTCT-C 16050504-CTATTTTATTCATTTATTATTCATTTTCT-C *
18637725-T-TCCGAAATGACTTCGTTCATCAATG 16525845-T-TCCGAAATGACTTCGTTCATCAATG *
18407771-G-A 16295891-G-A P6_Gap *
18628888-CATTGAAATA-C 16517008-CATTGAAATA-C *
18606786-T-C 16494906-T-C YY*
18604445-C-T 16492565-C-T YY*
18565956-A-G 16454076-A-G YY*
18565888-G-T 16454008-G-T Y*
18546057-A-G 16434177-A-G Y*
18546052-T-TAGCTGGCAAATTACCCATTGTTATCCCTACTAAACGTTGAGCTTCC 16434172-T-TAGCTGGCAAATTACCCATTGTTATCCCTACTAAACGTTGAGCTTCC *
18424874-A-G 16312994-A-G P6_Gap *
18407744-G-A 16295864-G-A P6_Gap *
18167124-ACATTTTAAT-A 16055244-ACATTTTAAT-A *
18265337-T-TCTGGCGAGCCGCATCTAAGGTCGCAATGATTTCCGTTGGATGATGGGCAAAATCATCGATAATAATAGTACCATTGACAACCTTTTCAGTGAAACGACGC 16153457-T-TCTGGCGAGCCGCATCTAAGGTCGCAATGATTTCCGTTGGATGATGGGCAAAATCATCGATAATAATAGTACCATTGACAACCTTTTCAGTGAAACGACGC *
18260918-A-G 16149038-A-G *
18228757-T-C 16116877-T-C *
18228756-T-A 16116876-T-A *
18201752-TTGCATTAATTC-T 16089872-TTGCATTAATTC-T *
18178070-A-G 16066190-A-G YY*
18176869-TA-T 16064989-TA-T *
18168328-G-A 16056448-G-A YY*
16439715-T-C 14327835-T-C YY*
16407494-G-A 14295614-G-A YY*
19329737-CAAA-C 17217857-CAAA-C *
14743838-TGGCA-T 12631907-TGGCA-T *
14809208-A-G 12697279-A-G YY*
14792270-GTAGAAAC-G 12680341-GTAGAAAC-G *
14787094-CAATA-C 12675164-CAATA-C *
14767330-G-GAGCGAATGGATCCTGAAACGATTGTCTGGCTACGAAGCTTGCCTTT 12655399-G-GAGCGAATGGATCCTGAAACGATTGTCTGGCTACGAAGCTTGCCTTT *
14766442-T-C 12654511-T-C YY*
14761183-T-C 12649252-T-C Y*
14756832-CT-C 12644901-CT-C *
14737284-C-A 12625352-C-A Y*
14833554-TAG-T 12721621-TAG-T *
14733954-C-A 12622022-C-A YY*
14727143-TC-T 12615211-TC-T *
14686370-A-G 12574436-A-G Y*
14667228-CAAGA-C 12555294-CAAGA-C *
14636994-TTACTGGA-T 12525063-TTACTGGA-T *
14630386-T-A 12518455-T-A YY*
14532363-T-TGC 12420564-T-TGC *
14519801-ATTCTGGACAGACCATTTCT-A 12408002-ATTCTGGACAGACCATTTCT-A *
14818785-AT-A 12706856-AT-A *
14835563-C-T 12723630-C-T YY*
14452972-G-GCCATACGCTCATAGTC 12332245-G-GCCATACGCTCATAGTC *
14856045-T-G 12744111-T-G YY*
14856087-C-T 12744153-C-T BY15023 YY*
14856080-A-AAG 12744146-A-AAG *
14856076-A-G 12744142-A-G YY*
14856075-C-T 12744141-C-T YY*
14856070-T-C 12744136-T-C YY*
14856060-A-G 12744126-A-G YY*
14856046-A-C 12744112-A-C YY*
14856042-A-G 12744108-A-G YY*
14835564-GCCCA-G 12723631-GCCCA-G *
14856037-T-C 12744103-T-C YY*
14856031-T-C 12744097-T-C YY*
14856030-A-T 12744096-A-T YY*
14856025-G-A 12744091-G-A YY*
14856023-A-G 12744089-A-G YY*
14848740-A-G 12736806-A-G YY*
14842203-A-T 12730270-A-T YY*
14835579-C-T 12723646-C-T YY*
14505023-C-T 12393228-C-T YY*
14428184-ATCAATCT-A 12307459-ATCAATCT-A *
14856107-A-T 12744173-A-T YY*
13858024-T-G 11737318-T-G *
13922703-A-G 11801997-A-G YY*
13891456-TC-T 11770750-TC-T *
13869481-A-AATGGT 11748775-A-AATGGT *
13869478-T-TTGACA 11748772-T-TTGACA *
13860898-TGGAA-T 11740192-TGGAA-T *
13858063-A-G 11737357-A-G *
13858058-C-G 11737352-C-G *
13857738-ATTTATTT-A 11737032-ATTTATTT-A *
13961491-GAA-G 11840785-GAA-G *
13854745-A-T 11734039-A-T *
13853415-TAA-T 11732709-TAA-T *
13853414-A-ACC 11732708-A-ACC *
13844076-A-T 11723370-A-T *
13841419-C-G 11720713-C-G *
13478497-C-T 11322821-C-T *
13839674-TG-T 11718968-TG-T *
13839654-G-A 11718948-G-A *
13959195-TCATC-T 11838489-TCATC-T *
14029047-TTTC-T 11908341-TTTC-T *
14424566-T-G 12303841-T-G YY*
14223713-A-G 12103007-A-G YY*
14384600-TCAGG-T 12263896-TCAGG-T *
14377389-TACAAGCTCATCACCTTAAAGAATCTGTTGAC-T 12256685-TACAAGCTCATCACCTTAAAGAATCTGTTGAC-T *
14376434-TG-T 12255730-TG-T *
14305861-A-G 12185155-A-G Y*
14305243-T-G 12184537-T-G Y*
14290888-GTTGCTTATCA-G 12170182-GTTGCTTATCA-G *
14281811-G-GATAGTGGAGCAATTGGGGCAGGCAATAATTCCGTTATGAGCATCAAGTGCATGTGCATTGACCTCTGGTACAA 12161105-G-GATAGTGGAGCAATTGGGGCAGGCAATAATTCCGTTATGAGCATCAAGTGCATGTGCATTGACCTCTGGTACAA *
14281745-C-T 12161039-C-T YY*
14204983-CT-C 12084277-CT-C *
14055271-A-G 11934565-A-G YY*
14204613-A-G 12083907-A-G Y*
14189191-AGGTTCATTTGTCTTCTGTCTCCTAGGAAGTAGTTGAG-A 12068485-AGGTTCATTTGTCTTCTGTCTCCTAGGAAGTAGTTGAG-A *
14183028-GTAAATTAGTTCAACCATT-G 12062322-GTAAATTAGTTCAACCATT-G *
14175435-CTA-C 12054729-CTA-C *
14149516-A-T 12028810-A-T YY*
14134531-T-A 12013825-T-A Y*
14115787-A-AGAG 11995081-A-AGAG 5×GAG*
14110611-GCCAAAGAT-G 11989905-GCCAAAGAT-G *
14856106-T-C 12744172-T-C YY*
14856109-C-T 12744175-C-T YY*
16384373-A-G 14272493-A-G Y*
15897609-G-T 13785729-G-T YY*
15974825-ATTTG-A 13862945-ATTTG-A *
15970787-A-ATGCATAATAGTTGTATAATCAAGTGTCGTGGTTGCATTAGTCGAAACCATTGTCCAACCATTAAG 13858907-A-ATGCATAATAGTTGTATAATCAAGTGTCGTGGTTGCATTAGTCGAAACCATTGTCCAACCATTAAG *
15961815-A-G 13849935-A-G Y*
15945502-C-T 13833622-C-T YY*
15941173-T-TGAGGCTGACGCGCCACGTGACTGACTGCGAACCCGATGGTCACCA 13829293-T-TGAGGCTGACGCGCCACGTGACTGACTGCGAACCCGATGGTCACCA *
15941172-T-TGCGGCC 13829292-T-TGCGGCC *
15941171-T-G 13829291-T-G YY*
15883973-GT-G 13772093-GT-G 10×T*
15991632-CTGG-C 13879752-CTGG-C *
15871067-A-G 13759187-A-G YY*
15842557-CTTTT-C 13730677-CTTTT-C 13×T*
15799759-C-T 13687879-C-T YY*
15786507-A-G 13674627-A-G YY*
15674407-A-G 13562527-A-G Y*
15672482-A-G 13560602-A-G Y*
15660172-CTAGGT-C 13548292-CTAGGT-C *
15652789-C-T 13540909-C-T YY*
15982412-A-T 13870532-A-T YY*
16030780-GCTGGATAGTTCT-G 13918900-GCTGGATAGTTCT-G *
15641588-G-A 13529708-G-A Y*
16192997-A-AAGGCTGTAGGTGTTATCGT 14081117-A-AAGGCTGTAGGTGTTATCGT *
16375157-A-G 14263277-A-G YY*
16362961-T-C 14251081-T-C YY*
16264680-A-G 14152800-A-G YY*
16261779-ACC-A 14149899-ACC-A *
16216731-A-G 14104851-A-G YY*
16203787-CAT-C 14091907-CAT-C *
16193001-A-AGCAGACAAGGCAGTTGAAACAGCACGCTTTGATGGTAAAAAATTGCTTTCTAAACCAGTTGCAGCAGGTATCC 14081121-A-AGCAGACAAGGCAGTTGAAACAGCACGCTTTGATGGTAAAAAATTGCTTTCTAAACCAGTTGCAGCAGGTATCC *
16180587-ACCATATAAAAAATT-A 14068707-ACCATATAAAAAATT-A *
16039109-A-G 13927229-A-G YY*
16170522-G-A 14058642-G-A Y*
16134807-C-CTGCTGTTTACCCAACGACCAATTCTTCTGTG 14022927-C-CTGCTGTTTACCCAACGACCAATTCTTCTGTG *
16133421-C-T 14021541-C-T *
16086658-G-A 13974778-G-A Y*
16081891-A-G 13970011-A-G Y*
16068415-G-A 13956535-G-A Y*
16066731-G-T 13954851-G-T Y*
16053455-G-A 13941575-G-A Y*
15646661-C-T 13534781-C-T Y*
15639522-A-C 13527642-A-C Y*
14856116-T-C 12744182-T-C YY*
15044482-G-A 12932572-G-A Y*
15161860-TA-T 13049946-TA-T 8×A*
15160698-G-A 13048784-G-A YY*
15130254-C-A 13018341-C-A YY*
15125417-GC-G 13013504-GC-G *
15083428-GGTACAT-G 12971518-GGTACAT-G *
15077539-T-C 12965629-T-C YY*
15064032-ATATGGAC-A 12952124-ATATGGAC-A *
15018227-C-T 12906316-C-T YY*
15175015-G-A 13063101-G-A YY*
14993747-GAA-G 12881832-GAA-G *
14981431-GGAAATTCAT-G 12869507-GGAAATTCAT-G *
14970495-C-G 12858570-C-G YY*
14965931-A-T 12854006-A-T YY*
14963706-AGTTT-A 12851781-AGTTT-A *
14944038-AT-A 12832112-AT-A *
14882461-G-C 12770527-G-C YY*
14856119-C-A 12744185-C-A YY*
15173310-C-T 13061396-C-T YY*
15179434-AT-A 13067520-AT-A *
15639435-G-T 13527555-G-T Y*
15505861-AT-A 13393981-AT-A *
15621599-TATGATC-T 13509719-TATGATC-T *
15615425-TACAATTGGTTC-T 13503545-TACAATTGGTTC-T *
15588096-T-C 13476216-T-C YY*
15578454-G-A 13466574-G-A YY*
15558127-TCTCTACA-T 13446247-TCTCTACA-T *
15519043-CAAGT-C 13407163-CAAGT-C *
15517351-G-A 13405471-G-A YY*
15507124-CATCTT-C 13395244-CATCTT-C *
15505686-C-T 13393806-C-T YY*
15242430-TACTTTAA-T 13130516-TACTTTAA-T *
15495620-A-AG 13383740-A-AG *
15486153-C-T 13374273-C-T YY*
15479825-A-G 13367945-A-G YY*
15378652-TAGTCATTCA-T 13266772-TAGTCATTCA-T *
15362966-CAAA-C 13251086-CAAA-C *
15316898-AAACATGGTAAATTAGGGT-A 13205004-AAACATGGTAAATTAGGGT-A *
15315025-TACTACAATAAGCATA-T 13203130-TACTACAATAAGCATA-T *
15246324-T-G 13134410-T-G Y*
19329158-AGAATCAATATTGTG-A 17217278-AGAATCAATATTGTG-A *
19368360-GA-G 17256480-GA-G 9×A*
13839000-G-A 11718294-G-A *
24925060-C-T 22778913-C-T g1 *
27468009-T-C 25321862-T-C P1_Y2 *
27331963-T-C 25185816-T-C P1_g3 *
27128112-A-C 24981965-A-C P1_g3 *
27128099-A-G 24981952-A-G P1_g3 *
26056041-T-C 23909894-T-C P1_Y1 *
25980401-A-G 23834254-A-G P1_Y1 *
24925062-G-C 22778915-G-C g1 *
24925057-C-T 22778910-C-T g1 *
27813932-TG-T 25667785-TG-T P1_Y2 *
24925055-T-A 22778908-T-A g1 *
24919179-C-T 22773032-C-T g1 *
24868365-A-G 22722218-A-G IR1_R *
24707633-A-G 22561486-A-G P3_b2 *
24497464-T-C 22351317-T-C *
24490986-G-C 22344839-G-C *
24490612-C-A 22344465-C-A *
24480608-G-A 22334461-G-A Y*
27561975-T-C 25415828-T-C P1_Y2 *
28207280-T-C 26061133-T-C P1_b4 *
24475908-C-CTAGCATCCCTTGTTACGGCAGGGAATTT 22329761-C-CTAGCATCCCTTGTTACGGCAGGGAATTT *
28579495-T-C 26433348-T-C *
28585773-G-C 26439626-G-C *
28581414-T-C 26435267-T-C *
28579532-T-C 26433385-T-C *
28579522-C-G 26433375-C-G *
28579516-G-A 26433369-G-A *
28579512-C-CA 26433365-C-CA *
28579505-G-A 26433358-G-A *
28579485-TTG-T 26433338-TTG-T *
28441572-A-G 26295425-A-G P1_gr2 *
28579480-A-G 26433333-A-G *
28579473-A-C 26433326-A-C *
28577507-AT-A 26431360-AT-A 9×T*
28557842-C-T 26411695-C-T *
28540647-T-C 26394500-T-C *
28524341-A-G 26378194-A-G *
28485032-C-T 26338885-C-T FT372828 *
28485011-A-G 26338864-A-G *
24475911-A-ATTCAATGCTTAATAAATT 22329764-A-ATTCAATGCTTAATAAATT *
24475903-T-TAGGTAAACCA 22329756-T-TAGGTAAACCA *
28605385-CTTCCTATATG-C 26459238-CTTCCTATATG-C *
23328105-GATC-G 21166219-GATC-G *
23479735-C-T 21317849-C-T YY*
23433410-C-T 21271524-C-T YY*
23380026-A-G 21218140-A-G YY*
23378640-GTATACATATATGC-G 21216754-GTATACATATATGC-G *
23364705-GAATACT-G 21202819-GAATACT-G *
23344330-C-A 21182444-C-A YY*
23332485-C-T 21170599-C-T YY*
23312158-C-A 21150272-C-A YY*
23483578-A-G 21321692-A-G YY*
23295227-T-C 21133341-T-C YY*
23293598-GTA-G,G 21131712-GTA-G,G 20×TA*
23269210-C-T 21107324-C-T YY*
23260839-A-G 21098953-A-G YY*
23207980-C-T 21046094-C-T Y*
23123327-T-C 20961441-T-C YY*
23123320-T-C 20961434-T-C YY*
23123319-G-T 20961433-G-T YY*
23483574-T-C 21321688-T-C YY*
23483588-T-C 21321702-T-C YY*
24433086-G-A 22286939-G-A *
24354776-A-G 22208629-A-G *
24431748-C-T 22285601-C-T Y*
24429201-GATTTTATT-G 22283054-GATTTTATT-G *
24427321-CTTTAGACATTTTA-C 22281174-CTTTAGACATTTTA-C *
24421166-G-A 22275019-G-A Y*
24390963-ATTTCATT-A 22244816-ATTTCATT-A *
24371055-TTTTTCC-T 22224908-TTTTTCC-T *
24369826-CTATGCAT-C 22223679-CTATGCAT-C *
24360595-T-C 22214448-T-C *
24314121-T-A 22167974-T-A P3_t1 *
23524663-G-A 21362777-G-A YY*
24210629-C-A 22064482-C-A P3_b1 *
23828094-T-TAAAGTTTCTGCCCGGACTCTGTCTGCACCG 21666208-T-TAAAGTTTCTGCCCGGACTCTGTCTGCACCG *
23744128-TCA-T 21582242-TCA-T *
23732841-GACAGAC-G 21570955-GACAGAC-G *
23614502-A-G 21452616-A-G YY*
23601664-T-A 21439778-T-A Y*
23582617-G-A 21420731-G-A YY*
23535096-GC-G 21373210-GC-G *
26440582-A- *
28686786-TA-T 26540639-TA-T *
23112987-CTCAT-C 20951101-CTCAT-C *
56736313-G-A *
56763824-A-T *
56752281-A-G *
56747920-T-A *
56744560-T-C *
56742803-A-T *
56742786-C-T *
56742572-G-T *
56733609-C-G *
56768311-A-C *
56731958-TGGAA- *
56714452-G-T *
56710559-T-G *
56708337-T-G *
56705737-A-G *
56702055-T-C *
56698544-ATTCG-A *
56698540-A-T *
56768305-G-T *
56768330-G-T *
56698532-A-C *
56871655-A-ATATATATATAT *
7070-T-A *
56886095-C-CAAA 11×A*
56875227-T-TAAACAGA *
56872457-T-A *
56872435-A-G *
56872429-A-C *
56872414-T-G *
56866731-G-T *
56768938-T-C *
56861289-T-TA *
56847120-A-G,G *
56841657-G-GC,GC *
56841254-G-C *
56841248-T-A *
56841242-G-A *
56835639-A-AGTGCG *
56769293-T-C *
56698537-G-A *
56682020-T-TA *
28693825-CTCACAA-C 26547678-CTCACAA-C *
28789487-AGTG-A 26643340-AGTG-A *
28799017-A-ATTGAGC 26652870-A-ATTGAGC *
28799016-A-AGTTT 26652869-A-AGTTT *
28798310-TTGAAA-T 26652163-TTGAAA-T *
28790560-G-GTA 26644413-G-GTA *
28789771-A-T 26643624-A-T *
28789765-G-A 26643618-G-A *
28789493-ATG-A 26643346-ATG-A *
28789456-G-C 26643309-G-C *
28799212-T-G 26653065-T-G *
28789336-CA-C 26643189-CA-C *
28787346-G-C 26641199-G-C 5×TGGAA*
28786051-G-GAATGGAGTGGAATGGAATGGAGTGAAATGGAAGGGAGTGGAGTGTAGTGGAGTGGAATGGAGTGTAATAGAGTGT 26639904-G-GAATGGAGTGGAATGGAATGGAGTGAAATGGAAGGGAGTGGAGTGTAGTGGAGTGGAATGGAGTGTAATAGAGTGT *
28734634-A-G 26588487-A-G Y*
28721442-G-A 26575295-G-A *
28715133-G-A 26568986-G-A *
28715103-C-T 26568956-C-T *
28696527-CA-C 26550380-CA-C *
28799024-G-C 26652877-G-C *
28799231-A-C 26653084-A-C *
56680238-G-T,T *
28802111-A-C 26655964-A-C *
56680183-A-AAATGGAATGGAATGGAATGG,AAATGGAATGGAATGGAATGG 5×AATGG*
56678191-A-G *
56677993-C-CTCAAATGGAATGGACTA,G *
56677977-T-TCTTCC *
28814329-G-T 26668182-G-T *
28807356-C-T 26661209-C-T *
28805562-GA-G 26659415-GA-G *
28805554-AGTGG-A 26659407-AGTGG-A *
28802100-A-G 26655953-A-G *
28799242-T-C 26653095-T-C *
28799274-T-G 26653127-T-G *
28799272-A-T 26653125-A-T *
28799269-C-G 26653122-C-G *
28799263-T-A 26653116-T-A *
28799261-C-A 26653114-C-A *
28799260-G-T 26653113-G-T *
26653097-C- *
28799243-GCAATGGGAGTC-G 26653096-GCAATGGGAGTC-G *
23123316-G-A 20961430-G-A YY*
23109056-G-A 20947170-G-A Y*
19392010-GA-G 17280130-GA-G *
21642421-C-T 19480535-C-T YY*
21731789-C-G 19569903-C-G YY*
21731040-CT-C 19569154-CT-C *
21726671-AATT-A 19564785-AATT-A *
21725463-C-T 19563577-C-T YY*
21713602-CCATCTATTCTTGGCTTCCCCATA-C 19551716-CCATCTATTCTTGGCTTCCCCATA-C *
21682517-GT-G 19520631-GT-G *
21646837-GAGAAACT-G 19484951-GAGAAACT-G *
21624349-T-C 19462463-T-C FTB49401 YY*
21764530-C-T 19602644-C-T YY*
21600910-GAGCTATTT-G 19439024-GAGCTATTT-G *
21586819-GCCAGCCTAAT-G 19424933-GCCAGCCTAAT-G *
21581977-AT-A 19420091-AT-A *
21554782-T-C 19392896-T-C YY*
21505961-G-A 19344075-G-A YY*
21500735-CA-C 19338849-CA-C *
21444135-G-GATAT 19282249-G-GATAT *
21441880-T-A 19279994-T-A YY*
21753992-CTTGTGCTGGTAGATCAGA-C 19592106-CTTGTGCTGGTAGATCAGA-C *
21805285-CT-C 19643399-CT-C *
21413423-G-A 19251537-G-A YY*
21935044-G-T 19773158-G-T YY*
22006406-C-T 19844520-C-T YY*
21986540-A-AATCTTGCGCATCATCGCTGGCATAACATGTGAATTCTCCAGATGGAAGTTGTCATTCGGACCGTAGAG 19824654-A-AATCTTGCGCATCATCGCTGGCATAACATGTGAATTCTCCAGATGGAAGTTGTCATTCGGACCGTAGAG *
21986538-G-GTTTTGCGAGGT 19824652-G-GTTTTGCGAGGT *
21977167-T-C 19815281-T-C YY*
21970473-CATACAAAA-C 19808587-CATACAAAA-C *
21963804-T-C 19801918-T-C YY*
21956333-CCAGTTTTCA-C 19794447-CCAGTTTTCA-C *
21920342-C-T 19758456-C-T Y*
21805814-T-C 19643928-T-C Y*
21920332-C-CATGT 19758446-C-CATGT *
21920329-A-C 19758443-A-C Y*
21920306-G-A 19758420-G-A Y*
21914409-A-G 19752523-A-G Y*
21912295-TATTGAGATAATCATGTA-T 19750409-TATTGAGATAATCATGTA-T *
21909199-A-G 19747313-A-G YY*
21887172-A-T 19725286-A-T Y*
21881011-C-T 19719125-C-T YY*
21417173-GC-G 19255287-GC-G *
21405157-T-C 19243271-T-C YY*
22066828-TAGTTACTC-T 19904942-TAGTTACTC-T *
19554121-A-G 17442241-A-G Y*
21047407-G-T 18885521-G-T Y*
21039275-T-C 18877389-T-C Y*
21032818-TTGTTG-T 18870932-TTGTTG-T *
20943701-CTT-C 18781815-CTT-C P4_Dst 10×T*
20805926-GAATTATTGCGTGATAGT-G 18644040-GAATTATTGCGTGATAGT-G P4_Gap *
20804064-G-T 18642178-G-T P4_Gap *
20064727-G-T 17952847-G-T P5_Gap *
19549397-CT-C 17437517-CT-C *
21058158-GAGACTTAGAT-G 18896272-GAGACTTAGAT-G *
19516332-TCTC-T 17404452-TCTC-T *
19505838-C-A 17393958-C-A YY*
19481308-T-C 17369428-T-C YY*
19468685-AT-A 17356805-AT-A *
19437626-GAGGGA-G 17325746-GAGGGA-G *
19436863-AAGG-A 17324983-AAGG-A *
19433151-T-TACATCGCTGAAGATGCCAAATCGCTCGGCGAAGTGGTGGTAACGGCACAGCGTTCGGACATGAAACTCGAGGTAGACCGCAAGACTTTCAGCGTAGACCAGCA 17321271-T-TACATCGCTGAAGATGCCAAATCGCTCGGCGAAGTGGTGGTAACGGCACAGCGTTCGGACATGAAACTCGAGGTAGACCGCAAGACTTTCAGCGTAGACCAGCA *
19413345-A-G 17301465-A-G YY*
21051733-TCACA-T 18889847-TCACA-T *
21077170-AAACCAATGG-A 18915284-AAACCAATGG-A *
21401964-G-T 19240078-G-T YY*
21291295-AAG-A 19129409-AAG-A *
21390025-TGCAG-T 19228139-TGCAG-T *
21371931-ATGGTCAGTT-A 19210045-ATGGTCAGTT-A *
21345914-A-AACTCTTTACCATGACGAACTTTGACCGTGAGGAAGCTGTCATGAAATTTGCACGGCAACTACGTGGTATGGGG 19184028-A-AACTCTTTACCATGACGAACTTTGACCGTGAGGAAGCTGTCATGAAATTTGCACGGCAACTACGTGGTATGGGG *
21319570-ATG-A 19157684-ATG-A *
21298327-G-A 19136441-G-A YY*
21296409-G-GGCAGATCAAAATCACTCGCGCCCAAACTTTCAAAATCCGCGCATCCGGTGTGGGTTTAGATGCGTTGTGGGGTGAACAGTGTGTGTCTGTTGTGGATTATTTGACCTT 19134523-G-GGCAGATCAAAATCACTCGCGCCCAAACTTTCAAAATCCGCGCATCCGGTGTGGGTTTAGATGCGTTGTGGGGTGAACAGTGTGTGTCTGTTGTGGATTATTTGACCTT *
21293662-G-A 19131776-G-A YY*
21293661-A-C 19131775-A-C YY*
21268045-A-G 19106159-A-G YY*
21088872-CT-C 18926986-CT-C *
21264893-A-G 19103007-A-G YY*
21264891-T-G 19103005-T-G YY*
21264889-T-C 19103003-T-C YY*
21264887-A-C 19103001-A-C FTB60986 YY*
21264881-GTCCA-G 19102995-GTCCA-G *
21197334-A-G 19035448-A-G Y*
21169226-CGGGGGACTACAGA-C 19007340-CGGGGGACTACAGA-C *
21117647-G-GGTGCGTACAACCATGTAGAGCGTGCCGGTGCCCTGTGCCGCATCCACCTCGATGCGCGGGTTTGAGAGCGTTAGGTTC 18955761-G-GGTGCGTACAACCATGTAGAGCGTGCCGGTGCCCTGTGCCGCATCCACCTCGATGCGCGGGTTTGAGAGCGTTAGGTTC *
22017285-A-G 19855399-A-G Y*
22134911-A-G 19973025-A-G Y*
23104611-G-A 20942725-G-A Y*
22785196-CTTTCAA-C 20623310-CTTTCAA-C *
22828740-G-GAGTGGC 20666854-G-GAGTGGC *
22813224-T-A 20651338-T-A YY*
22811738-G-A 20649852-G-A Y*
22802376-A-G 20640490-A-G YY*
22791422-T-C 20629536-T-C YY*
22789534-G-T 20627648-G-T Y*
22789091-T-A 20627205-T-A Y*
22775159-A-G 20613273-A-G YY*
22828745-A-ATCGAAGGGCATTGCCTGCACACCATTTGCAGTAGCGGTCGGTGTCCCAATCAAGGGGAGTGCTGG 20666859-A-ATCGAAGGGCATTGCCTGCACACCATTTGCAGTAGCGGTCGGTGTCCCAATCAAGGGGAGTGCTGG *
22766007-G-A 20604121-G-A Y*
22753150-CCTGAGGA-C 20591264-CCTGAGGA-C *
22744305-CA-C 20582419-CA-C *
22743471-G-A 20581585-G-A YY*
22740506-CAATGTGAGACTGCCCCAGAGGTAGTGGGTG-C 20578620-CAATGTGAGACTGCCCCAGAGGTAGTGGGTG-C *
22736034-G-T 20574148-G-T YY*
22735081-A-G 20573195-A-G YY*
22711046-G-A 20549160-G-A YY*
22828742-C-CCGCATCAAACTGGGAGGCTCCATCACGTATGGGGAGACGCGTAAGG 20666856-C-CCGCATCAAACTGGGAGGCTCCATCACGTATGGGGAGACGCGTAAGG *
22849042-CTTGTTGTTT-C 20687156-CTTGTTGTTT-C *
22635497-T-G 20473611-T-G Y*
23007819-T-A 20845933-T-A Y*
23097309-C-G 20935423-C-G YY*
23074959-G-A 20913073-G-A YY*
23056380-T-C 20894494-T-C YY*
23055267-ACATGCAAG-A 20893381-ACATGCAAG-A *
23053043-C-T 20891157-C-T YY*
23052648-TAAG-T 20890762-TAAG-T *
23014393-G-T 20852507-G-T Y*
23007035-GTTGTTT-G 20845149-GTTGTTT-G *
22864065-GACAC-G 20702179-GACAC-G 12×AC*
22986315-CAATTTTGTAAT-C 20824429-CAATTTTGTAAT-C *
22982950-T-C 20821064-T-C Y*
22975721-GCAATAT-G 20813835-GCAATAT-G *
22973243-A-G 20811357-A-G YY*
22933185-T-C 20771299-T-C YY*
22931542-CA-C 20769656-CA-C *
22926153-CT-C,CTT 20764267-CT-C,CTT 13×T*
22879194-A-T 20717308-A-T Y*
22667350-A-G 20505464-A-G Y*
22619199-A-AACCGTAACCGTATCAAC 20457313-A-AACCGTAACCGTATCAAC *
22159127-CTG-C 19997241-CTG-C *
22427906-G-T 20266020-G-T DYZ19 *
22474654-A-T 20312768-A-T BY44858 DYZ19 *
22472627-T-A 20310741-T-A DYZ19 *
22470200-C-T 20308314-C-T BY222375 DYZ19 *
22449403-C-T 20287517-C-T DYZ19 *
22449397-T-A 20287511-T-A DYZ19 *
22442800-TAGAGTTCCTTACTTCTGGGAGGTTCATAGACTTGCTCATTTCAAGAATGAAGCTGCAGACCTTTACGGTGAGTGTTATAGCACTTAAAGGTGTTATGTCCAGAGTTTGTTCCTTCCGATGTGTCC-T 20280914-TAGAGTTCCTTACTTCTGGGAGGTTCATAGACTTGCTCATTTCAAGAATGAAGCTGCAGACCTTTACGGTGAGTGTTATAGCACTTAAAGGTGTTATGTCCAGAGTTTGTTCCTTCCGATGTGTCC-T DYZ19 *
22436497-ACC-A 20274611-ACC-A DYZ19 *
22317673-TCG-T 20155787-TCG-T DYZ19 *
22480287-C-T 20318401-C-T BY25232 DYZ19 *
22317669-T-TGA 20155783-T-TGA DYZ19 *
22260846-T-A 20098960-T-A DYZ19 *
22260692-TAGATGTGTCTAGAGTTTCTTCCTTCTGGCAGGTTCATGGTCTTGCTCACTTCAAGTAAGAATGAAGCTGCAGACCTTTACGGTGATTGTTACAGCATATAAAGTGTTATGTCCAAAGTTTGTTCCTTC-T 20098806-TAGATGTGTCTAGAGTTTCTTCCTTCTGGCAGGTTCATGGTCTTGCTCACTTCAAGTAAGAATGAAGCTGCAGACCTTTACGGTGATTGTTACAGCATATAAAGTGTTATGTCCAAAGTTTGTTCCTTC-T DYZ19 *
22247190-A-G 20085304-A-G DYZ19 *
22238429-A-C 20076543-A-C DYZ19 *
22203375-A-G 20041489-A-G YY*
22198600-C-A 20036714-C-A Y*
22168167-T-C 20006281-T-C Y*
22475923-T-TAC 20314037-T-TAC DYZ19 *
22480292-CTTACTGT-C 20318406-CTTACTGT-C DYZ19 *
22618878-T-C 20456992-T-C YY*
22510364-T-A 20348478-T-A DYZ19 *
22595908-CT-C 20434022-CT-C 9×T*
22560676-C-CTAATCGCTATATGATCCAAAATCTAGTAGCCGAAGAAATAGCTACATATGGAGTTGAAAGTTTTAATAGTGTTCGATTTATGGAGCGATATCAATTAAAG 20398790-C-CTAATCGCTATATGATCCAAAATCTAGTAGCCGAAGAAATAGCTACATATGGAGTTGAAAGTTTTAATAGTGTTCGATTTATGGAGCGATATCAATTAAAG *
22559672-C-A 20397786-C-A YY*
22535399-A-G 20373513-A-G Y*
22534094-G-A 20372208-G-A Y*
22531187-GAAAAAAGAAT-G 20369301-GAAAAAAGAAT-G *
22529338-C-CA 20367452-C-CA *
22525167-A-C 20363281-A-C Y*
22509297-T-C 20347411-T-C BY225545 DYZ19 *
22480305-GTAACA-G 20318419-GTAACA-G DYZ19 *
22509143-G-T 20347257-G-T BY38421 DYZ19 *
22509138-G-A 20347252-G-A DYZ19 *
22508147-A-C 20346261-A-C DYZ19 *
22505780-T-C 20343894-T-C DYZ19 *
22505778-T-A 20343892-T-A DYZ19 *
22505770-C-G 20343884-C-G DYZ19 *
22505735-C-A 20343849-C-A DYZ19 *
22485584-T-C 20323698-T-C DYZ19 *
13839651-G-A 11718945-G-A *
13838993-A-C 11718287-A-C *
9397764-G-GGGACGCA 9560155-G-GGGACGCA *
10888754-A-ACTCTGTTCGC *
10903533-T-C *
10903527-G-T *
10903513-T-C *
10903502-T-C *
10902211-C-G *
10890408-C-T *
10889322-C-CGTGTT *
10887377-C-G *
10903553-T-C *
10884813-A-G *
10882276-A-C *
10882269-G-A *
10881512-T-C *
10881353-A-ACC *
10881346-CTG-C *
10880757-C-CACCCGGATT *
10880756-T-TA *
10903540-C-T *
10903557-G-C *
10877667-C-CCTTTA *
10911737-A-C *
10912329-A-G *
10912319-G-A *
10912317-C-T *
10912307-G-C *
10912306-A-G *
10912111-CACAGATATGTCACAATTTCCCCAGTAGGCAGAGCCTACACAAGTGTTACATCACTTTGGTGATCAGTGT-C *
10911746-T-C *
10911725-T-C *
10904582-G-C *
10911721-C-T *
10910829-CT-C *
10909759-G-T *
10909757-A-C *
10907674-T-G *
10906175-T-C *
10906163-T-G *
10905347-A-G *
10879481-C-G *
10877664-A-ATTCCATTCCATACCATTCCAGTTGTTTCCC *
10912354-G-C *
10815203-A-C *
10821778-GTTCCGATCCCCTCTATTCCATTCTTTTCCATTCCATTTCATTCCGTTTGATTCCATTCCATTCCACTGCACTCCGTTCAA-G *
10821520-T-A *
10821514-C-T *
10821505-T-G *
10821137-T-A *
10821130-C-T *
10815204-T-A *
10815201-T-C *
10823116-C-A *
10815200-T-A *
10807551-T-C *
10803458-T-C *
10803455-G-T *
10802025-CCGATCCACTCCACTGA-C *
10802018-CTGCA-C *
10802015-A-T *
10801005-A-AATTCC,AATTCC *
10823084-C-T *
10823513-C-A *
10872616-G-T *
10848969-CTCCAT-C *
10872614-C-T *
10872608-T-C *
10872604-G-T *
10872145-CCACTCCATTCCACTCCATTCCTTTCAATTCCACTCCATTCCATTTTATTCCACTGCTTGTCACTCCATTCCACTGCACTA-C *
10868056-TTCCCC-T *
10856456-C-CAACT *
10856454-T-A *
10852560-ATTCCT-A *
10836578-C- *
10824207-C-T *
10836561-A- *
10831033-T-C *
10829334-T-A *
10829326-C-T *
10827998-TCCAC-T *
10827985-CACTCAACTACA-C *
10826591-T-A *
10824208-A-G *
10912342-A-T *
10912512-G-T *
10799643-T-C *
10988582-C-CA *
10992744-CCCCAA-C *
10992739-C-T *
10992724-TTCC-T *
10992721-CCA-C *
10992703-ATCCC-A *
10991276-AT-A *
10988583-T-G *
10988540-T-TATTCCACTCCACTTCATTCC *
10993054-C-CATAAA *
10985939-CAT-C *
10985937-T-TCCCCTCC *
10985635-A-ATTCTGCTCCTTTCTTTTGACAGGTTCTCCCTATGTCACACAGGCTGTAGCGCAGAGACACAATCTCAAAACCCATGCCG *
10982975-C-A *
10982888-C- *
10982255-T-G *
10981235-T-C *
10975833-C-CTCCACTCCATTCCATCCCATACCATTATATTCCACTCCGTCCCACTCCACTTCACTCCATTCCAG *
10992754-C-T *
10993074-C-T *
10971407-CATTCTATTCCATTGT-C *
11015214-GCACTCCACTCCATCCATTTCACTCCATCCCATTCCATTCGACTCCATTCCACTCCACTTCACTC-G *
11029459-C-G FT440140 *
11029431-C-G *
11029388-C-CGAA *
11029384-T-TCC *
11021486-C-G *
11020696-AT-A *
11016417-C-T FT393763 *
11013569-T-A *
10994678-C-G *
11006675-C-T *
11005434-TCTCCATTCCATTCCACTCCACTCCA-T *
11001965-C-T *
11001940-TTATATTCGCCTCTATTTCAC-T *
11001429-T-C *
11001417-C-T *
11001401-C-T *
10999299-AGGCTTAAGTGCAGTGGCACAATCTCAGCTC-A *
10971434-TTCCAA-T *
10971099-C-CAAATT *
10913380-G-A *
10918586-A-C *
10925037-C-CCT *
10925024-ATT-A *
10925022-C-CTA *
10925003-C-G *
10918624-T-G *
10918600-G-C *
10918594-A-T *
10918583-A-G *
10934302-A-T *
10918477-A-AT *
10917342-T-A *
10914880-C-G *
10914846-T-G *
10914801-G-A *
10913849-C-A *
10913391-T-C *
10913385-C-T *
10925038-AAT-A *
10934305-C-G *
10969458-G-T *
10953591-C-G *
10964918-TGGCACA-T *
10959039-TCCACTGCACACGAC-T *
10959031-CAGTCCA-C *
10958865-C-CGTGTT *
10958004-CTTCAT-C *
10954384-T-G *
10954371-C-T *
10953600-T-A *
10953583-T-G *
10934854-A-AC *
10953575-T-TCCAAA *
10946900-T-G *
10945312-T-G *
10940943-T-A *
10939807-C-CACTTTACTCCACTCCACTTG *
10936972-C-T FT437283 *
10935351-C-CTAGTT *
10934855-T-TCCACTCCATTCCACTCCACTGCACTCCGA *
10799653-T-G *
10798055-C-T *
11030819-CTCTACTCCAT-C *
9943925-G-A 10106316-G-A Y*
10006072-G-A 10168463-G-A Y*
10006034-G-T 10168425-G-T Y*
9989328-TTCATGGAC-T 10151719-TTCATGGAC-T *
9965700-T-C 10128091-T-C Y*
9965515-T-C 10127906-T-C Y*
9965404-CA-C 10127795-CA-C *
9949476-A-G 10111867-A-G Y*
9942396-A-G 10104787-A-G Y*
10010248-G-A 10172639-G-A Y*
9942391-T-C 10104782-T-C Y*
9942383-A-T 10104774-A-T Y*
9942373-A-T 10104764-A-T Y*
9942360-C-T 10104751-C-T Y*
9942353-G-C 10104744-G-C FT361960 Y*
9942352-T-C 10104743-T-C Y*
9942333-G-A 10104724-G-A Y*
9942332-T-C 10104723-T-C Y*
10010244-G-T 10172635-G-T Y*
10010252-A-G 10172643-A-G Y*
9942309-A-G 10104700-A-G Y*
10068400-C-T 10230791-C-T *
10082040-A-T 10244431-A-T *
10082035-T-C 10244426-T-C *
10082018-G-A 10244409-G-A *
10072695-T-C 10235086-T-C *
10072679-C-G 10235070-C-G *
10068408-T-C 10230799-T-C *
10068406-C-T 10230797-C-T *
10068395-G-GTTTGCATTTGAAGTTTGCA 10230786-G-GTTTGCATTTGAAGTTTGCA *
10010260-CGA-C 10172651-CGA-C *
10064095-G-A 10226486-G-A *
10049764-A-G 10212155-A-G *
10042652-T-C 10205043-T-C *
10032904-C-T 10195295-C-T Y*
10022060-C-T 10184451-C-T Y*
10010271-GGCCA-G 10172662-GGCCA-G *
10010268-C-CCCCTT 10172659-C-CCCCTT *
10010267-A-AT 10172658-A-AT *
9942310-G-T 10104701-G-T Y*
9937765-T-G 10100156-T-G Y*
10598753-G-C *
9772858-T-C 9935249-T-C Y*
9853487-T-C 10015878-T-C YY*
9848330-TCTGCATATC-T 10010721-TCTGCATATC-T *
9845507-G-A 10007898-G-A YY*
9845470-AAAAG-A 10007861-AAAAG-A *
9834653-C-A 9997044-C-A YY*
9810725-T-A 9973116-T-A YY*
9774340-A-C 9936731-A-C Y*
9763232-TTTCAAGTG-T 9925623-TTTCAAGTG-T *
9863355-TTTTGAATCTTC-T 10025746-TTTTGAATCTTC-T *
9697142-A-G 9859533-A-G IR3_Prx *
13484222-T-G 11328546-T-G *
9503692-C-T 9666083-C-T BY181391 *
9452072-TG-T 9614463-TG-T *
9406957-G-A 9569348-G-A YY*
9402566-CGTTG-C 9564957-CGTTG-C *
9397768-C-G 9560159-C-G YY*
9397765-T-TACCGAGCCCCTGATA 9560156-T-TACCGAGCCCCTGATA *
9858603-ACCCTTACC-A 10020994-ACCCTTACC-A *
9866585-A-G 10028976-A-G YY*
9937756-A-G 10100147-A-G Y*
9914617-G-T 10077008-G-T Y*
9937753-A-C 10100144-A-C Y*
9919149-A-T 10081540-A-T Y*
9919139-A-T 10081530-A-T Y*
9919124-C-A 10081515-C-A Y*
9919122-T-TCAA 10081513-T-TCAA *
9916002-A-G 10078393-A-G Y*
9914622-G-C 10077013-G-C Y*
9914618-A-T 10077009-A-T Y*
9914612-C-T 10077003-C-T Y*
9867934-T-C 10030325-T-C YY*
9914597-A-G 10076988-A-G Y*
9914592-C-T 10076983-C-T Y*
9910091-A-T 10072482-A-T Y*
9909800-C-T 10072191-C-T Y*
9909787-T-A 10072178-T-A Y*
9909775-G-A 10072166-G-A Y*
9898704-ACAAATCAGTATGTTGAAG-A 10061095-ACAAATCAGTATGTTGAAG-A *
9879122-CT-C 10041513-CT-C 10×T*
10598750-G-A *
10598755-A-T *
10798040-C-A *
10772012-A-ACGCCT *
10773214-C-T *
10773213-A-G *
10773202-CATTACATTCA-C *
10773200-T-G *
10773189-T-TCAA *
10773183-ATTCTGT-A *
10773181-C-CCAA *
10768746-G-A *
10773229-C-G *
10768739-A-T *
10768719-A-T *
10768716-TC-T *
10768685-T-G *
10768646-TCCATTCCAATCCATTCTTTTC-T *
10768632-CCATTCCATT-C *
10768617-GCAT-G *
10768614-ATT-A *
10773216-C-A *
10774051-G-GTTCCGTTCCATTCCATTCCATTCCAATCTATTCGGGTTAATTGCATTCCATTCCATTCTATTGCAATCGTGTTGATTCCATTCCATTCCATTCCATTCCATTCCT *
10763653-T-C *
10792329-TTCCA-T *
10798015-C-G *
10798009-C-T *
10798004-CCAA-C *
10797995-CATACCAA-C *
10797743-ATTCCATTCCATACCACTCCACTCCACTCTTCTCCACTCCACTCCTCTCTATTCCATTCCATTTCATACCACTGTCCCCCATCAACTCCACTCAACTTCACTCCTCAACACTTCTCTCCGTTCTTTTTGTTCTTTTCCT-A *
10796962-A-C *
10796177-C-CGGATG *
10792320-GCCA-G *
10776353-T-C *
10792316-CCA-C *
10792300-TCCAATCCAATCC-T *
10792285-TCCAATCCACCCCA-T *
10791027-T-TGAA *
10787904-CTCA- *
10787337-C-T *
10787326-A-C *
10778870-T-A *
10765830-A-C *
10763648-A-AT *
10604331-T-A *
10648128-ATCCT-A *
10671793-A-T *
10664409-C-CATTGCACTCGGGTTG *
10664401-T-C *
10658128-A-ACTACC *
10657887-CACTAA-C *
10648154-C-T *
10648133-ATTCTATTGAAC-A *
10627183-T-C *
10673924-ATTCCATTCCATTCCATTGCACCCCATT- *
10627182-T-A *
10627178-T-C *
10627173-T-C *
10627165-AAC-A *
10627164-T-TTCATTGC *
10627160-A-C *
10625269-AAAAT-A *
10617065-T-C *
10671801-CGGCCTCATTG-C *
10684633-C-T *
10763647-A-ATTGC *
10754312-T-C *
10759137-ACTGCATT-A *
10756656-T-A *
10756642-T-A *
10756636-C-CCAA *
10756635-T-C *
10756633-C-CGA *
10756623-C-CTTTTCAATTT *
10754319-T-G *
10754309-C-G *
10692667-C-T *
10751646-T-C *
10749947-AAT-A *
10749943-TTCC-T *
10747898-GATATAAAGTGGCCAAATCGTAACTAACATTTCATTAATC-G *
10747894-ACG-A *
10747820-ACTCCATTCCATTCCATTCCAATGCACTCCATTCCATTCCATTCTACTCCGTTCCAATCCATCCCTTTACTTC-A *
10744523-C-G *
10693737-TC-T *
11030783-A-ATGGT *
11032235-A-C *
13828682-A-AAAAGC 11707976-A-AAAAGC *
13485250-G-A 11329574-G-A *
13488000-C-A 11332324-C-A *
13487995-G-T 11332319-G-T *
13485303-G-A 11329627-G-A *
13485298-G-A 11329622-G-A *
13485280-C-T 11329604-C-T *
13485262-T-C 11329586-T-C *
13485256-A-T 11329580-A-T *
13485194-G-A 11329518-G-A *
11332391-T- *
13485189-G-T 11329513-G-T *
13485027-C-G 11329351-C-G *
13484944-A-G 11329268-A-G *
13482925-G-T 11327249-G-T *
13482536-G-A 11326860-G-A *
13481101-G-C 11325425-G-C *
13480971-A-C 11325295-A-C *
13479311-G-T 11323635-G-T *
13488005-C-G 11332329-C-G *
13488107-T-A 11332431-T-A *
11323459-C- *
13489695-C-G 11334019-C-G *
13512932-TG-T 11357256-TG-T *
13500664-T-G 11344988-T-G *
13489994-G-A 11334318-G-A *
11334089-TAC- *
13489757-C-CT 11334081-C-CT *
13489754-C-CTG 11334078-C-CTG *
13489740-C-A 11334064-C-A *
11333295-C- *
13488132-G-T 11332456-G-T *
11333294-G- *
13488954-C-T 11333278-C-T *
13488825-GCGTGACAGCC-G 11333149-GCGTGACAGCC-G *
11333037-GCCA- *
13488597-CACGA-C 11332921-CACGA-C *
13488594-C-CTGTG 11332918-C-CTGTG *
11332902-C- *
11332901-C- *
13479275-C-T 11323599-C-T *
13479134-CCT-C 11323458-CCT-C *
13525676-CTT-C 11370000-CTT-C *
13477591-G-T 11321915-G-T *
13477787-T-C 11322111-T-C *
13477785-C-CG 11322109-C-CG *
13477779-CACT-C 11322103-CACT-C *
13477743-G-A 11322067-G-A BY85982 *
13477742-C-G 11322066-C-G *
13477741-G-A 11322065-G-A *
13477593-C-T 11321917-C-T *
13477582-C-T 11321906-C-T FT278653 *
13477791-T-TGG 11322115-T-TGG *
13477578-A-G 11321902-A-G *
13477568-C-A 11321892-C-A *
13477564-T-C 11321888-T-C *
13477555-C-T 11321879-C-T *
13477552-A-G 11321876-A-G *
13477550-AC-A 11321874-AC-A *
13477546-C-A 11321870-C-A *
13477542-A-AT 11321866-A-AT *
13477789-T-C 11322113-T-C *
13477806-C-T 11322130-C-T *
13479133-G-GAT 11323457-G-GAT *
13478703-G-C 11323027-G-C *
11323443-T- *
11323442-CTAT- *
13478862-C-CACAA 11323186-C-CACAA *
11323178-A- *
11323175-CGA- *
13478844-C-A 11323168-C-A *
13478725-G-T 11323049-G-T *
13478719-GC-G 11323043-GC-G *
11322585-GGCA- *
13477807-A-G 11322131-A-G *
11322582-AGTG- *
13477869-A-G 11322193-A-G *
13477832-T-G 11322156-T-G *
13477831-G-C 11322155-G-C *
13477827-A-G 11322151-A-G *
13477824-A-C 11322148-A-C *
13477815-A-C 11322139-A-C *
13477813-A-C 11322137-A-C *
13521526-C-T 11365850-C-T *
13527350-T-A 11371674-T-A *
13477410-A-G 11321734-A-G *
11656584-G-C *
11659967-G-C *
11656618-GA-G *
11656616-A-AT *
11656606-A-T *
11656605-T-A *
11656589-AAG-A *
11656587-T-TGG *
11656578-T-G *
11676334-A-ATCAACTACAT *
11656572-C-T FT450539 *
11656568-G-T FT411653 *
11656553-G-T *
11656546-G-T FT450538 *
11655430-T-A *
11648095-G-A *
13730132-A-G 11574456-A-G *
13721112-G-C 11565436-G-C *
11666399-T-TATTGAG *
11676337-G-T *
13719688-A-G 11564012-A-G *
13808010-G-A 11687304-G-A *
13828680-G-A 11707974-G-A *
13828679-T-A 11707973-T-A *
13825146-TG-T 11704440-TG-T *
13814157-G-C 11693451-G-C *
13814156-G-A 11693450-G-A *
13808030-T-C 11687324-T-C *
13808028-A-T 11687322-A-T *
13804066-G-A 11683360-G-A *
11677463-A-G *
13804048-C-T 11683342-C-T *
13804039-T-A 11683333-T-A *
13804038-A-T 11683332-A-T *
13804033-C-T 11683327-C-T *
13803356-TTGAA-T 11682650-TTGAA-T *
13802279-A-G 11681573-A-G *
13802278-C-T 11681572-C-T *
13802269-G-A 11681563-G-A *
13721108-TA-T 11565432-TA-T *
13714284-T-C 11558608-T-C *
13574387-C-G 11418711-C-G *
13653110-A-ACCCG 11497434-A-ACCCG *
13675441-T-A 11519765-T-A *
13668180-T-G 11512504-T-G *
13668175-G-T 11512499-G-T *
13658258-G-C 11502582-G-C *
13653117-T-G 11497441-T-G *
13653113-G-GC 11497437-G-GC *
13653112-G-GT 11497436-G-GT *
13653107-CG-C 11497431-CG-C *
13678088-C-T 11522412-C-T *
13653106-T-A 11497430-T-A FTA1405 *
13653078-G-A 11497402-G-A *
13650778-G-GGT 11495102-G-GGT *
13650773-A-G 11495097-A-G *
13645450-G-A 11489774-G-A BY10954 *
13642661-C-T 11486985-C-T *
13607935-T-C 11452259-T-C *
13605789-AT-A 11450113-AT-A 10×T*
13676190-A-G 11520514-A-G *
13678089-G-C 11522413-G-C *
13714251-G-T 11558575-G-T *
13692669-G-T 11536993-G-T *
13711187-ATCGAATGGAATGGAG-A 11555511-ATCGAATGGAATGGAG-A *
13706415-A-G 11550739-A-G *
13706075-A-C 11550399-A-C *
11545966-C- *
13695631-G-A 11539955-G-A *
13693745-CATAGA-C 11538069-CATAGA-C *
13692870-G-A 11537194-G-A *
13692682-A-G 11537006-A-G *
13692665-GA-G 11536989-GA-G *
13678098-G-T 11522422-G-T *
13691315-A-G 11535639-A-G *
13688235-T-TGGAATGGAATG 11532559-T-TGGAATGGAATG *
13684675-TA-T 11528999-TA-T *
13678118-C-T 11522442-C-T BY88102 *
13678112-TGGCA-T 11522436-TGGCA-T *
13678109-GA-G 11522433-GA-G *
13678103-A-G 11522427-A-G *
13678099-C-G 11522423-C-G *
13477417-A-G 11321741-A-G *
13477409-C-T 11321733-C-T *
11032236-C-T *
13443692-C-G 11288016-C-G *
13458736-C-CCCTGCACGGCG 11303060-C-CCCTGCACGGCG *
13455236-A-T 11299560-A-T FT443810 *
13455081-A-T 11299405-A-T *
13454926-A-G 11299250-A-G *
13454923-T-A 11299247-T-A *
13454906-C-G 11299230-C-G *
13454899-T-TTGCAATCGAGTTGAA 11299223-T-TTGCAATCGAGTTGAA *
13442665-A-G 11286989-A-G *
13460166-TGACAAGGCCCCTTTAAGCAGACCCTCGACAATAGTTACATCAC-T 11304490-TGACAAGGCCCCTTTAAGCAGACCCTCGACAATAGTTACATCAC-T *
13434566-A-T 11278890-A-T *
13412904-A-G 11257228-A-G *
13399220-A-G 11243544-A-G *
13395185-G-T 11239509-G-T *
13395172-C-T 11239496-C-T *
13391753-T-C 11236077-T-C *
13381617-A-C 11225941-A-C *
13380779-A-C 11225103-A-C *
13458738-T-TACACTTCACTCAATTCTAA 11303062-T-TACACTTCACTCAATTCTAA *
13460229-A-T 11304553-A-T *
13377178-G-T 11221502-G-T *
13462530-C-G 11306854-C-G *
13464416-T-C 11308740-T-C *
11307761-T- *
13462937-G-C 11307261-G-C *
13462854-G-A 11307178-G-A *
13462810-A-T 11307134-A-T *
13462699-G-C 11307023-G-C *
13462593-G-A 11306917-G-A *
13462519-C-A 11306843-C-A *
13460381-C-T 11304705-C-T *
13461867-A-C 11306191-A-C *
13460719-C-T 11305043-C-T *
13460717-C-T 11305041-C-T *
13460621-G-T 11304945-G-T *
13460560-A-C 11304884-A-C *
13460469-A-AGG 11304793-A-AGG *
13460466-GCA-G 11304790-GCA-G *
13460390-G-A 11304714-G-A *
13377179-A-G 11221503-A-G *
13356957-T-C 11201281-T-C *
13467710-G-T 11312034-G-T *
13196263-C-T 11040587-C-T *
13340766-A-AATC 11185090-A-AATC *
13322447-C-T 11166771-C-T *
13304060-CATTGATATGTCAAAGA-C 11148384-CATTGATATGTCAAAGA-C *
13285229-G-T 11129553-G-T *
13266638-G-T 11110962-G-T *
13250624-G-A 11094948-G-A *
13196264-A-G 11040588-A-G *
11039720-CACCATTCCACTGCCCTCCACTTCACCCCACTCCAGTACATTCCACTGCCTTCCATTCCACTCCACTCCAGTTCACTCCACTCCACTCCACTCCACTGCAT- *
13340771-TACAA-T 11185095-TACAA-T *
13195376-CTCCATTCCATTCCATTCCACACCATTCCACTGCCCTCCACTTCACCCCACTCCAGTACATTCCACTGCCTTCCATTCCACTCCACTCCAG-C 11039700-CTCCATTCCATTCCATTCCACACCATTCCACTGCCCTCCACTTCACCCCACTCCAGTACATTCCACTGCCTTCCATTCCACTCCACTCCAG-C *
11039683-CAATCCACTCCTCTCCACTCCATT- *
11039591-TCCATTCCACTGCACTCCACTCAAGTCCGCTCCACTCCACTCCAATCCATTTCATTCCAATCTATTCCATTCTACTCCACTCCACTCC- *
11039582-CCAT- *
11039563-CACTACACTACACGCCAT- *
13195231-TTCCACTCCACTACACTACACGCCATTCCATTCCACTCCATTCCACTGCACTCCACTCAAGTCCGCTCCACTCCACTCCAATCCATTTCATTCCAATCTATTCCATTCTACTCCACTCCACTCCACACCAA-T 11039555-TTCCACTCCACTACACTACACGCCATTCCATTCCACTCCATTCCACTGCACTCCACTCAAGTCCGCTCCACTCCACTCCAATCCATTTCATTCCAATCTATTCCATTCTACTCCACTCCACTCCACACCAA-T *
11037730-CACCTA-C *
11032258-G-A *
13340769-T-C 11185093-T-C *
13340776-G-GT 11185100-G-GT *
13356948-C-G 11201272-C-G *
13348900-C-T 11193224-C-T *
13356939-G-C 11201263-G-C *
13356938-A-C 11201262-A-C *
13356927-C-T 11201251-C-T *
13356918-C-A 11201242-C-A FT443177 *
13356899-G-T 11201223-G-T *
13356861-T-C 11201185-T-C *
13356629-G-T 11200953-G-T 11×A*
13352364-TAA-T 11196688-TAA-T *
13347474-T-C 11191798-T-C *
13340814-ACTC-A 11185138-ACTC-A *
13347455-C-G 11191779-C-G *
13340848-T-C 11185172-T-C *
13340844-C-T 11185168-C-T *
13340833-T-TATATG 11185157-T-TATATG *
13340830-T-C 11185154-T-C *
13340826-G-GGA 11185150-G-GGA *
13340825-G-GA 11185149-G-GA *
13340819-T-G 11185143-T-G *
13464737-A-C 11309061-A-C *
13468008-A-T 11312332-A-T *
13477402-G-T 11321726-G-T *
13472984-C-A 11317308-C-A *
13473868-G-T 11318192-G-T *
13473867-T-A 11318191-T-A *
11317825-C- *
13473498-G-A 11317822-G-A *
13473474-A-G 11317798-A-G *
13473473-C-T 11317797-C-T *
13473004-C-T 11317328-C-T *
13472952-A-C 11317276-A-C *
13473887-G-T 11318211-G-T *
13472930-C-G 11317254-C-G *
13472895-A-T 11317219-A-T *
11316800-CT- *
11316615-C- *
13472147-TG-AG,T 11316471-TG-AG,T *
13471905-G-T 11316229-G-T *
13471785-C-A 11316109-C-A *
13471784-G-A 11316108-G-A *
13473876-A-T 11318200-A-T *
13475942-A-T 11320266-A-T *
13471693-T-G 11316017-T-G *
11321421-A- *
13477397-C-A 11321721-C-A *
13477385-G-T 11321709-G-T *
13477373-C-CAT 11321697-C-CAT *
13477370-TGG-T 11321694-TGG-T *
13477357-C-G 11321681-C-G *
13477234-A-T 11321558-A-T *
13477112-C-T 11321436-C-T FT444132 *
13476820-C-T 11321144-C-T *
13475953-G-C 11320277-G-C *
11321107-A- *
13476778-GTTCCA-G 11321102-GTTCCA-G *
13476775-T-TAAGAA 11321099-T-TAAGAA *
13476735-C-T 11321059-C-T *
13476717-C-G 11321041-C-G *
13476553-T-A 11320877-T-A *
13476552-G-GCT 11320876-G-GCT *
13476187-CATAAATAGAGCCTAGACAAGGGTCCCATCACCTGGGTGATCAGTGCAGAAATATGTCACAATGTCCCCATAGGCAGATCTAACACAAGAGTTACATCACCTGGGTGATAGG-C 11320511-CATAAATAGAGCCTAGACAAGGGTCCCATCACCTGGGTGATCAGTGCAGAAATATGTCACAATGTCCCCATAGGCAGATCTAACACAAGAGTTACATCACCTGGGTGATAGG-C *
13471754-A-C 11316078-A-C *
13471687-C-A 11316011-C-A *
13468013-A-T 11312337-A-T *
13469362-CAT-C 11313686-CAT-C *
13470381-TTCCGTGGTGGGGTGGGCTGTCCCAGGGCTCACCGCCATTCATGAAGGGGTGCAGCCTGCCTGTCTGCGTGCCTTTATAAGAGC-T 11314705-TTCCGTGGTGGGGTGGGCTGTCCCAGGGCTCACCGCCATTCATGAAGGGGTGCAGCCTGCCTGTCTGCGTGCCTTTATAAGAGC-T *
13470293-TCATTTCTCCAGCCTCACCACAGCCATCAGCACGCCCTCCCCACCACCCCACCACCACACGGCCGCAGGCCTCGACTCCCTGGGAA-T 11314617-TCATTTCTCCAGCCTCACCACAGCCATCAGCACGCCCTCCCCACCACCCCACCACCACACGGCCGCAGGCCTCGACTCCCTGGGAA-T *
13470144-C-T 11314468-C-T *
13469547-A-G 11313871-A-G *
13469535-G-T 11313859-G-T *
13469371-G-GCTCC 11313695-G-GCTCC *
13469367-CTGAG-C 11313691-CTGAG-C *
13469359-T-TAA 11313683-T-TAA *
13470517-G-T 11314841-G-T *
13468886-A-G 11313210-A-G *
13468664-GAGCTTAGACAAGAGTTATATCACCTGGGTGATCAGTGCAGTGGTATGTCACAA-G 11312988-GAGCTTAGACAAGAGTTATATCACCTGGGTGATCAGTGCAGTGGTATGTCACAA-G *
13468661-G-C 11312985-G-C *
13468647-ACAACCCCC-A 11312971-ACAACCCCC-A *
13468635-CAGAGATATGT-C 11312959-CAGAGATATGT-C *
13468581-AAGCACCCTGTAGGCAAATCCTAGAGAAGAGTTATATCACCTGGATGATCAG-A 11312905-AAGCACCCTGTAGGCAAATCCTAGAGAAGAGTTATATCACCTGGATGATCAG-A *
13468049-AGGCAGAACTTG-A 11312373-AGGCAGAACTTG-A *
13468029-A-G 11312353-A-G *
13470498-G-A 11314822-G-A *
13470554-C-A 11314878-C-A *
13471643-C-G 11315967-C-G *
13470755-C-T 11315079-C-T *
13471606-C-T 11315930-C-T *
13471602-A-G 11315926-A-G *
13471124-G-T 11315448-G-T *
13470962-CGCTAGGG-C 11315286-CGCTAGGG-C *
13470808-G-T 11315132-G-T *
13470783-G-A 11315107-G-A *
13470774-G-GA 11315098-G-GA *
13470770-TC-T 11315094-TC-T *
13470744-GTACC-G 11315068-GTACC-G *
13470556-G-GA 11314880-G-GA *
13470743-A-ATAAT 11315067-A-ATAAT *
13470737-C-A 11315061-C-A *
13470728-G-A 11315052-G-A *
13470726-C-G 11315050-C-G *
13470725-C-T 11315049-C-T *
13470721-C-T 11315045-C-T *
13470716-G-C 11315040-G-C *
11314884-G- *
13484253-C-T 11328577-C-T *
13480357-A-AGT 11324681-A-AGT *
13484209-G-C 11328533-G-C *
13471149-A-G 11315473-A-G *
13828662-C-A 11707956-C-A Y138279 *
16025338-C-T 13913458-C-T Y*
13680966-G-A 11525290-G-A *
28800436-G-T 26654289-G-T *
28800421-C-A 26654274-C-A *
28800419-C-T 26654272-C-T *
28800418-A-G 26654271-A-G *
13271851-G-A 11116175-G-A *
22475724-G-T 20313838-G-T DYZ19 *
13473869-T-A 11318193-T-A *
22510079-A-G 20348193-A-G DYZ19 *
22448617-T-A 20286731-T-A DYZ19 *
22448602-C-A 20286716-C-A DYZ19 *
58854540-T-C 56736331-A-G *
22509088-G-C 20347202-G-C DYZ19 *
22505779-T-A 20343893-T-A DYZ19 *
22509092-T-G 20347206-T-G DYZ19 *
13719069-G-A 11563393-G-A *
22475730-A-G 20313844-A-G DYZ19 *
28802727-T-G 26656580-T-G *
13462929-A-T 11307253-A-T *
19165992-CT-C 17054112-CT-C 10×T*
13487819-C-T 11332143-C-T *
9991990-A-T 10154381-A-T Y*
13462988-T-C 11307312-T-C *
9997088-A-T 10159479-A-T Y*
9989353-C-T 10151744-C-T Y*
13462956-G-A 11307280-G-A *
13488856-G-T 11333180-G-T A16243 *
13298607-T-C 11142931-T-C *
13476807-C-T 11321131-C-T *
13488929-C-T 11333253-C-T *
13462916-T-G 11307240-T-G *
13499807-TAA-T 11344131-TAA-T 11×A*
22475549-C-A 20313663-C-A DYZ19 *
13474339-A-T 11318663-A-T *
13477719-G-C 11322043-G-C *
13489769-C-T 11334093-C-T *
58914478-C-T 56676393-G-A *
14609799-C-CA 12498001-C-CA 23×A*
13462592-C-T 11306916-C-T *
58985083-G-T 56838936-G-T *
9916133-A-C 10078524-A-C Y*
58996994-C-A 56850847-C-A *
9924423-G-A 10086814-G-A Y*
9919152-G-C 10081543-G-C Y*
9909196-T-C 10071587-T-C Y*
58891434-T-C 56699437-A-G *
4763687-AT-A 4895646-AT-A 24×T*
58912884-A-C 56677987-T-G *
10068347-A-C 10230738-A-C *
13486591-T-C 11330915-T-C *
58997130-T-C 56850983-T-C *
13462958-C-T 11307282-C-T FT443943 *
13433218-G-A 11277542-G-A *
8274571-CTT-C 8406530-CTT-C 12×T*
10043110-A-T 10205501-A-T *
10043071-G-A 10205462-G-A *
9925276-G-A 10087667-G-A Y*
9925265-A-G 10087656-A-G Y*
10068370-T-A 10230761-T-A *
9986969-A-T 10149360-A-T Y*
13471231-C-T 11315555-C-T *
22463983-G-T 20302097-G-T BY221227 DYZ19 *
13489571-G-T 11333895-G-T *
13347859-G-A 11192183-G-A *
13347854-G-T 11192178-G-T *
13347449-T-C 11191773-T-C *
13345159-T-A 11189483-T-A A3795 *
13487993-T-C 11332317-T-C *
13478216-G-A 11322540-G-A A15570 *
10081895-G-T 10244286-G-T *
13489992-T-A 11334316-T-A *
58829318-C-T 56761553-G-A *
13259964-G-C 11104288-G-C *
58882362-G-T 56708509-C-A *
58846327-T-C 56744544-A-G *
28818701-T-A 26672554-T-A *
9924421-G-T 10086812-G-T Y*
10081903-G-T 10244294-G-T *
5702620-CA-C 5834579-CA-C 25×A*
13462610-C-T 11306934-C-T *
13474599-A-T 11318923-A-T *
58856623-A-C 56734248-T-G *
13364575-G-T 11208899-G-T *
58898266-T-C 56692605-A-G *
58898263-C-G 56692608-G-C *
58898204-C-T 56692667-G-A *
22508009-G-T 20346123-G-T DYZ19 *
13698997-G-C 11543321-G-C *
58856639-T-G 56734232-A-C *
13721237-G-T 11565561-G-T *
13468739-A-G 11313063-A-G *
13726384-A-G 11570708-A-G *
58848056-A-T 56742815-T-A *
9962446-T-G 10124837-T-G Y*
13477259-G-A 11321583-G-A *
13477253-C-T 11321577-C-T *
13477249-A-G 11321573-A-G *
13136145-G-A 10625631-G-A *
13136141-C-CTG 10625627-C-CTG *
13474540-C-A 11318864-C-A *
58910397-C-G 56680474-G-C *
9944139-G-A 10106530-G-A Y*
56752398-A-G *
10821516-G-C *
56841639-A-G *
10799657-T-C *
10798042-C-T FT108563 *
10799655-C-T *
13487710-C-A 11332034-C-A *
11012297-GCATTC-G *
10902216-C-T *
9990556-T-TAAAA 10152947-T-TAAAA *
11011998-G-C *
11011990-A-T *
11011983-C-T *
11011980-T-A *
11011960-C-G *
23013636-T-TTTA 20851750-T-TTTA 6×TTA*
10879510-C-G *
10791934-A-C *
13471968-C-T 11316292-C-T *
13468174-A-G 11312498-A-G *
13488678-G-A 11333002-G-A *
9949478-C-G 10111869-C-G Y*
13450884-T-TCCACTCCTCTCCCCAACACTCCACC 11295208-T-TCCACTCCTCTCCCCAACACTCCACC *
13257287-ATATTTT-A 11101611-ATATTTT-A *
13245065-G-GTCCTGCTC 11089389-G-GTCCTGCTC *
5991178-T-C 6123137-T-C *
58893731-T-C 56697140-A-G *
9949465-A-AT 10111856-A-AT 8×T*
13866589-G-A 11745883-G-A *
5193820-A-G 5325779-A-G *
58979510-C-CTCCACACCATTCCAT,CTCCATTCCATTCCATTCTACTCCATTCCAT 56833363-C-CTCCACACCATTCCAT,CTCCATTCCATTCCATTCTACTCCATTCCAT *
22298454-G-C 20136568-G-C DYZ19 *
22298450-T-C 20136564-T-C A4067 DYZ19 *
13465389-C-G 11309713-C-G *
13462719-A-G 11307043-A-G *
13465414-T-A 11309738-T-A *
10006069-G-A 10168460-G-A Y*
13478532-G-T 11322856-G-T *
13680972-A-T 11525296-A-T *
28795834-ATGAAT-A 26649687-ATGAAT-A *
59009226-A-AAACC 56863079-A-AAACC *
22229201-A-G 20067315-A-G BY23228 DYZ19 *
28549459-C-A 26403312-C-A *
22229191-T-C 20067305-T-C BY23225 DYZ19 *
13804050-C-T 11683344-C-T *
7179734-G-GTT 7311693-G-GTT 25×T*
13693461-A-G 11537785-A-G *
28549469-G-T 26403322-G-T *
13471975-G-A 11316299-G-A *
9964551-C-A 10126942-C-A Y*
28814583-T-A 26668436-T-A *
13477480-T-C 11321804-T-C *
13259827-G-C 11104151-G-C *
13477464-A-G 11321788-A-G *
13477420-G-A 11321744-G-A *
9986899-A-G 10149290-A-G Y*
9986873-C-G 10149264-C-G Y*
22510502-G-T 20348616-G-T BY225650 DYZ19 *
23376960-AAAT-A 21215074-AAAT-A 5×AAT*
13451455-A-G 11295779-A-G *
9964311-C-A 10126702-C-A Y*
5281438-T-C 5413397-T-C *
13333852-C-A 11178176-C-A *
10929890-C-G *
22448687-A-T 20286801-A-T DYZ19 *
22509615-T-G 20347729-T-G DYZ19 *
22509606-T-G 20347720-T-G FT90132 DYZ19 *
13471088-C-T 11315412-C-T *
13745444-C-A 11589768-C-A *
13466567-T-C 11310891-T-C *
13462944-A-T 11307268-A-T *
22448689-G-T 20286803-G-T DYZ19 *
13489302-C-T 11333626-C-T *
13866621-T-G 11745915-T-G *
13466830-A-G 11311154-A-G *
13488051-C-T 11332375-C-T *
28799008-G-T 26652861-G-T 5×GGAAT*
13479063-C-T 11323387-C-T *
13349508-AGG-A 11193832-AGG-A *
13488661-C-G 11332985-C-G *
13488589-G-A 11332913-G-A *
13488550-C-T 11332874-C-T *
13472741-G-A 11317065-G-A *
9328907-T-C 9491298-T-C Y*
13488503-C-T 11332827-C-T *
58891353-T-A 56699518-A-T *
9432663-C-A 9595054-C-A FTB17297 Y*
58916381-C-T 56674490-G-A *
21634040-A-G 19472154-A-G Y*
21634039-C-T 19472153-C-T Y*
58912656-T-C 56678215-A-G *
58891476-C-A 56699395-G-T *
58891429-T-C 56699442-A-G *
13356717-C-T 11201041-C-T FGC43842 *
13470955-G-A 11315279-G-A F10781 *
13489016-C-T 11333340-C-T *
58872705-A-T 56718166-T-A *
22472931-A-G 20311045-A-G FGC27674 DYZ19 *
9954418-A-G 10116809-A-G Y*
58882431-T-A 56708440-A-T *
58882402-C-T 56708469-G-A *
58827198-T-C 56763673-A-G *
58827044-A-T 56763827-T-A *
13488543-C-T 11332867-C-T *
13487826-C-A 11332150-C-A *
10071430-C-G 10233821-C-G *
10063365-T-A 10225756-T-A *
13482172-C-A 11326496-C-A *
13482150-G-A 11326474-G-A *
13482140-C-A 11326464-C-A *
13446001-G-T 11290325-G-T *
10075716-G-T 10238107-G-T FT427320 *
10075712-G-T 10238103-G-T *
10075709-A-G 10238100-A-G *
9964038-T-C 10126429-T-C Y*
13483376-C-T 11327700-C-T *
9959781-G-C 10122172-G-C Y*
9957957-C-A 10120348-C-A Y*
9939183-A-G 10101574-A-G Y*
9939106-C-T 10101497-C-T Y*
58997033-G-A 56850886-G-A *
58997032-A-G 56850885-A-G *
13482463-A-G 11326787-A-G *
13465573-A-C 11309897-A-C *
13482175-G-C 11326499-G-C *
13500400-G-C 11344724-G-C *
13349496-C-T 11193820-C-T FGC5222 *
58985893-T-C 56839746-T-C *
58855332-GCATTC-G 56735514-CAATGG-C 4×CATTC*
13489621-C-CCTT 11333945-C-CCTT *
58846313-AG-A 56744555-TC-T *
13488369-C-T 11332693-C-T *
13488365-G-A 11332689-G-A *
58842970-G-C 56747901-C-G *
13489718-C-T 11334042-C-T *
13489701-C-A 11334025-C-A *
13477500-G-C 11321824-G-C *
13559826-T-A 11404150-T-A *
13463011-C-T 11307335-C-T *
10068402-G-A 10230793-G-A FGC24469 *
10005500-C-T 10167891-C-T Y*
10004373-T-C 10166764-T-C Y*
10004319-A-AT 10166710-A-AT *
9986278-A-G 10148669-A-G Y*
9986273-A-C 10148664-A-C Y*
58970175-A-T 56824028-A-T *
13470669-G-C 11314993-G-C *
13379472-G-A 11223796-G-A *
13466469-C-T 11310793-C-T *
13477871-G-T 11322195-G-T FGC409 *
13473632-A-T 11317956-A-T *
13340813-T-C 11185137-T-C *
13478473-G-T 11322797-G-T *
10006430-A-G 10168821-A-G Y*
13481775-C-A 11326099-C-A *
22486543-C-T 20324657-C-T DYZ19 *
22486511-C-T 20324625-C-T DYZ19 *
58869271-C-T 56721600-G-A *
58916343-T-C 56674528-A-G *
58869256-C-T 56721615-G-A *
13479116-G-A 11323440-G-A *
58856656-AATTCCATTCC-A 56734195-AGAATGGAATG-A *
13446147-C-T 11290471-C-T *
13476776-C-A 11321100-C-A *
22505733-T-G 20343847-T-G DYZ19 *
13462566-C-T 11306890-C-T FGC39802BY41740 *
13454588-A-G 11298912-A-G *
13516786-C-A 11361110-C-A *
59000362-G-A 56854215-G-A *
4975960-C-T 5107919-C-T *
10027256-G-T 10189647-G-T Y*
13711545-A-G 11555869-A-G *
16242402-CTTTT-C 14130522-CTTTT-C 18×T*
58880435-A-T 56710436-T-A *
58880323-C-T 56710548-G-A *
4227070-G-C 4359029-G-C *
13504498-C-CAAAA 11348822-C-CAAAA 12×A*
13522198-G-C 11366522-G-C *
9942320-T-G 10104711-T-G Y*
13488447-C-A 11332771-C-A *
13377261-CTG-C 11221585-CTG-C *
24490594-G-A 22344447-G-A FGC28012 *
19025744-G-A 16913864-G-A Y*
13611331-C-T 11455655-C-T *
13583616-C-T 11427940-C-T *
13488505-G-A 11332829-G-A *
13488475-C-T 11332799-C-T *
13488462-G-T 11332786-G-T *
13576724-C-T 11421048-C-T FT445677 *
2911533-C-CA 3043492-C-CA 10×A*
10041552-TA-T 10203943-TA-T *
13474378-T-A 11318702-T-A *
13455121-T-G 11299445-T-G 8×TTCCA*
9985868-G-C 10148259-G-C Y*
9985857-C-A 10148248-C-A Y*
13462670-G-A 11306994-G-A *
13461834-C-T 11306158-C-T *
22295408-T-G 20133522-T-G DYZ19 *
13468321-GC-G 11312645-GC-G *
13468093-A-T 11312417-A-T *
13488124-C-T 11332448-C-T *
13472805-C-T 11317129-C-T *
22480260-G-C 20318374-G-C DYZ19 *
13462676-G-C,T 11307000-G-C,T *
3154138-T-G 3286097-T-G *
9924454-G-A 10086845-G-A Y*
13479593-T-G 11323917-T-G *
13479581-T-A 11323905-T-A *
13472272-G-A 11316596-G-A S14069 *
13490013-G-C 11334337-G-C *
13474589-A-T 11318913-A-T *
9984239-A-C 10146630-A-C Y*
13465347-T-C 11309671-T-C *
9984234-T-C 10146625-T-C Y*
28785729-GTGGAA-G 26639582-GTGGAA-G 6×TGGAA*
13483345-G-A 11327669-G-A *
9977607-C-T 10139998-C-T Y*
13487970-G-A 11332294-G-A *
58827095-C-G 56763776-G-C *
58827074-C-T 56763797-G-A *
10037726-C-A 10200117-C-A *
13465345-G-C 11309669-G-C *
22508449-G-T 20346563-G-T DYZ19 *
58846436-A-T 56744435-T-A *
58874799-C-G 56716072-G-C *
58874792-T-C 56716079-A-G *
58838655-T-C 56752216-A-G *
58826927-T-A 56763944-A-T *
22485576-C-G 20323690-C-G DYZ19 *
58843222-T-C 56747649-A-G *
22508468-T-C 20346582-T-C DYZ19 *
10929887-G-A *
10929891-C-T *
13711248-T-A 11555572-T-A *
10848933-A-G *
9958044-G-A 10120435-G-A Y*
10768690-T-C *
18848067-C-G 16736187-C-G Y*
13708970-G-A 11553294-G-A *
13483715-C-A 11328039-C-A *
10848951-T-C FT219996 *
10848941-C-T *
10848929-T-C *
10932742-C-T *
10848926-C-T *
10848922-T-A *
10848916-C-A *
10848909-T-C *
10848908-T-A *
10848901-C-T *
10848899-T-C *
10848895-C-T *
56710438-A-T *
10982863-T-C FT94207 *
17218202-C-T 15106322-C-T YY*
10975895-A-G *
10934283-T-C *
13483732-G-C 11328056-G-C *
13483730-G-C 11328054-G-C *
13483720-G-A 11328044-G-A *
13483716-C-A 11328040-C-A *
13483714-G-A 11328038-G-A *
13463555-G-A 11307879-G-A *
13701723-C-G 11546047-C-G FGC45645 *
10982868-T-G *
10936910-C-T *
10936894-C-T *
10936887-C-CACTTA *
10936882-C-T *
10823086-A-AC *
13480942-C-G 11325266-C-G *
10787976-C-A *
10982874-T-A *
10995461-C-T *
4131493-TA-T 4263452-TA-T 9×A*
10914805-T-A *
56828284-A-AATTCCTATCC *
56847594-A-T *
11001438-A-T *
13489522-G-A 11333846-G-A *
11025605-A-C *
10759817-T-C *
13460278-C-A 11304602-C-A *
56828304-C-CGTTTG *
10648159-C-T *
13447137-CATTCCATTCCATTCCATTCT-C 11291461-CATTCCATTCCATTCCATTCT-C *
13475241-A-C 11319565-A-C *
13475224-C-A 11319548-C-A *
13475216-A-T 11319540-A-T *
10772688-C-T *
10667828-G-C *
11676354-C-A *
13488964-G-T 11333288-G-T *
10827982-G-T *
56845603-C-T *
9125132-GA-G *
10026637-C-A 10189028-C-A Y*
10889330-A-T *
56842387-CTG-C *
18723887-C-CTT 16612007-C-CTT 19×T*
10657602-T-C *
10749764-C-T *
10920447-C-A FT436576 *
8723639-C-A 8855598-C-A YY*
14971076-CTT-C 12859151-CTT-C 13×T*
10688043-T-C *
13474426-T-A 11318750-T-A *
13478118-C-A 11322442-C-A *
6984644-G-C 7116603-G-C YY*
10781232-C-G *
14060057-A-G 11939351-A-G YY*
10936932-A-C *
10936930-C-T *
10930323-T-C *
19270520-T-C 17158640-T-C YY*
10839058-T-G *
10914779-C-A *
10655877-C-T *
10954368-T-C *
9921968-G-T 10084359-G-T Y*
56677939-G-A *
58836871-C-T 56754000-G-A *
58836873-A-C 56753998-T-G *
56753978-T-C *
13488772-G-C 11333096-G-C *
13469897-G-A 11314221-G-A *
10791019-C-A *
9921880-A-G 10084271-A-G Y*
19760-C-T *
9921879-C-T 10084270-C-T Y*
9941592-T-C 10103983-T-C Y*
10920448-C-A *
10920439-A-T *
8293978-GA-G 8425937-GA-G 10×A*
13499839-A-G 11344163-A-G *
13499820-C-T 11344144-C-T *
10884478-A-T *
19731-A-T *
10913851-A-G *
10655881-A-T *
10756339-T-C *
10760016-A-T *
21115586-G-A 18953700-G-A YY*
13480368-T-A 11324692-T-A *
10969465-T-G *
13466410-G-T 11310734-G-T *
10756358-T-G *
10756340-T-A *
10756335-T-C *
10915040-T-C *
9127533-G-T 9289924-G-T Y*
10993069-C-A *
10668343-T-TCAA *
11025608-A-G *
6530569-A-AT 6662528-A-AT 9×T*
10976153-GCATTC-G *
10993018-G-T *
10915075-A-T *
19817-A-C *
11011947-C-CTTTAT *
10796176-C-A *
11029450-G-C *
11011951-A-G *
10951073-T-C FT437872 *
10791018-C-A *
13710109-G-T 11554433-G-T *
10888756-A-T *
9482683-TA-T 9645074-TA-T 10×A*
11029390-T-C *
11029412-A-C *
10906161-T-A *
13487749-C-CAAAA 11332073-C-CAAAA *
11030797-T-C *
10684622-G-C *
13461123-T-G 11305447-T-G *
10071455-G-T 10233846-G-T *
10071450-A-G 10233841-A-G *
10071422-A-C 10233813-A-C *
11029365-A-C *
11011955-C-T *
23052933-AT-A 20891047-AT-A 8×T*
13472102-C-T 11316426-C-T *
10823111-T-C *
10993056-C-T *
13489891-T-A 11334215-T-A *
13468011-T-A 11312335-T-A *
56861291-T-TA *
13460622-T-A 11304946-T-A *
10912267-C-T *
13468087-G-T 11312411-G-T *
11032301-C-T *
13458729-T-A 11303053-T-A *
10936959-C-T *
13463499-G-A 11307823-G-A *
10981247-C-A *
10806374-G-T *
10765843-A-C *
10765841-A-T *
10793286-C-A *
13474427-A-G 11318751-A-G *
10936969-C-T *
10889323-C-T *
10889309-A-G *
10799637-C-T *
56828309-A-G,T *
10796884-C-T *
10796879-T-C *
13488847-T-A 11333171-T-A *
10925375-A-T *
56860965-G-A *
10799562-T-C *
13462281-C-A 11306605-C-A *
10801531-T-C *
10905886-C-T *
13485426-A-T 11329750-A-T *
13485416-G-A 11329740-G-A *
10792279-C-T *
10792246-C-G *
11001447-A-T *
13477487-G-A 11321811-G-A *
13477472-G-A 11321796-G-A *
13479112-C-A 11323436-C-A *
10962783-A-C *
10905890-C-G *
10806380-A-C *
13488669-C-A 11332993-C-A *
8449678-C-CA 8581637-C-CA 10×A*
10932745-A-C *
10889308-C-A *
10800342-T-C *
10787977-A-C *
13485444-A-T 11329768-A-T *
10781515-G-C *
19816-T-A *
10905896-T-G *
10760012-C-T *
11030772-C-G *
10912246-A-G *
10999661-A-T *
13489134-G-A 11333458-G-A *
10985916-C-T *
11029400-G-C *
11029380-G-C *
10806385-G-T *
13469536-C-A 11313860-C-A *
10912224-A-C *
56850955-G-T *
10916363-T-G *
11030804-C-T *
10922013-C-A *
10922010-C-T *
10821925-T-C *
56850976-C-T *
56850956-G-A *
56850954-G-T *
28788033-G-T 26641886-G-T *
10993043-C-A *
10913845-G-C *
10913842-G-T *
10913841-G-T *
10913839-T-A *
28805746-T-A 26659599-T-A *
28805742-G-C 26659595-G-C *
11032265-T-A *
10791016-T-G *
56842333-C-T *
10858472-C-T *
10916376-G-T *
15330458-CA-C 13218576-CA-C 9×A*
11001448-A-C *
10756616-C-T *
10951091-T-C *
10925035-T-C *
13462170-G-T 11306494-G-T *
11012000-A-G *
7243532-CA-C 7375491-CA-C *
13722783-G-A 11567107-G-A *
10880364-T-A *
13722768-G-T 11567092-G-T *
13722761-C-A 11567085-C-A *
13722723-G-T 11567047-G-T *
56841642-T-A *
13472234-G-A 11316558-G-A *
56834832-T-A *
10797683-A-T *
10992709-T-C *
11000455-C-T *
10952499-C-G *
11032215-T-C *
10913828-C-A *
10882081-A-C *
56841238-T-C *
13460574-T-A 11304898-T-A *
10872561-T-C *
10759350-ATCCAT-A *
13726236-G-A 11570560-G-A *
10911698-G-C *
10913803-C-G *
10994189-T-A *
13488692-T-A 11333016-T-A *
9965507-A-G 10127898-A-G Y*
56850912-G-A *
10877674-A-C *
10986438-C-G *
10986436-T-C *
10986426-C-T *
10986419-C-T *
13461316-G-T 11305640-G-T *
11034839-C-A *
13489540-G-T 11333864-G-T *
10975873-A-T *
10788001-C-T *
10787999-T-C *
10787994-T-C *
10787980-T-C *
10787969-A-T *
10982875-T-A *
10688032-T-C *
10881501-T-A *
11034857-TCCATGA-T *
13484735-G-A 11329059-G-A *
10912225-G-A *
13488852-G-T 11333176-G-T *
13487583-A-G 11331907-A-G *
11035568-A-C *
10752977-C-A *
10998886-G-A *
17432010-CTTT-C 15320130-CTTT-C 21×T*
10986415-A-G *
13477621-A-G 11321945-A-G *
10795966-T-C *
28802599-G-C 26656452-G-C *
10787327-C-T *
10914856-G-C *
10906140-T-A *
13488693-C-A 11333017-C-A *
13461746-G-T 11306070-G-T *
13460384-G-T 11304708-G-T *
28802607-T-G 26656460-T-G *
10899207-C-T FT91982 *
21961720-GAA-G 19799834-GAA-G 12×A*
10899203-G-C *
10899196-C-T *
10899191-G-T *
10899189-C-T *
10899182-T-A *
10899176-C-T *
10982968-T-C *
10982951-T-C *
13460453-A-T 11304777-A-T *
28800450-G-A 26654303-G-A FT462156 *
10805485-G-A *
9127529-G-T 9289920-G-T Y*
13478405-C-G 11322729-C-G *
10918128-G-A *
13488627-TG-T 11332951-TG-T *
13488133-T-C 11332457-T-C *
9645653-CTTTTTT-C,CTTTTT 9808044-CTTTTTT-C,CTTTTT IR3_Prx 20×T*
10794022-C-T *
13488626-T-C 11332950-T-C *
10787967-T-C *
10982949-G-T *
13480909-CT-C 11325233-CT-C *
11035661-T-C *
11035653-C-T *
11035638-A-T *
11035635-T-A *
11035589-GACTCC-G *
11035588-C-A *
11035584-T-C *
10992732-C-A *
58912787-G-A 56678084-C-T *
16642743-T-C 14530863-T-C YY*
10773166-C-G *
7579118-T-C 7711077-T-C YY*
22295355-C-A 20133469-C-A DYZ19 *
13509666-G-A 11353990-G-A *
13477450-C-T 11321774-C-T *
13477424-C-A 11321748-C-A *
13477422-C-A 11321746-C-A *
13477416-C-A 11321740-C-A *
9013153-G-A 9175544-G-A Y*
7073067-C-CT 7205026-C-CT 10×T*
58978144-C-CAACTA 56831997-C-CAACTA *
7579109-T-C 7711068-T-C YY*
9962265-C-CAT 10124656-C-CAT *
13472906-A-C 11317230-A-C F18178 *
13472933-A-T 11317257-A-T *
13482899-G-T 11327223-G-T *
13467600-C-T 11311924-C-T *
13364428-T-C 11208752-T-C *
13468728-A-C 11313052-A-C *
9977463-C-G 10139854-C-G Y*
10035639-A-C 10198030-A-C *
13484666-G-A 11328990-G-A *
13463689-C-T 11308013-C-T FT443967 *
13428727-A-C 11273051-A-C *
9952050-T-G 10114441-T-G Y*
9934940-C-T 10097331-C-T Y*
10064277-G-C 10226668-G-C *
10064281-C-A 10226672-C-A *
13461693-A-G 11306017-A-G *
58838785-A-C 56752086-T-G *
13463682-C-T 11308006-C-T *
9931964-G-A 10094355-G-A Y*
13358638-T-C 11202962-T-C *
13472916-T-C 11317240-T-C *
58833894-A-T 56756977-T-A *
13489725-C-A 11334049-C-A *
13465494-T-G 11309818-T-G *
13463614-C-T 11307938-C-T *
2786264-G-A 2918223-G-A Y*
13463721-T-C 11308045-T-C *
13364441-G-A 11208765-G-A *
13341678-G-T 11186002-G-T *
13428747-G-A 11273071-G-A *
9989327-A-G 10151718-A-G Y*
28788005-G-A 26641858-G-A *
28788001-T-C 26641854-T-C *
58852349-G-A 56738522-C-T *
9966747-A-T 10129138-A-T Y*
9966742-A-G 10129133-A-G Y*
4843273-G-A 4975232-G-A *
13481063-C-G 11325387-C-G *
58879927-TC-T 56710942-CG-C *
13463952-C-CCCCG 11308276-C-CCCCG *
9958051-C-A 10120442-C-A Y*
13472268-A-C 11316592-A-C S14068 *
13482173-T-G 11326497-T-G *
22477936-AG-A 20316050-AG-A DYZ19 *
28800499-A-T 26654352-A-T *
13445808-A-T 11290132-A-T *
10038774-C-T 10201165-C-T *
58872543-T-A 56718328-A-T *
28788010-G-T 26641863-G-T *
13473507-G-T 11317831-G-T *
13341674-C-G 11185998-C-G *
58875139-A-C 56715732-T-G *
10082062-G-T 10244453-G-T *
10082019-C-T 10244410-C-T *
9966703-T-C 10129094-T-C Y*
13427873-T-G 11272197-T-G *
13481714-A-G 11326038-A-G *
10060558-T-A 10222949-T-A *
13478257-G-GCAC 11322581-G-GCAC *
13705828-G-A 11550152-G-A BY211183 *
13114848-G-A 10604334-G-A *
13473510-A-G 11317834-A-G *
13114847-T-C 10604333-T-C *
13468730-G-A 11313054-G-A BY85797 *
13468722-A-G 11313046-A-G *
13558604-A-G 11402928-A-G *
13526424-C-T 11370748-C-T *
13256041-G-A 11100365-G-A *
13258333-A-C 11102657-A-C *
13380191-A-G 11224515-A-G *
13428740-A-T 11273064-A-T *
58980527-T-TTCCATTCCATTCCAC 56834380-T-TTCCATTCCATTCCAC *
58855913-A-T 56734958-T-A *
10022560-T-C 10184951-T-C Y*
13260073-T-A 11104397-T-A *
13259914-G-C 11104238-G-C *
13259899-T-C 11104223-T-C *
13259771-T-A 11104095-T-A *
13259750-G-C 11104074-G-C *
10038366-T-A 10200757-T-A *
10033999-G-A 10196390-G-A Y*
10006033-T-G 10168424-T-G Y*
13261275-G-A 11105599-G-A *
10005992-G-A 10168383-G-A Y*
10004408-C-G 10166799-C-G Y*
10004407-T-G 10166798-T-G Y*
9997062-C-A 10159453-C-A F10492 Y*
9990509-C-A 10152900-C-A Y*
9944541-C-T 10106932-C-T FT227810 Y*
9944533-T-G 10106924-T-G Y*
9943530-T-C 10105921-T-C Y*
13260092-T-C 11104416-T-C *
13261289-T-A 11105613-T-A *
9942602-C-T 10104993-C-T Y*
13298630-T-A 11142954-T-A *
13372558-A-G 11216882-A-G *
13372520-A-G 11216844-A-G *
13315022-G-A 11159346-G-A *
13309130-T-C 11153454-T-C *
13307210-G-A 11151534-G-A *
13306702-C-T 11151026-C-T *
13298698-C-T 11143022-C-T *
13290645-G-T 11134969-G-T *
13263834-G-A 11108158-G-A *
13285211-A-G 11129535-A-G *
13278499-A-T 11122823-A-T *
13275407-A-G 11119731-A-G *
13275119-A-G 11119443-A-G *
13270797-A-G 11115121-A-G *
13265152-G-A 11109476-G-A *
13264955-G-A 11109279-G-A *
13263883-A-G 11108207-A-G *
9943512-G-A 10105903-G-A Y*
9939087-C-G 10101478-C-G Y*
13388629-T-C 11232953-T-C *
10006399-G-A 10168790-G-A Y*
13507927-G-A 11352251-G-A *
13507935-C-A 11352259-C-A *
13254609-T-TGTGTG 11098933-T-TGTGTG *
22233011-T-A 20071125-T-A FGC15297 DYZ19 *
13488966-G-T 11333290-G-T *
13372279-G-A 11216603-G-A *
13357224-C-T 11201548-C-T *
28804036-G-T 26657889-G-T *
2755045-G-C 2887004-G-C CTS139 YY*
23967215-G-GA 21821068-G-GA 9×A*
13866625-G-C 11745919-G-C *
58884112-C-A 56706759-G-T *
13470739-C-A 11315063-C-A *
6011314-T-C 6143273-T-C FGC41377 *
58876451-A-T 56714420-T-A *
13465386-G-C 11309710-G-C *
13434969-A-T 11279293-A-T *
58858927-C-T 56731944-G-A *
2931840-ATG-A 3063799-ATG-A *
9931927-A-G 10094318-A-G Y*
5502271-G-A 5634230-G-A *
9930146-C-A 10092537-C-A Y*
7451030-A-C 7582989-A-C IR1_L *
6006845-C-T 6138804-C-T *
6006838-G-T 6138797-G-T *
5937208-ATCTCTC-A 6069167-ATCTCTC-A 17×TC*
5831349-A-G 5963308-A-G *
5831298-G-A 5963257-G-A *
5666456-GTC-G 5798415-GTC-G 8×TC*
5381480-G-A 5513439-G-A *
3047071-G-A 3179030-G-A *
5193873-G-C 5325832-G-C *
4503350-T-C 4635309-T-C *
4456329-A-G 4588288-A-G *
3901835-G-T 4033794-G-T *
3901803-C-T 4033762-C-T *
3554062-A-G 3686021-A-G *
3554057-C-A 3686016-C-A 8×A*
3480816-A-ATG 3612775-A-ATG 13×TG*
58872540-C-T 56718331-G-A *
58855843-G-T 56735028-C-A *
13379763-G-C 11224087-G-C *
13478524-C-T 11322848-C-T *
13479287-C-A 11323611-C-A *
13489775-G-A 11334099-G-A *
13810322-C-T 11689616-C-T *
13478857-G-A 11323181-G-A FT444163 *
28794142-G-T 26647995-G-T *
22510581-G-A 20348695-G-A DYZ19 *
22479385-G-T 20317499-G-T DYZ19 *
13464336-C-T 11308660-C-T *
10022511-G-C 10184902-G-C Y*
58978312-T-C 56832165-T-C *
13479550-C-T 11323874-C-T *
9958280-T-A 10120671-T-A Y*
9958256-G-A 10120647-G-A Y*
24377783-AAG-A 22231636-AAG-A 8×AG*
13461798-C-A 11306122-C-A *
13469880-G-A 11314204-G-A BY85823 *
13474600-G-C 11318924-G-C *
22508626-G-A 20346740-G-A DYZ19 *
22229188-A-C 20067302-A-C BY23224 DYZ19 *
13477384-C-T 11321708-C-T Z18107BY43116 *
13691905-C-G 11536229-C-G *
13475237-A-G 11319561-A-G *
16051847-TA-T 13939967-TA-T 10×A*
13477143-T-C 11321467-T-C *
13477127-C-T 11321451-C-T *
13477124-T-G 11321448-T-G *
13488506-C-A 11332830-C-A F10862 *
9992627-T-C 10155018-T-C Y*
13464633-G-A 11308957-G-A *
22229193-T-A 20067307-T-A BY23226 DYZ19 *
22463897-G-A 20302011-G-A DYZ19 *
58858901-C-G 56731970-G-C *
13476794-C-A 11321118-C-A *
28586633-T-G 26440486-T-G CTS12426 *
13545398-AGAAG-A 11389722-AGAAG-A *
22510524-T-G 20348638-T-G DYZ19 *
9943632-A-T 10106023-A-T Y*
22229194-A-G 20067308-A-G BY23227 DYZ19 *
28784679-G-A 26638532-G-A *
13455090-C-T 11299414-C-T FTA2495 *
13600272-T-C 11444596-T-C *
9992606-C-A 10154997-C-A Y*
13488054-G-C 11332378-G-C *
13692894-G-T 11537218-G-T *
58978019-CCATTG-C 56831872-CCATTG-C *
13464334-T-C 11308658-T-C *
13464328-G-C 11308652-G-C *
13464320-A-C 11308644-A-C *
13466927-GAA-G 11311251-GAA-G *
9992607-A-G 10154998-A-G Y*
9992628-G-A 10155019-G-A BY82602 Y*
13464398-C-T 11308722-C-T *
13839671-G-A 11718965-G-A Y65617 *
13455104-CCACCCTGTTT-C 11299428-CCACCCTGTTT-C *
13454583-G-A 11298907-G-A BY50604 *
9605139-CTG-C 9767530-CTG-C IR3_Prx *
13477380-T-A 11321704-T-A *
13477371-G-C 11321695-G-C *
13473891-T-A 11318215-T-A *
13488063-A-T 11332387-A-T *
13866442-T-TCAGAATCAAA 11745736-T-TCAGAATCAAA *
13477148-C-T 11321472-C-T *
13474502-A-T 11318826-A-T *
13471018-A-G 11315342-A-G *
58912436-T-C 56678435-A-G *
18582423-GA-G 16470543-GA-G A7537 *
13470234-C-T 11314558-C-T *
58858870-T-C 56732001-A-G *
9995002-A-T 10157393-A-T Y*
22477926-T-G 20316040-T-G BY25212 DYZ19 *
22477922-C-A 20316036-C-A BY25210 DYZ19 *
9986844-A-G 10149235-A-G Y*
13194073-T-C 11038397-T-C *
13857715-C-T 11737009-C-T *
13476460-T-C 11320784-T-C *
13476453-G-C 11320777-G-C *
13480930-G-A 11325254-G-A *
59021849-G-A 56875702-G-A *
9974216-T-G 10136607-T-G Y*
13478702-T-C 11323026-T-C *
13463772-G-A 11308096-G-A FTB21036 *
13748373-G-A 11592697-G-A *
58976934-T-TTCCAC 56830787-T-TTCCAC *
13382931-A-G 11227255-A-G *
13481079-A-T 11325403-A-T *
13488273-C-T 11332597-C-T *
13488271-C-T 11332595-C-T *
13488247-G-T 11332571-G-T *
13479047-G-C 11323371-G-C *
13481812-A-G 11326136-A-G *
13481755-C-G 11326079-C-G F18185 *
13481756-C-T 11326080-C-T *
10022507-A-C 10184898-A-C Y*
9968027-T-C 10130418-T-C Y*
58912767-G-A 56678104-C-T *
13479531-T-G 11323855-T-G *
13476846-C-T 11321170-C-T *
9944502-A-G 10106893-A-G Y*
9432609-T-C 9595000-T-C Y*
13475686-G-T 11320010-G-T *
13475674-C-T 11319998-C-T *
13463886-C-T 11308210-C-T *
13488284-A-G 11332608-A-G *
9968044-G-A 10130435-G-A Y*
58882513-C-A 56708358-G-T *
13462576-C-T 11306900-C-T *
22424911-A-G 20263025-A-G DYZ19 *
13415942-A-T 11260266-A-T *
13380056-G-A 11224380-G-A *
13416557-G-A 11260881-G-A *
13398413-T-A 11242737-T-A *
28788011-T-A 26641864-T-A *
13291099-C-A 11135423-C-A *
58898280-A-T 56692591-T-A *
9968051-C-T 10130442-C-T BY29739 Y*
13114800-C-T 10604286-C-T *
13488511-G-A 11332835-G-A *
9952474-C-T 10114865-C-T FT373435 Y*
58846333-C-T 56744538-G-A *
18141280-A-T 16029400-A-T Y*
13480736-C-T 11325060-C-T *
13471438-T-G 11315762-T-G *
13471428-A-C 11315752-A-C *
13475663-G-A 11319987-G-A *
58874684-A-C 56716187-T-G *
13476405-G-A 11320729-G-A *
13488036-C-A 11332360-C-A *
13479587-G-A 11323911-G-A *
13471661-G-A 11315985-G-A *
13471619-C-T 11315943-C-T *
28803347-A-T 26657200-A-T *
13472950-C-T 11317274-C-T *
58843030-GATTCCATTCCATTCT-G 56747815-AGGAATGGAATAGAAT-A *
13488037-C-A 11332361-C-A *
13461998-C-T 11306322-C-T *
9992791-T-C 10155182-T-C Y*
28805538-C-G 26659391-C-G *
15828703-CAA-C 13716823-CAA-C 12×A*
13262214-T-A 11106538-T-A ZS149 *
13489779-G-A 11334103-G-A *
13479057-G-A 11323381-G-A *
22472968-G-A 20311082-G-A DYZ19 *
22472954-T-A 20311068-T-A DYZ19 *
13471733-G-A 11316057-G-A *
58912398-C-T 56678473-G-A *
22448697-TC-T 20286811-TC-T DYZ19 *
58874683-A-C 56716188-T-G *
8207556-CT-C 8339515-CT-C 10×T*
13470935-T-G 11315259-T-G *
13372190-C-T 11216514-C-T *
13470927-T-C 11315251-T-C *
13472380-G-A 11316704-G-A *
13466720-A-T 11311044-A-T *
13472336-G-C 11316660-G-C *
28785084-G-A 26638937-G-A *
28819016-G-A 26672869-G-A *
58892315-T-A 56698556-A-T *
13460141-T-C 11304465-T-C *
22475516-C-G 20313630-C-G FGC9722 DYZ19 *
13488157-C-T 11332481-C-T *
58876856-A-G 56714015-T-C *
13475717-C-T 11320041-C-T *
13378120-C-T 11222444-C-T *
13378119-G-C 11222443-G-C *
13475702-C-T 11320026-C-T *
13463567-A-C 11307891-A-C *
13374677-C-A 11219001-C-A *
13379781-G-A 11224105-G-A *
16642741-T-A 14530861-T-A YY*
58916367-C-T 56674504-G-A *
59007023-G-T 56860876-G-T *
59007016-A-C 56860869-A-C *
59006193-G-A 56860046-G-A *
59002161-G-A 56856014-G-A *
59000025-G-A 56853878-G-A *
58998501-A-G 56852354-A-G *
58975363-G-C 56829216-G-C *
58881607-C-G 56709264-G-C *
59008339-G-A 56862192-G-A *
58881606-C-A 56709265-G-T *
28817910-C-A 26671763-C-A *
28814785-A-T 26668638-A-T *
28807357-C-T 26661210-C-T *
28805535-C-G 26659388-C-G BY40026 *
28787333-G-A 26641186-G-A Z21894 *
28734667-GTGAA-G 26588520-GTGAA-G *
28696558-C-T 26550411-C-T M11743 *
59008226-T-G 56862079-T-G *
59009057-C-T 56862910-C-T *
28585957-C-A 26439810-C-A *
59018121-T-C 56871974-T-C *
59022082-G-T 56875935-G-T *
59021744-A-C 56875597-A-C *
59021219-T-G 56875072-T-G *
59020641-G-C 56874494-G-C *
59020633-A-G 56874486-A-G *
59020187-T-C 56874040-T-C *
59018535-CA-C 56872388-CA-C *
59017911-A-C 56871764-A-C *
59011488-C-A 56865341-C-A *
59014005-T-TCC 56867858-T-TCC *
59013671-AC-A 56867524-AC-A *
59013026-A-T 56866879-A-T *
59012660-C-A 56866513-C-A *
59012659-G-A 56866512-G-A *
59012367-T-G 56866220-T-G *
59012364-A-T 56866217-A-T *
59012104-G-C 56865957-G-C F14136 *
28586890-A-T 26440743-A-T *
23193141-G-A 21031255-G-A Y38178 Y*
59023473-T-G 56877326-T-G *
13468467-G-A 11312791-G-A *
13503094-A-T 11347418-A-T *
13503088-C-T 11347412-C-T *
13488362-C-A 11332686-C-A BY46510 *
13487474-C-T 11331798-C-T *
13486592-A-T 11330916-A-T *
13483767-C-A 11328091-C-A *
13473477-A-G 11317801-A-G *
13468450-A-T 11312774-A-T *
13517931-T-C 11362255-T-C *
13466456-T-C 11310780-T-C *
13466079-A-C 11310403-A-C *
13465734-T-C 11310058-T-C *
13462852-A-G 11307176-A-G *
13462712-G-A 11307036-G-A Z22920 *
13446419-C-A 11290743-C-A *
13446415-C-A 11290739-C-A *
13445504-T-C 11289828-T-C *
13513412-C-T 11357736-C-T *
13517933-A-G 11362257-A-G *
22811719-T-C 20649833-T-C FT51485 FGC59208 Y*
18927496-C-T 16815616-C-T Y29337 YY*
22509635-G-A 20347749-G-A BY48023 DYZ19 *
22508458-C-G 20346572-C-G DYZ19 *
22447524-G-T 20285638-G-T DYZ19 *
22255893-T-C 20094007-T-C DYZ19 *
22255871-G-A 20093985-G-A DYZ19 *
22255870-T-G 20093984-T-G BY188772 DYZ19 *
22255839-G-C 20093953-G-C DYZ19 *
19504905-GTC-G 17393025-GTC-G *
18768123-C-T 16656243-C-T Z41872 Y*
13525669-C-T 11369993-C-T *
13722865-A-C 11567189-A-C *
13722859-A-T 11567183-A-T *
13718736-T-C 11563060-T-C *
13711897-T-C 11556221-T-C *
13711891-A-G 11556215-A-G *
13711855-G-A 11556179-G-A *
13711339-C-A 11555663-C-A *
13688065-C-A 11532389-C-A FT448446 *
59022782-A-G 56876635-A-G *
59024223-C-T 56878076-C-T *
13435833-A-G 11280157-A-G *
13561896-C-T 11406220-C-T *
9909109-C-A 10071500-C-A Y*
13460561-A-G 11304885-A-G *
58974441-G-T 56828294-G-T *
13473674-C-A 11317998-C-A *
58869801-C-G 56721070-G-C *
58916340-T-C 56674531-A-G *
58898226-C-T 56692645-G-A *
13561880-T-A 11406204-T-A *
9921915-A-G 10084306-A-G Y*
13561833-C-G 11406157-C-G *
13471727-G-A 11316051-G-A *
13463933-A-G 11308257-A-G *
28803326-A-G 26657179-A-G *
13488292-C-T 11332616-C-T *
13472306-T-G 11316630-T-G S14075 *
13472267-A-C 11316591-A-C S14067 *
13488547-G-A 11332871-G-A *
9921886-T-C 10084277-T-C Y*
9921949-C-A 10084340-C-A Y*
16642893-G-A 14531013-G-A YY*
13711744-GAATGGAACGGAATGGAATTAAATGGAACGGAATGGAATGGCATGGAATGGAATGGCATGGCATGGAATGGAATGGAATGGAATGGAATGA-G 11556068-GAATGGAACGGAATGGAATTAAATGGAACGGAATGGAATGGCATGGAATGGAATGGCATGGCATGGAATGGAATGGAATGGAATGGAATGA-G *
16642696-C-T 14530816-C-T YY*
9936525-A-G 10098916-A-G A18885 Y*
13537696-G-A 11382020-G-A *
13467987-T-A 11312311-T-A *
13379541-C-T 11223865-C-T *
9962289-G-A 10124680-G-A Y*
13471075-C-T 11315399-C-T *
13486006-AGT-A 11330330-AGT-A *
13460567-T-A 11304891-T-A *
13114783-A-G 10604269-A-G *
58988285-G-A 56842138-G-A *
13446389-C-T 11290713-C-T *
9930171-G-T 10092562-G-T FT361790 Y*
9962277-C-T 10124668-C-T Y*
10068267-T-C 10230658-T-C *
58912771-T-C 56678100-A-G *
58912757-C-T 56678114-G-A *
9997296-T-G 10159687-T-G Y*
16642890-T-G 14531010-T-G YY*
59025184-C-G 56879037-C-G *
9980236-C-T 10142627-C-T Y*
58990029-T-C 56843882-T-C *
13717835-G-A 11562159-G-A BY54454 *
16642830-T-C 14530950-T-C YY*
16642724-G-A 14530844-G-A YY*
16642721-A-G 14530841-A-G YY*
16642710-C-T 14530830-C-T YY*
16642704-G-C 14530824-G-C YY*
13719768-C-T 11564092-C-T *
13470580-G-A 11314904-G-A *
13719741-A-ATGGAATGGAT 11564065-A-ATGGAATGGAT *
9984231-T-C 10146622-T-C Y*
10075704-T-C 10238095-T-C *
22317634-C-G 20155748-C-G A17963 DYZ19 *
59032512-TTCC-T 56886365-TTCC-T *
59031342-CA-C 56885195-CA-C *
59027229-G-A 56881082-G-A *
59026553-G-T 56880406-G-T *
13857731-G-A 11737025-G-A *
13463695-C-T 11308019-C-T *
16642886-G-A 14531006-G-A YY*
13465401-T-G 11309725-T-G *
16642884-A-C 14531004-A-C YY*
16642880-A-G 14531000-A-G YY*
16642879-T-A 14530999-T-A YY*
13478759-G-C 11323083-G-C *
13488353-A-T 11332677-A-T *
9188489-GTCT-G 9350880-GTCT-G *
58884084-A-G 56706787-T-C *
13489221-G-C 11333545-G-C *
13465366-T-C 11309690-T-C *
58820187-A-C 56770684-T-G *
13465352-A-T 11309676-A-T *
9994930-G-A 10157321-G-A Y*
13489023-G-T 11333347-G-T *
13267772-T-TCC 11112096-T-TCC *
58874760-A-T 56716111-T-A *
58903863-A-T 56687008-T-A *
58854644-A-C 56736227-T-G *
58854600-T-C 56736271-A-G *
13437443-G-T 11281767-G-T *
13427940-A-C 11272264-A-C *
13380078-T-C 11224402-T-C *
9994866-A-ATTATTAAT 10157257-A-ATTATTAAT *
13462756-G-T 11307080-G-T *
10064274-G-T 10226665-G-T *
10064309-C-T 10226700-C-T *
19210017-C-G 17098137-C-G Y*
58914329-A-T 56676542-T-A *
13488308-T-G 11332632-T-G *
13488296-A-T 11332620-A-T *
13463615-A-G 11307939-A-G BY85661 *
17245529-GA-G 15133649-GA-G 22×A*
13358595-C-T 11202919-C-T *
58912494-ATTCCT-A 56678369-CAAAGG-C *
58912503-C-T 56678368-G-A *
13488766-C-T 11333090-C-T *
59027305-A-AG 56881158-A-AG *
59026840-T-G 56880693-T-G *
59026811-GT-G 56880664-GT-G *
58998510-G-A 56852363-G-A *
13827899-T-C 11707193-T-C *
9992820-T-C 10155211-T-C Y*
28803488-G-T 26657341-G-T *
13708719-T-G 11553043-T-G *
13461878-G-A 11306202-G-A *
9954766-G-C 10117157-G-C Y*
9954759-C-T 10117150-C-T Y*
9954751-G-A 10117142-G-A BY82145 Y*
9954750-T-G 10117141-T-G FGC25949 FT125378 Y*
22288235-G-A 20126349-G-A DYZ19 *
9958028-AT-A 10120419-AT-A *
13556170-C-T 11400494-C-T *
9921892-T-G 10084283-T-G Y*
13380303-T-C 11224627-T-C *
22475695-A-G 20313809-A-G BY46154 DYZ19 *
9804915-G-A 9967306-G-A Y*
58841013-T-C 56749858-A-G *
59001054-C-A 56854907-C-A *
13462546-C-CCT 11306870-C-CCT *
13338400-G-A 11182724-G-A PF509 *
13523628-AT-A 11367952-AT-A *
28805599-A-G 26659452-A-G *
28800468-A-G 26654321-A-G CTS36FT200091 *
9962052-A-G 10124443-A-G Y*
13434676-C-A 11279000-C-A *
13502954-G-T 11347278-G-T *
13502851-C-T 11347175-C-T *
13500639-C-T 11344963-C-T *
13499785-A-C 11344109-A-C *
13477874-A-C 11322198-A-C A10795 *
13471087-A-G 11315411-A-G *
13465562-A-T 11309886-A-T *
13434609-C-A 11278933-C-A *
13503096-T-G 11347420-T-G *
13399167-A-G 11243491-A-G *
13388557-A-G 11232881-A-G *
13386429-T-C 11230753-T-C *
13386219-C-T 11230543-C-T *
13384292-A-G 11228616-A-G FGC43581 *
13383653-A-T 11227977-A-T *
13383638-C-G 11227962-C-G *
13383062-A-G 11227386-A-G *
13503073-G-A 11347397-G-A *
13509654-G-T 11353978-G-T *
28800409-T-A 26654262-T-A *
13578018-G-T 11422342-G-T *
28780709-A-C 26634562-A-C *
28643754-A-G 26497607-A-G CTS12622 *
22436874-C-A 20274988-C-A DYZ19 *
13854741-TG-T 11734035-TG-T *
13693539-G-C 11537863-G-C *
13634919-A-T 11479243-A-T *
13622377-A-T 11466701-A-T *
13591179-A-T 11435503-A-T *
13576799-A-G 11421123-A-G *
13516804-A-G 11361128-A-G *
13573795-T-A 11418119-T-A *
13567313-A-T 11411637-A-T *
13534584-A-T 11378908-A-T *
13518141-C-A 11362465-C-A *
13517505-T-C 11361829-T-C *
13517501-G-A 11361825-G-A *
13516825-C-T 11361149-C-T *
13516814-A-G 11361138-A-G *
9962044-C-A 10124435-C-A Y*
4439006-C-T 4570965-C-T FT320656 *
13421386-G-A 11265710-G-A *
13285358-C-T 11129682-C-T *
13336023-C-T 11180347-C-T *
13307286-C-T 11151610-C-T *
13304100-T-C 11148424-T-C *
13298711-C-T 11143035-C-T *
13290008-T-G 11134332-T-G *
13288251-G-A 11132575-G-A *
13288188-G-A 11132512-G-A *
13282394-G-C 11126718-G-C *
13352297-G-A 11196621-G-A *
13275426-T-G 11119750-T-G *
13271621-C-G 11115945-C-G *
13271291-C-T 11115615-C-T *
13270702-G-A 11115026-G-A *
13270442-G-C 11114766-G-C *
13270307-G-A 11114631-G-A BY3638 A12511 *
13269636-C-T 11113960-C-T *
13268376-C-T 11112700-C-T *
13338148-G-A 11182472-G-A *
13358504-G-C 11202828-G-C *
13266418-C-T 11110742-C-T *
13383525-C-G 11227849-C-G FGC39086 *
13411564-C-T 11255888-C-T 8×A*
13405080-A-G 11249404-A-G *
13405074-G-T 11249398-G-T *
13405050-G-A 11249374-G-A FT262864 *
13398793-T-A 11243117-T-A *
13392747-A-G 11237071-A-G *
13390022-G-A 11234346-G-A *
13382511-A-G 11226835-A-G *
13358527-C-T 11202851-C-T *
13374681-A-T 11219005-A-T *
13374134-C-T 11218458-C-T *
13372286-T-A 11216610-T-A *
13372265-C-A 11216589-C-A *
13365709-G-C 11210033-G-C Z10449 *
13365702-T-C 11210026-T-C Z10447 *
13364701-A-C 11209025-A-C *
13364588-T-C 11208912-T-C *
13266656-T-C 11110980-T-C FT442068 *
13266368-T-G 11110692-T-G *
4442602-AAC-A 4574561-AAC-A *
9942379-C-G 10104770-C-G Y*
9966699-A-T 10129090-A-T Y*
9964353-A-C 10126744-A-C Y*
9945357-T-C 10107748-T-C Y*
9944624-G-A 10107015-G-A Y*
9944010-G-A 10106401-G-A Y*
9943574-A-C 10105965-A-C Y*
9943551-G-A 10105942-G-A Y*
9942358-G-A 10104749-G-A Z13702 Y*
9980246-G-GTA 10142637-G-GTA *
9939128-G-A 10101519-G-A Y*
9939118-G-A 10101509-G-A Y*
9939086-T-G 10101477-T-G Y*
9939063-G-A 10101454-G-A Y*
9013185-G-A 9175576-G-A Y*
7579137-A-G 7711096-A-G FT333927 YY*
6403096-T-C 6535055-T-C *
4456328-C-T 4588287-C-T *
9977485-T-C 10139876-T-C Y*
9981475-C-G 10143866-C-G Y*
13264176-T-C 11108500-T-C *
13195048-A-T 11039372-A-T *
13263872-G-A 11108196-G-A *
13263555-G-T 11107879-G-T *
13262477-C-T 11106801-C-T *
13259941-T-G 11104265-T-G *
13259728-G-A 11104052-G-A *
13259718-G-T 11104042-G-T *
13258510-C-T 11102834-C-T *
13251168-C-T 11095492-C-T FGC16843 F6610 *
13135620-G-A 10625106-G-A *
9981505-G-A 10143896-G-A Y*
10068232-T-G 10230623-T-G *
10038389-G-C 10200780-G-C *
10026730-G-A 10189121-G-A FT376502 Y*
10026685-G-A 10189076-G-A Y*
10006442-C-T 10168833-C-T Z5004 Y*
10006006-G-T 10168397-G-T A10370 Y*
10005997-A-T 10168388-A-T A10369 Y*
9988100-G-A 10150491-G-A Y*
8183587-GT-G 8315546-GT-G 10×T*
27390-G-T *
13484203-A-T 11328527-A-T *
9933046-A-G 10095437-A-G Y*
13475283-A-T 11319607-A-T *
13473522-T-A 11317846-T-A *
13465399-A-T 11309723-A-T *
10025652-G-T 10188043-G-T Y*
9942712-C-G 10105103-C-G Y*
9942711-T-C 10105102-T-C Y*
9933053-T-C 10095444-T-C Y*
9933043-T-C 10095434-T-C Y*
23001371-A-AT 20839485-A-AT 8×T*
13697372-T-A 11541696-T-A *
13697365-A-G 11541689-A-G *
13477263-C-A 11321587-C-A *
22252005-G-A 20090119-G-A DYZ19 *
13469349-T-G 11313673-T-G *
13365624-G-T 11209948-G-T *
15590931-AT-A 13479051-AT-A 10×T*
13487962-C-T 11332286-C-T *
22359671-A-G 20197785-A-G DYZ19 *
13488470-G-A 11332794-G-A *
13470859-G-T 11315183-G-T *
13461282-A-G 11305606-A-G *
13348767-T-C 11193091-T-C *
9965685-A-T 10128076-A-T Y*
9944527-G-T 10106918-G-T Y*
9944492-C-G 10106883-C-G Y*
9939057-T-C 10101448-T-C Y*
9939050-C-T 10101441-C-T Y*
13462518-A-C 11306842-A-C *
13345179-T-C 11189503-T-C *
13470079-C-A 11314403-C-A *
13247759-T-C 11092083-T-C *
13466516-G-T 11310840-G-T *
13462645-C-G 11306969-C-G *
13979069-T-A 11858363-T-A Y*
13339809-A-T 11184133-A-T *
13477600-G-A 11321924-G-A *
22288244-C-A 20126358-C-A DYZ19 *
13469207-A-G 11313531-A-G *
13489910-C-A 11334234-C-A *
13482538-C-G 11326862-C-G *
9939227-G-C 10101618-G-C Y*
9965212-T-C 10127603-T-C Y*
28795264-C-G 26649117-C-G *
13688006-C-T 11532330-C-T *
13411490-C-T 11255814-C-T *
13395319-G-A 11239643-G-A *
13395280-C-T 11239604-C-T *
13395279-G-T 11239603-G-T *
10907667-G-T *
13470666-C-T 11314990-C-T *
27453-G-A *
18411634-A-AAC 16299754-A-AAC P6_Gap 11×AC*
13488414-C-A 11332738-C-A *
13488088-C-T 11332412-C-T *
28811013-C-T 26664866-C-T *
28794143-G-T 26647996-G-T *
28780935-C-T 26634788-C-T *
22447488-G-T 20285602-G-T DYZ19 *
22447444-G-C 20285558-G-C DYZ19 *
27409-T-C *
27467-G-T *
13487252-G-A 11331576-G-A *
13480386-G-A 11324710-G-A *
13478119-C-G 11322443-C-G *
14738413-CTTT-C 12626481-CTTT-C 17×T*
13488383-A-T 11332707-A-T *
22475752-G-A 20313866-G-A DYZ19 *
13478479-C-T 11322803-C-T *
9914609-A-G 10077000-A-G Y*
13466591-C-T 11310915-C-T *
13479009-GC-G 11323333-GC-G *
28794151-T-A 26648004-T-A *
27470-T-A *
28792816-G-T 26646669-G-T *
11656181-A-G *
11656177-A-T *
13691368-G-A 11535692-G-A *
13433505-G-C 11277829-G-C *
56830619-A-G *
27477-A-C *
27472-A-T *
13558190-G-T 11402514-G-T *
9943700-T-A 10106091-T-A FT263042 Y*
13719652-T-G 11563976-T-G *
13454921-T-G 11299245-T-G *
13193973-T-C 11038297-T-C *
10951066-C-G *
9929428-CTGA-C 10091819-CTGA-C *
19270507-C-T 17158627-C-T YY*
19270493-A-C 17158613-A-C YY*
19209872-A-T 17097992-A-T YY*
6984562-A-ATT 7116521-A-ATT *
10766371-CCACTCCATCCAATCT-C *
13292996-C-G 11137320-C-G *
9924462-C-T 10086853-C-T Y*
9934932-TC-T 10097323-TC-T *
9934928-T-A 10097319-T-A Y*
9934911-CTATCT-C 10097302-CTATCT-C *
9934906-G-T 10097297-G-T Y*
9924510-A-T 10086901-A-T Y*
9924476-C-T 10086867-C-T Y*
9924471-A-T 10086862-A-T Y*
23123333-T-C 20961447-T-C YY*
13390134-C-T 11234458-C-T *
9924393-T-G 10086784-T-G Y*
9909792-A-G 10072183-A-G Y*
10625162-C-T *
13477243-C-T 11321567-C-T *
13466467-C-T 11310791-C-T *
14886399-CAA-C,CAAA 12774465-CAA-C,CAAA 21×A*
13481920-G-A 11326244-G-A *
3076105-T-C 3208064-T-C *
14826464-C-T 12714531-C-T FT335788 YY*
13465110-G-T 11309434-G-T *
10027262-C-T 10189653-C-T FT112443 Y*
13469356-G-T 11313680-G-T *
22852199-CT-C,CTT 20690313-CT-C,CTT 16×T*
18798584-CA-C 16686704-CA-C *
13490049-C-A 11334373-C-A *
18250311-A-AT 16138431-A-AT 10×T*
13462563-G-T 11306887-G-T *
13467562-G-A 11311886-G-A *
13487260-G-A 11331584-G-A *
9924435-T-A 10086826-T-A Y*
4976049-G-T 5108008-G-T *
10022522-G-C 10184913-G-C Y*
13482242-T-C 11326566-T-C *
21979715-A-G 19817829-A-G FT363710 YY*
13332198-G-T 11176522-G-T *
28799198-G-T 26653051-G-T *
9965634-C-G 10128025-C-G Y*
19209886-T-A 17098006-T-A YY*
19209881-T-C 17098001-T-C YY*
9944114-C-T 10106505-C-T Y*
13475722-C-A 11320046-C-A *
21979731-C-T 19817845-C-T FT403973 YY*
13421467-G-T 11265791-G-T *
13421447-A-C 11265771-A-C *
13416593-C-G 11260917-C-G *
13416513-G-C 11260837-G-C *
13404294-G-A 11248618-G-A *
13400517-T-C 11244841-T-C *
11035538-C-T *
10022550-G-A 10184941-G-A Y*
21979721-G-C 19817835-G-C YY*
21979737-G-T 19817851-G-T YY*
13576750-G-A 11421074-G-A *
9804877-G-C 9967268-G-C Y*
13479435-G-A 11323759-G-A *
13479322-C-G 11323646-C-G *
13428151-G-T 11272475-G-T *
13428129-T-G 11272453-T-G *
11025616-A-G *
10022121-GC-G 10184512-GC-G *
9804999-A-T 9967390-A-T YY*
9804888-A-C 9967279-A-C Y*
9013215-G-T 9175606-G-T Y*
13470687-A-T 11315011-A-T *
13535325-T-G 11379649-T-G *
13479304-T-A 11323628-T-A *
10778869-G-A FT263031 *
10050916-G-A 10213307-G-A *
9948457-G-A 10110848-G-A Y*
9948449-G-A 10110840-G-A Y*
9805004-T-A 9967395-T-A YY*
13356807-C-A 11201131-C-A *
13977176-T-C 11856470-T-C Y*
13509024-C-A 11353348-C-A *
13463616-C-T 11307940-C-T FT230069 *
9929372-T-C 10091763-T-C Y*
13382996-C-T 11227320-C-T *
10981249-G-A *
10039718-G-T 10202109-G-T *
9932098-C-G 10094489-C-G Y*
9929379-G-C 10091770-G-C Y*
9929374-T-C 10091765-T-C Y*
9929373-G-A 10091764-G-A Y*
9916085-A-C 10078476-A-C Y*
13392729-C-T 11237053-C-T *
9909179-T-G 10071570-T-G Y*
9909161-G-C 10071552-G-C Y*
9909160-T-C 10071551-T-C Y*
9909140-T-A 10071531-T-A Y*
9909108-A-C 10071499-A-C Y*
9909093-T-C 10071484-T-C Y*
56884836-C-T *
56838924-G-A *
13383088-T-C 11227412-T-C *
13392749-T-C 11237073-T-C *
56682002-G-C *
13473166-A-T 11317490-A-T *
13486023-C-G 11330347-C-G *
13484979-T-G 11329303-T-G *
13482312-G-A 11326636-G-A *
13482205-C-A 11326529-C-A *
13481743-A-G 11326067-A-G *
13477378-A-C 11321702-A-C *
13477337-G-A 11321661-G-A *
13473059-A-C 11317383-A-C *
13392776-A-G 11237100-A-G *
13465551-G-T 11309875-G-T *
13464784-G-A 11309108-G-A BY210288 *
13395229-G-C 11239553-G-C *
13395196-A-T 11239520-A-T *
13395173-G-C 11239497-G-C *
13395168-T-A 11239492-T-A *
13395147-G-A 11239471-G-A *
13392779-A-G 11237103-A-G *
56747938-A-G *
28816543-T-G 26670396-T-G *
13486533-T-A 11330857-T-A *
13482199-A-C 11326523-A-C *
13556901-A-T 11401225-A-T *
13551380-C-T 11395704-C-T *
13546558-C-A 11390882-C-A *
13518315-G-A 11362639-G-A *
13518160-A-G 11362484-A-G *
13500434-C-T 11344758-C-T *
13482530-A-G 11326854-A-G *
13472021-A-G 11316345-A-G *
13573866-C-G 11418190-C-G *
13468416-T-C 11312740-T-C *
13461807-T-C 11306131-T-C *
13445827-T-A 11290151-T-A *
13439340-C-T 11283664-C-T *
13437468-A-T 11281792-A-T *
13437465-C-A 11281789-C-A *
13405218-G-A 11249542-G-A *
13405203-A-G 11249527-A-G *
13562032-G-A 11406356-G-A *
13573885-G-C 11418209-G-C *
28814852-T-G 26668705-T-G *
13815516-T-G 11694810-T-G *
28811148-G-T 26665001-G-T BY152051 *
28806818-A-T 26660671-A-T *
28789498-G-A 26643351-G-A *
28788970-T-A 26642823-T-A *
28585761-G-A 26439614-G-A *
28583970-A-G 26437823-A-G *
22509559-T-A 20347673-T-A DYZ19 *
13815522-G-A 11694816-G-A *
13709583-T-A 11553907-T-A *
13573897-A-G 11418221-A-G *
13708647-A-T 11552971-A-T *
13707343-G-T 11551667-G-T *
13700381-G-C 11544705-G-C *
13688617-T-C 11532941-T-C *
13688087-G-A 11532411-G-A *
13688083-A-G 11532407-A-G *
13688072-G-T 11532396-G-T FT448447 *
13688059-A-C 11532383-A-C *
13486029-C-A 11330353-C-A *
13488806-G-C 11333130-G-C *
13465122-C-G 11309446-C-G *
16216708-T-C 14104828-T-C YY*
13395042-C-T 11239366-C-T *
10027271-C-T 10189662-C-T Y*
10027261-C-T 10189652-C-T Y*
9964242-A-G 10126633-A-G Y*
9964234-T-C 10126625-T-C Y*
9924496-T-C 10086887-T-C Y*
9909220-A-T 10071611-A-T Y*
13470535-G-T 11314859-G-T *
13425807-G-A 11270131-G-A *
13488413-C-A 11332737-C-A *
13488158-G-A 11332482-G-A *
13469422-C-A 11313746-C-A *
13476584-C-A 11320908-C-A *
13476567-C-T 11320891-C-T *
13476536-GC-G 11320860-GC-G *
13476514-G-A 11320838-G-A *
56867291-T-C *
13425743-C-A 11270067-C-A *
13427941-G-T 11272265-G-T *
22507890-C-G 20346004-C-G DYZ19 *
4439007-G-A 4570966-G-A *
13418457-C-A 11262781-C-A *
13416556-C-T 11260880-C-T *
9965352-C-T 10127743-C-T Y*
9965351-G-A 10127742-G-A Y*
9941595-C-T 10103986-C-T Y*
13470714-C-T 11315038-C-T *
13470643-G-T 11314967-G-T *
13492886-T-C 11337210-T-C *
13444843-C-T 11289167-C-T *
13484183-A-C 11328507-A-C *
13345169-T-A 11189493-T-A *
13463307-T-C 11307631-T-C *
16679099-AT-A,ATT 14567219-AT-A,ATT 25×T*
13523622-C-CA 11367946-C-CA *
13609136-C-T 11453460-C-T *
13580574-A-C 11424898-A-C *
13552601-C-A 11396925-C-A *
28792815-T-G 26646668-T-G *
13851111-G-A 11730405-G-A *
13493109-A-G 11337433-A-G *
28800498-G-T 26654351-G-T *
56875564-A-G *
56875554-T-A *
56863090-A-C *
56744547-G-C *
28807416-G-C 26661269-G-C BY151890 *
28805817-C-G 26659670-C-G *
28800501-G-T 26654354-G-T *
28795420-A-C 26649273-A-C *
19770-C-T *
28583128-T-C 26436981-T-C *
28582945-G-T 26436798-G-T *
11656190-A-G *
13707348-G-A 11551672-G-A *
13706546-T-A 11550870-T-A BY89244 *
13540195-T-C 11384519-T-C FGC78531 *
13527168-A-C 11371492-A-C *
13527167-C-A 11371491-C-A *
56884831-G-A *
13476639-C-A 11320963-C-A *
13558817-A-T 11403141-A-T *
13481907-T-C 11326231-T-C *
13543634-A-G 11387958-A-G *
13523400-C-T 11367724-C-T *
13500089-G-A 11344413-G-A *
13465511-C-G 11309835-C-G *
10932782-T-C *
10777182-C-T *
13540588-C-T 11384912-C-T *
13519152-T-C 11363476-T-C *
56862117-T-A *
10784045-ACTCCG-A *
13482547-C-CA 11326871-C-CA *
13466551-C-G 11310875-C-G *
28816647-CG-C 26670500-CG-C *
13557751-G-A 11402075-G-A *
13543165-G-A 11387489-G-A *
13495556-T-G 11339880-T-G *
13468405-A-T 11312729-A-T *
56862931-AG-A *
10684619-A-G *
4744338-TA-T 4876297-TA-T 8×A*
13405194-G-T 11249518-G-T *
13688924-C-T,T 11533248-C-T,T *
13838968-A-T 11718262-A-T *
13838958-A-ATGCAG 11718252-A-ATGCAG *
13748441-TGGAATGGAA-T 11592765-TGGAATGGAA-T *
13748439-AC-A 11592763-AC-A *
13720993-T-TATGGAATGGAATGGAATGGAATGGA 11565317-T-TATGGAATGGAATGGAATGGAATGGA *
13705477-AAT-A 11549801-AAT-A *
13693685-CCTAGAATGGAATGAA-C 11538009-CCTAGAATGGAATGAA-C *
13679796-A-AAAAC 11524120-A-AAAAC *
13838972-AATGG-A 11718266-AATGG-A *
13650760-A-T 11495084-A-T *
13650757-T-C 11495081-T-C *
13489266-G-A 11333590-G-A *
13489265-A-C 11333589-A-C *
13489251-C-A 11333575-C-A *
13489249-T-TA 11333573-T-TA *
13489238-G-C 11333562-G-C *
13488994-G-A 11333318-G-A *
13838970-G-A 11718264-G-A *
13838977-CA-C 11718271-CA-C *
13487835-A-C 11332159-A-C *
22813143-A-G 20651257-A-G YY*
28757649-A-G 26611502-A-G Y*
22813210-A-G 20651324-A-G YY*
22813208-G-T 20651322-G-T YY*
22813205-C-T 20651319-C-T YY*
22813179-A-T 20651293-A-T YY*
22813177-G-A 20651291-G-A YY*
22813157-T-C 20651271-T-C YY*
22813138-G-T 20651252-G-T YY*
16642622-T-TTC 14530742-T-TTC *
22813130-T-C 20651244-T-C YY*
22813126-A-G 20651240-A-G YY*
22255932-TGCTCAGTTCAAGAAAGAATGAAGCTGCAGACATTTACGGTGAGTGTTACAGCACTTAAAGTTGTTATATCCAGAGTTTGTTCCTTCAGATGTGTCCACAGTTTTTTTCTTCTGGCAGTTTCATGGTCTA-T 20094046-TGCTCAGTTCAAGAAAGAATGAAGCTGCAGACATTTACGGTGAGTGTTACAGCACTTAAAGTTGTTATATCCAGAGTTTGTTCCTTCAGATGTGTCCACAGTTTTTTTCTTCTGGCAGTTTCATGGTCTA-T DYZ19 *
16642663-T-TCA 14530783-T-TCA *
16642660-GCT-G 14530780-GCT-G *
16642656-G-GTGGC 14530776-G-GTGGC *
16642652-TACA-T 14530772-TACA-T *
16642623-GGC-G 14530743-GGC-G *
13487920-G-A 11332244-G-A *
13485358-G-C 11329682-G-C *
28809913-T-TGG 26663766-T-TGG *
10911726-A-C *
13448454-C-CGTTTT 11292778-C-CGTTTT *
13447103-TTTCTA-T 11291427-TTTCTA-T *
13332352-ATTACCACC-A 11176676-ATTACCACC-A *
13287961-T-TCTCTCTC 11132285-T-TCTCTCTC *
13287958-T-TA 11132282-T-TA *
10926302-A-ATTCTG *
10911738-G-T *
10884980-TTCACTGCAC-T *
13448488-T-C 11292812-T-C *
10841994-C-CGT *
10803266-C-T *
10803257-A-C *
10803249-GC-G *
10803239-TAAATTCAAC-T *
10803238-T-C *
10800349-C-A *
10068230-G-A 10230621-G-A *
13448480-GT-G 11292804-GT-G *
13448490-A-T 11292814-A-T *
13485327-T-G 11329651-T-G *
13474444-C-A 11318768-C-A *
13484738-C-A 11329062-C-A *
13484673-G-A 11328997-G-A *
13484668-T-G 11328992-T-G *
13482270-A-T 11326594-A-T *
13482231-G-C 11326555-G-C *
13482204-T-C,G 11326528-T-C,G *
13478619-T-C 11322943-T-C *
13478508-ATT-A 11322832-ATT-A *
13473860-TG-T 11318184-TG-T *
13449141-T-TCC 11293465-T-TCC *
13472755-A-G 11317079-A-G *
13472752-C-A 11317076-C-A *
13472744-G-T 11317068-G-T *
13470033-TG-T 11314357-TG-T *
13470028-AAGC-A 11314352-AAGC-A *
13469366-A-T 11313690-A-T *
13466488-C-T 11310812-C-T *
13465150-G-A 11309474-G-A *
28757651-G-T 26611504-G-T Y*
28809914-A-AATGGAATGGAGTGGAATG 26663767-A-AATGGAATGGAGTGGAATG *
9995028-TG-T 10157419-TG-T *
13428116-A-C 11272440-A-C *
13464478-A-C 11308802-A-C *
13461802-C-T 11306126-C-T *
13448469-C-T 11292793-C-T *
13448468-C-G 11292792-C-G *
13448063-T-TC 11292387-T-TC *
13448061-G-GCA 11292385-G-GCA *
13428120-A-G 11272444-A-G *
13384261-C-G 11228585-C-G *
13466409-A-T 11310733-A-T *
13365676-C-CA 11210000-C-CA *
13267917-TGCCACCACACC-T 11112241-TGCCACCACACC-T *
13267907-TACAGGC-T 11112231-TACAGGC-T *
13194078-C-T 11038402-C-T *
13193978-T-G 11038302-T-G *
11025623-A-T *
11025621-T-A *
11014885-T-C *
13465160-G-T 11309484-G-T *
13469998-G-C 11314322-G-C *
11014875-T-TAC *
13480231-T-A 11324555-T-A *
13482539-A-G 11326863-A-G *
13482137-G-A 11326461-G-A *
13480925-G-A 11325249-G-A *
13480920-GGC-G 11325244-GGC-G *
13480360-ACC-A 11324684-ACC-A *
13473839-C-G 11318163-C-G *
13480280-C-G 11324604-C-G *
13479139-T-A 11323463-T-A *
13472065-G-T 11316389-G-T *
13479102-T-A 11323426-T-A *
13478996-C-CCA 11323320-C-CCA *
13478673-G-A 11322997-G-A *
13478522-G-A 11322846-G-A *
13478485-C-T 11322809-C-T *
13475513-G-T 11319837-G-T *
13474757-T-C 11319081-T-C *
13472739-T-A 11317063-T-A *
11014880-T-C *
11014871-TCC-T *
56676601-A-G *
56830616-A-C *
9939064-C-G 10101455-C-G Y*
56867486-T-A *
56867478-T-TAA *
56850358-T-TCTCTGCACCGATCACTCAGGTGATGTAACTATTGTCTTGGCTCTGCTTAAAGGGACCTTGTCATATAC *
56836153-T-TTCCGC *
56834817-C-CTCCACTCCACTCCAT *
56830626-A-G *
56830603-T-A *
9948349-A-G 10110740-A-G Y*
56830602-T-C *
56763715-T-G *
56746241-CAATGGAATGGAATGGAATGG-C 11×AATGG*
56744450-TGGA-T *
56744446-GAA-G *
56734061-G-T *
56734060-G-T *
56678312-T-A *
9948348-C-T 10110739-C-T Y*
9954438-T-C 10116829-T-C Y*
10954350-C-T *
10879494-T-A *
10952466-A-ATTCCATTCAACTCCATTCCATTCCAATACTTTCCGTTATATTCCT *
10910699-C-CTGTAGT *
10905834-CTG-C *
10883422-C-A *
10883417-T-C *
10883407-T-TTTTC *
10883135-T-C *
10879496-T-G *
10879492-C-CG *
9959873-TAATAATAATAA-T 10122264-TAATAATAATAA-T *
10780627-T-TTCCATTTCATTCCATTGCATTCCAC *
10668345-T-TCC *
10027289-GAC-G 10189680-GAC-G *
9994892-TA-T,TAA 10157283-TA-T,TAA *
9994853-TATAA-AATAA,T 10157244-TATAA-AATAA,T *
9984236-C-G 10146627-C-G Y*
9984228-C-T 10146619-C-T Y*
9964499-G-A 10126890-G-A Y*
10056993-C-G 10219384-C-G *
9994910-GC-G 10157301-GC-G *
10027303-A-C 10189694-A-C Y*
13458792-A-C 11303116-A-C *
13697242-A-T 11541566-A-T *
13678352-T-A 11522676-T-A *
13576763-G-A 11421087-G-A *
13576760-T-C 11421084-T-C *
13486017-A-G 11330341-A-G *
13480839-C-A 11325163-C-A *
13465561-T-A 11309885-T-A *
13427979-T-C 11272303-T-C *
28734648-T-C 26588501-T-C Y*
13410359-A-G 11254683-A-G *
13410358-C-T 11254682-C-T *
13400548-A-T 11244872-A-T *
13400547-C-A 11244871-C-A *
13398816-C-T 11243140-C-T *
13398812-C-T 11243136-C-T *
13382928-T-C 11227252-T-C *
13382915-G-A 11227239-G-A *
28585419-G-A 26439272-G-A *
28791903-G-A 26645756-G-A *
13376815-C-A 11221139-C-A *
10662169-C-CTCCACTGCACGCCACTCCACTGCACTCCATTCCATTCCATTCCAT *
13461756-G-T 11306080-G-T *
13451445-ATTCCT-A 11295769-ATTCCT-A *
13451428-CTATTCCATTG-C 11295752-CTATTCCATTG-C *
13354871-AAC-A 11199195-AAC-A *
13247753-T-C 11092077-T-C *
13247752-C-T 11092076-C-T *
13196196-T-A 11040520-T-A FT258103 *
9985162-G-T 10147553-G-T Y*
28791906-G-A 26645759-G-A *
9964165-C-T 10126556-C-T Y*
9963323-A-G 10125714-A-G Y*
9958560-G-A 10120951-G-A Y*
9957026-T-C 10119417-T-C Y*
56885333-A-G *
56885327-G-A *
56705730-G-A *
56705708-T-G *
13380319-G-T 11224643-G-T *
13332218-G-C 11176542-G-C *
13462612-T-C 11306936-T-C *
9994978-T-C 10157369-T-C Y*
9995053-G-C 10157444-G-C Y*
9995047-G-A 10157438-G-A Y*
9995038-T-C 10157429-T-C Y*
9995030-G-A 10157421-G-A Y*
9995007-G-T 10157398-G-T Y*
9995005-G-A 10157396-G-A Y*
9994998-A-G 10157389-A-G Y*
9994967-A-G 10157358-A-G Y*
13576708-A-G 11421032-A-G *
9994966-T-C 10157357-T-C Y*
9994912-C-T 10157303-C-T Y*
9994905-T-A 10157296-T-A Y*
9994902-G-A 10157293-G-A Y*
9944655-C-G 10107046-C-G Y*
9780404-C-T 9942795-C-T Y*
9780401-T-C 9942792-T-C Y*
14305255-C-T 12184549-C-T Y*
13475301-C-T 11319625-C-T *
13576709-T-C 11421033-T-C *
10858969-C-T *
9942801-G-A 10105192-G-A Y*
10808021-C-T *
10026747-G-A 10189138-G-A Y*
10013987-G-T 10176378-G-T Y*
10013949-A-T 10176340-A-T Y*
10013934-C-T 10176325-C-T Y*
9945343-T-C 10107734-T-C Y*
9942803-C-T 10105194-C-T Y*
9942802-T-C 10105193-T-C Y*
9942789-T-A 10105180-T-A Y*
13576712-G-A 11421036-G-A FT445676 *
9932087-TTAAAA-T 10094478-TTAAAA-T *
9909201-G-C 10071592-G-C Y*
8972621-T-C 9135012-T-C *
5193796-T-C 5325755-T-C *
4636042-C-G 4768001-C-G *
4635955-G-A 4767914-G-A *
4635938-C-T 4767897-C-T *
3271838-T-C 3403797-T-C *
13462607-C-T 11306931-C-T *
13470108-CCA-C 11314432-CCA-C *
9986938-G-T 10149329-G-T Y*
3901846-ATG-A 4033805-ATG-A *
9916080-T-C 10078471-T-C Y*
9107854-TA-T *
9055890-T-A *
9055889-G-T *
9055886-T-TG *
4636108-T-A,A 4768067-T-A,A *
3901849-AT-A 4033808-AT-A *
56884440-T-TAAAA *
9916090-C-G 10078481-C-G Y*
56861298-T-TTA *
56845056-AGGCTCTGCCTATAGTGGCATTGTGACATATCTCTGCACTGATCACCCATGTGATATAACTCTTGTCTG-A *
56834790-C-CATTCCACTCCACTCCATTCA *
56833867-A-AC *
56833866-A-ACTCC *
56833351-C-CACTGCACTGCACTCCATTCCATTCCATTCT *
56829344-TGA-T *
28808021-GTT-G 26661874-GTT-G *
9916081-T-A 10078472-T-A Y*
9916098-T-A 10078489-T-A Y*
28780939-T-C 26634792-T-C *
9958184-A-G 10120575-A-G Y*
9986881-GTCGCC-G 10149272-GTCGCC-G *
9986880-G-T 10149271-G-T Y*
9986869-G-T 10149260-G-T Y*
9986865-G-A 10149256-G-A Y*
9986861-G-T 10149252-G-T Y*
9985132-T-C,G 10147523-T-C,G *
9965080-T-A 10127471-T-A Y*
9958039-G-A 10120430-G-A Y*
9916112-ACT-A 10078503-ACT-A *
9958035-T-A 10120426-T-A Y*
9957976-T-C 10120367-T-C Y*
9944658-G-T 10107049-G-T Y*
9916149-T-G 10078540-T-G Y*
9916145-A-T 10078536-A-T Y*
9916142-A-G 10078533-A-G Y*
9916134-A-T 10078525-A-T Y*
9916130-C-T 10078521-C-T Y*
28796860-TG-T 26650713-TG-T *
28587205-T-A 26441058-T-A *
13470111-A-AGC 11314435-A-AGC *
13487751-C-CAA 11332075-C-CAA *
13489771-G-GCCCAC 11334095-G-GCCCAC *
13489764-GT-G 11334088-GT-G *
13489758-G-A 11334082-G-A *
13489729-C-CCAG 11334053-C-CCAG *
13489637-C-CCCCA 11333961-C-CCCCA *
13489549-C-A 11333873-C-A *
13488958-G-GTC 11333282-G-GTC *
13478345-TGCA-T 11322669-TGCA-T *
13687991-G-A 11532315-G-A *
13478339-G-GCTC 11322663-G-GCTC *
13476534-T-C 11320858-T-C *
13475874-T-C 11320198-T-C *
13475303-T-C 11319627-T-C *
13474612-G-GCC 11318936-G-GCC *
13472110-T-C 11316434-T-C *
13470160-G-GCC 11314484-G-GCC *
13470126-G-A 11314450-G-A *
13583731-T-G 11428055-T-G *
13688004-C-T 11532328-C-T *
28587200-T-A 26441053-T-A *
16642873-A-G 14530993-A-G YY*
23354909-A-C,C 21193023-A-C,C *
22511231-G-T 20349345-G-T DYZ19 *
22448635-T-G 20286749-T-G DYZ19 *
22437620-GACCTTAGTGGTGAGCGTTACAGCACTTAAGTTTTTATGTCCAGAGTTTGTTCCTTCACATAAGTCCAGAGTTTCTTCCTTCTGTCCGGTTTATGGTCTTGCTCACTTCAAGAATGAAGCTGCAT-G 20275734-GACCTTAGTGGTGAGCGTTACAGCACTTAAGTTTTTATGTCCAGAGTTTGTTCCTTCACATAAGTCCAGAGTTTCTTCCTTCTGTCCGGTTTATGGTCTTGCTCACTTCAAGAATGAAGCTGCAT-G DYZ19 *
22237712-ACT-A 20075826-ACT-A DYZ19 *
22237711-C-CGT 20075825-C-CGT DYZ19 *
16642876-A-G 14530996-A-G YY*
16642875-T-C 14530995-T-C YY*
16642866-C-T 14530986-C-T YY*
13693068-T-A 11537392-T-A *
16642845-TTATG-T 14530965-TTATG-T *
16642841-G-GCACC 14530961-G-GCACC *
16642838-C-A 14530958-C-A YY*
16642835-AC-A 14530955-AC-A *
15097982-A-T 12986070-A-T YY*
15097973-C-T 12986061-C-T YY*
15097970-C-T 12986058-C-T YY*
15097958-C-A 12986046-C-A YY*
13405196-C-A 11249520-C-A *
13405066-G-A 11249390-G-A *
10902209-T-G *
13464432-C-A 11308756-C-A *
10655444-C-G *
13478488-C-A 11322812-C-A *
22229215-T-A 20067329-T-A DYZ19 *
5394879-G-A 5526838-G-A *
5558716-A-T 5690675-A-T *
7939251-A-G 8071210-A-G YY*
56829854-G-GTT *
13478264-A-G 11322588-A-G *
11030815-T-C *
3477885-TGC-T 3609844-TGC-T *
13720429-G-T 11564753-G-T *
9945336-A-G 10107727-A-G Y*
10751656-T-C *
10791937-C-T *
13461134-G-T 11305458-G-T *
13488973-TG-T 11333297-TG-T *
13489175-A-G 11333499-A-G *
10803265-C-A *
13389607-C-T 11233931-C-T *
4631504-AT-A 4763463-AT-A 8×T*
13488752-G-A 11333076-G-A *
10959026-C-T FT87579 *
13477081-C-A 11321405-C-A *
10798054-A-C *
10912212-A-G *
10912205-T-C *
10969480-C-T *
13469424-A-T 11313748-A-T *
10910845-G-T *
13389610-C-T 11233934-C-T *
10910838-G-A FT230077 *
58916336-C-G 56674535-G-C *
58847399-C-T 56743472-G-A *
22509331-G-A 20347445-G-A DYZ19 *
16642677-A-T 14530797-A-T YY*
13711836-A-G 11556160-A-G *
13708486-G-C 11552810-G-C *
13475517-C-A 11319841-C-A *
13480861-G-A 11325185-G-A *
10787989-T-A *
13460546-T-C 11304870-T-C *
9984319-G-A 10146710-G-A FT373752 Y*
13705634-T-G 11549958-T-G *
13482328-A-G 11326652-A-G *
13434989-T-A 11279313-T-A *
3444838-G-A 3576797-G-A *
10768675-C-T *
9985135-G-A 10147526-G-A Y*
9984331-A-G 10146722-A-G FT373753 Y*
9984270-T-C 10146661-T-C Y*
13977178-A-G 11856472-A-G Y*
13488360-T-A 11332684-T-A *
13489763-C-A 11334087-C-A *
13463131-T-A 11307455-T-A *
2827909-CT-C,CTT 2959868-CT-C,CTT 17×T*
10839067-T-C *
10911720-C-T *
13488961-CCA-C 11333285-CCA-C *
2925592-CTTT-C 3057551-CTTT-C 15×T*
13977174-T-C 11856468-T-C Y*
10953596-C-A *
10787984-T-C *
13258348-C-A 11102672-C-A *
10998831-A-C *
10910866-G-T FT436302 *
10803270-T-C *
7579147-G-T 7711106-G-T YY*
10880384-T-C *
10882090-C-T *
10882089-C-A *
58883917-G-A 56706954-C-T *
10912258-G-A *
10883420-T-C *
10912254-A-G *
10744531-T-C *
10744498-C-G *
28796070-A-C 26649923-A-C *
13636932-A-T 11481256-A-T *
10753011-TCCCCC-T *
13465168-T-A 11309492-T-A *
13469557-C-T 11313881-C-T *
3271448-T-C 3403407-T-C *
10977143-C-G *
13489255-A-T 11333579-A-T *
10744504-C-A *
13482838-A-G 11327162-A-G *
10925385-A-T *
10971446-C-A *
10752998-T-C *
11030839-C-T *
10916398-A-G *
10037905-T-C 10200296-T-C *
10946910-C-T *
11031647-G-A *
4049372-TAAA-T 4181331-TAAA-T 16×A*
13471208-G-T 11315532-G-T *
13478910-G-T 11323234-G-T *
9107857-T-G *
10918534-G-T *
13477203-G-A 11321527-G-A *
14280236-C-CT 12159530-C-CT 9×T*
9967154-C-A 10129545-C-A Y*
10688057-T-C *
10912515-G-C *
2750839-CAA-C,CAAA 2882798-CAA-C,CAAA 16×A*
13712579-G-T 11556903-G-T *
10958854-T-G *
10912510-C-G *
10752993-C-A *
10746667-C-A FT429399 *
10684634-A-T *
58856337-T-C 56734534-A-G *
22448664-G-T 20286778-G-T DYZ19 *
13482120-C-A 11326444-C-A *
10953593-T-A *
13388239-G-C 11232563-G-C *
13388232-A-G 11232556-A-G *
13388227-A-G 11232551-A-G *
13196234-A-T 11040558-A-T *
6403276-A-C 6535235-A-C *
22510056-G-C 20348170-G-C DYZ19 *
13259334-A-G 11103658-A-G *
10958833-T-A *
10835348-T-A *
56883991-C-T *
10791923-T-G *
58872690-C-A 56718181-G-T *
13488813-C-A 11333137-C-A *
10905880-C-A *
56735576-A-G *
10815198-C-A *
13477093-T-C 11321417-T-C *
13477085-C-T 11321409-C-T FT444130 *
11676341-C-G *
22510106-G-A 20348220-G-A BY225608 DYZ19 *
10992731-G-C *
22510102-A-G 20348216-A-G DYZ19 *
13704934-C-G 11549258-C-G *
13468142-CAG-C 11312466-CAG-C *
11029433-A-C *
10799659-C-T *
11030809-C-T *
13488585-C-T 11332909-C-T *
10846970-A-T *
13483336-G-A 11327660-G-A *
10872595-C-A *
13473805-A-T 11318129-A-T *
13478602-C-A 11322926-C-A *
13473802-G-C 11318126-G-C *
18606854-G-GTT 16494974-G-GTT 13×T*
13488538-G-T 11332862-G-T *
2834819-C-T 2966778-C-T FT178614 YY*
10688072-T-C *
10964905-G-A *
10940416-C-T *
10884808-T-A *
10787966-C-G *
56834239-ATTCCATTCCG-A *
13473870-A-T 11318194-A-T *
13463292-C-A 11307616-C-A *
11001437-T-TTCC *
13487572-C-A 11331896-C-A *
13462157-C-A 11306481-C-A *
10954383-C-T *
10784098-T-C *
4632489-GA-G 4764448-GA-G 10×A*
9964517-C-A 10126908-C-A Y*
59017776-A-T 56871629-A-T *
13473390-T-A 11317714-T-A *
10906157-T-G *
10951227-C-A *
13488731-C-T 11333055-C-T *
10918483-T-C *
13474688-T-C 11319012-T-C *
18843873-ATT-A 16731993-ATT-A 11×T*
19270521-G-A 17158641-G-A YY*
13470869-G-A 11315193-G-A *
10959055-A-C *
13347479-T-C 11191803-T-C *
10958830-C-A *
10806402-G-C *
13460380-T-A 11304704-T-A *
10918420-G-T *
13722779-A-G 11567103-A-G *
10959808-T-G *
10959805-C-A *
10692607-C-A *
13488811-G-A 11333135-G-A *
13347874-C-T 11192198-C-T *
10796163-G-T *
10688062-T-C *
10918139-T-A *
13489056-C-T 11333380-C-T *
10992717-G-C *
28799012-A-G 26652865-A-G *
10061348-A-C 10223739-A-C *
10951093-T-C *
10951088-T-C *
10909747-C-A *
17940092-T-C 15828212-T-C YY*
11676692-AAATGG-A *
13460292-C-T 11304616-C-T *
10982926-T-C *
10756659-C-A *
22762820-GAA-G 20600934-GAA-G 12×A*
10793271-A-G *
10793264-C-A *
9967951-G-A 10130342-G-A FGC241 Y*
13472172-A-G 11316496-A-G *
13483349-A-C 11327673-A-C *
10911677-G-A FT436328 *
10759198-T-A *
13489686-C-A 11334010-C-A *
6399691-G-GA 6531650-G-GA 10×A*
2693364-C-T 2825323-C-T YY*
13462525-T-A 11306849-T-A *
10935318-A-C *
10821523-T-G *
10759203-T-A *
10918603-C-G *
10958014-T-A *
10918593-T-C *
10918569-C-G *
10918539-G-T *
13573610-A-AT 11417934-A-AT 11×T*
10880379-T-C *
10787990-C-T *
10022132-A-G 10184523-A-G Y*
10993046-C-T *
28804018-G-A 26657871-G-A *
10920435-C-A *
59027000-G-A 56880853-G-A *
27287-G-A *
13488845-C-CCA 11333169-C-CCA *
10977142-G-C *
10801539-T-C *
59021174-A-G 56875027-A-G *
56875026-C-T *
13468338-G-A 11312662-G-A *
10056586-T-C 10218977-T-C *
10056572-T-C 10218963-T-C *
13720751-A-G 11565075-A-G *
10920437-A-G *
13720731-A-G 11565055-A-G *
10932759-C-A *
19486930-A-AT 17375050-A-AT 9×T*
2651303-CAAA-C,CAA 2783262-CAAA-C,CAA 16×A*
14118245-GTT-G 11997539-GTT-G 13×T*
10800337-C-T *
13478410-G-T 11322734-G-T *
10920441-G-A *
10911671-A-G *
10911700-G-A *
22510114-T-G 20348228-T-G DYZ19 *
13707292-G-A 11551616-G-A *
13466473-T-C 11310797-T-C *
13463750-C-A 11308074-C-A FTB19017 *
10625044-T-G *
13464415-C-G 11308739-C-G FT41991 *
21894633-CAAA-C 19732747-CAAA-C 15×A*
13476182-GT-G 11320506-GT-G *
10992738-C-A *
13706154-G-C 11550478-G-C BY48179 *
10082045-T-A 10244436-T-A *
11648711-C-A *
10784083-G-C *
10883414-G-C *
56841269-A-G *
10951081-C-A *
13484933-A-G 11329257-A-G *
13461279-T-A 11305603-T-A *
10784106-C-T *
13487297-C-A 11331621-C-A *
13469546-C-A 11313870-C-A *
13487975-C-T 11332299-C-T *
10846978-C-T *
22510080-T-G 20348194-T-G DYZ19 *
16642698-A-T 14530818-A-T YY*
13721345-T-A 11565669-T-A *
13721226-G-A 11565550-G-A *
13269822-T-G 11114146-T-G *
3358529-ATTTT-A 3490488-ATTTT-A 18×T*
10763654-G-T *
10909746-T-A *
10888009-T-A *
10909741-T-A *
10993029-C-A *
6001853-T-A 6133812-T-A *
13461800-T-G 11306124-T-G *
10998838-T-A *
11670845-A-C *
9966120-AAAAT-A 10128511-AAAAT-A *
13489697-GT-G 11334021-GT-G *
10056562-G-T 10218953-G-T *
13486507-C-T 11330831-C-T *
10688047-C-T *
10934304-G-T *
10693710-GTTGCA-G *
13466533-GC-G 11310857-GC-G *
13690258-G-C 11534582-G-C *
13468316-CT-C 11312640-CT-C *
13804020-C-T 11683314-C-T *
56877471-C-A *
56877465-A-G *
13483673-C-A 11327997-C-A *
13488380-A-T 11332704-A-T *
28812474-C-T 26666327-C-T *
10081962-C-A 10244353-C-A *
10081934-T-G 10244325-T-G *
10081913-G-A 10244304-G-A *
10081906-C-G 10244297-C-G *
10081894-A-T 10244285-A-T *
10081889-T-G 10244280-T-G *
10688048-T-C *
13488367-A-T 11332691-A-T *
10953602-C-A *
9909163-TG-T 10071554-TG-T *
10912537-G-A *
9909135-G-T 10071526-G-T Y*
9909120-T-C 10071511-T-C Y*
9909098-C-G 10071489-C-G Y*
10995463-C-A *
13460716-G-A 11305040-G-A *
13472169-C-G 11316493-C-G *
13463457-G-A 11307781-G-A *
10799650-C-A *
10803098-A-C *
13467717-C-G 11312041-C-G *
10803096-C-A *
13489823-T-G 11334147-T-G *
13489930-T-C 11334254-T-C *
13489925-C-A 11334249-C-A *
13488435-G-A 11332759-G-A *
13488428-G-T 11332752-G-T *
13488403-C-A 11332727-C-A *
13467722-C-T 11312046-C-T *
10026654-C-A 10189045-C-A Y*
11025546-T-C *
13405045-T-C 11249369-T-C *
9980244-C-G 10142635-C-G Y*
10038435-A-G 10200826-A-G *
10038427-T-C 10200818-T-C *
10038424-A-G 10200815-A-G *
10025660-C-T 10188051-C-T FGC34113 Y*
10025648-G-A 10188039-G-A Y*
10004369-A-G 10166760-A-G Y*
10004340-G-A 10166731-G-A Y*
9948400-C-T 10110791-C-T Y*
13374494-A-G 11218818-A-G *
9948397-T-C 10110788-T-C Y*
9929378-A-T 10091769-A-T Y*
10914894-G-C *
9936522-G-A 10098913-G-A Y*
16362-T-G *
10938628-C-G *
10772698-C-T *
10798047-T-C *
13374462-T-G 11218786-T-G *
13384263-G-A 11228587-G-A *
13463282-C-G 11307606-C-G *
13583668-G-A 11427992-G-A *
13478849-CACGAA-C 11323173-CACGAA-C *
13473663-GT-G 11317987-GT-G *
13267932-CTAA-C 11112256-CTAA-C *
9967987-TC-T 10130378-TC-T *
9967984-TGC-T 10130375-TGC-T *
3167215-G-GT 3299174-G-GT *
19209891-A-G 17098011-A-G YY*
13481864-T-A 11326188-T-A *
13403456-T-C 11247780-T-C *
13481853-A-C 11326177-A-C *
13478991-C-A 11323315-C-A *
13478949-A-G 11323273-A-G *
13478884-C-T 11323208-C-T *
13478883-C-G 11323207-C-G *
13470790-T-A 11315114-T-A *
13465694-A-T 11310018-A-T *
13416583-C-T 11260907-C-T *
11029428-T-C *
13463271-G-T 11307595-G-T *
13478858-C-CCCCA 11323182-C-CCCCA *
13477499-G-T 11321823-G-T *
10975892-C-A *
13465409-C-T 11309733-C-T *
13699005-T-A 11543329-T-A *
23565471-A-G 21403585-A-G YY*
10766393-A-C *
13477525-C-A 11321849-C-A *
13477506-G-A 11321830-G-A *
13464047-G-A 11308371-G-A *
10684608-C-G *
13489707-A-T 11334031-A-T *
13487633-C-T 11331957-C-T *
13477596-C-T 11321920-C-T *
28807351-G-T 26661204-G-T *
10805486-T-C *
10903711-T-C *
3194380-AT-A 3326339-AT-A 9×T*
13458740-C-T 11303064-C-T *
10684603-C-T *
2693343-G-A 2825302-G-A YY*
13463252-C-T 11307576-C-T *
10921423-T-C *
10749789-T-C *
56831471-C-CCAT *
56831469-C-CAT *
13463224-G-A 11307548-G-A *
13463209-C-T 11307533-C-T *
13471012-A-G 11315336-A-G *
13690878-G-C 11535202-G-C *
13690869-A-G 11535193-A-G *
10648161-C-A *
10800341-A-T *
13462164-C-A 11306488-C-A *
10772016-C-A *
10869928-T-C *
13463621-C-A 11307945-C-A *
13460525-C-A 11304849-C-A *
13474762-A-C 11319086-A-C *
10964893-C-T *
13450102-C-T 11294426-C-T *
13478855-C-CT 11323179-C-CT *
13478866-AC-A 11323190-AC-A *
10056466-C-G 10218857-C-G *
10068269-T-C 10230660-T-C *
10068330-T-A 10230721-T-A *
10068328-T-G 10230719-T-G *
10068321-A-T 10230712-A-T *
10068317-T-A 10230708-T-A *
10068284-C-T 10230675-C-T *
10068280-A-T 10230671-A-T *
10068275-A-T 10230666-A-T *
10068257-G-A 10230648-G-A *
10068354-A-G 10230745-A-G *
10068247-G-C 10230638-G-C *
10068244-C-G 10230635-C-G *
9985124-T-A 10147515-T-A Y*
9985117-T-C 10147508-T-C Y*
9967979-C-A 10130370-C-A Y*
9967977-G-A 10130368-G-A Y*
9945339-G-C 10107730-G-C Y*
9924517-T-A 10086908-T-A Y*
10068331-T-C 10230722-T-C *
10068377-T-G 10230768-T-G *
13468157-T-A 11312481-T-A *
13251678-C-T 11096002-C-T *
13405035-A-G 11249359-A-G *
13405030-T-C 11249354-T-C *
13380274-C-A 11224598-C-A *
13374252-G-A 11218576-G-A *
13374158-C-A 11218482-C-A *
13374144-T-C 11218468-T-C *
13269678-C-T 11114002-C-T *
13193984-T-A 11038308-T-A *
10068386-G-C 10230777-G-C *
11001414-C-T *
10936964-C-T *
10879478-T-A *
10852568-C-G *
10823124-T-C *
10752985-T-C *
10752975-T-C *
10068389-A-C 10230780-A-C *
9924455-T-A 10086846-T-A Y*
13468139-C-CTG 11312463-C-CTG *
13478871-C-CG 11323195-C-CG *
10995465-T-C *
13469965-A-G,T 11314289-A-G,T *
13462434-A-G 11306758-A-G *
13482112-G-T 11326436-G-T *
13476530-C-G 11320854-C-G *
13479770-T-A 11324094-T-A *
21998622-C-CT 19836736-C-CT 8×T*
13479595-C-A 11323919-C-A *
13471692-C-T 11316016-C-T BY85877 *
13476491-A-T 11320815-A-T *
6984552-C-T 7116511-C-T FT18869 YY*
13485275-A-T 11329599-A-T *
10959005-C-G *
58974480-C-CTTTG 56828333-C-CTTTG *
58856385-C-CCATTCCATTCGATTG 56734476-A-AAATGGAATGCAATCG *
28814688-TGGA-T 26668541-TGGA-T *
13488957-G-GTT 11333281-G-GTT *
13488703-GT-G 11333027-GT-G *
13476454-A-G 11320778-A-G *
13476494-A-T 11320818-A-T *
10821509-C-T *
3363318-CTTT-C 3495277-CTTT-C 15×T*
10045598-G-A 10207989-G-A BY209689 *
13476801-C-T 11321125-C-T *
13478697-C-T 11323021-C-T *
13482138-C-G 11326462-C-G *
13476436-C-G 11320760-C-G *
13476433-G-A 11320757-G-A *
13472368-T-C,G 11316692-T-C,G *
13488371-C-A 11332695-C-A *
13464497-C-T 11308821-C-T *
13476512-C-T 11320836-C-T *
13478611-A-G 11322935-A-G *
13484196-T-C 11328520-T-C *
28786012-A-AGGGGAGTTTG 26639865-A-AGGGGAGTTTG *
13462427-T-G 11306751-T-G *
4439012-T-G 4570971-T-G *
13481783-G-C 11326107-G-C *
13470607-C-G 11314931-C-G *
13476513-G-T 11320837-G-T *
10056467-G-T 10218858-G-T *
10056412-T-G 10218803-T-G *
15018145-A-AT 12906234-A-AT 10×T*
10061366-A-G 10223757-A-G *
10912302-T-C *
10907737-A-C *
4237791-GA-G 4369750-GA-G 9×A*
10954353-T-G *
10056372-G-A 10218763-G-A *
10061373-T-G 10223764-T-G *
10061372-C-T 10223763-C-T *
10061357-C-A 10223748-C-A *
28809861-A-AGTGG 26663714-A-AGTGG *
13464054-C-A 11308378-C-A BY32169 *
56853606-G-T *
56714065-T-G *
22510088-G-A 20348202-G-A DYZ19 *
15769380-C-G 13657500-C-G YY*
4262884-A-AT 4394843-A-AT 10×T*
11023161-CCACTCCTCT-C *
13470238-G-C 11314562-G-C *
13707320-A-G 11551644-A-G *
14210430-AT-A 12089724-AT-A 9×T*
13485378-A-G 11329702-A-G *
22485146-C-G 20323260-C-G DYZ19 *
13471169-A-T 11315493-A-T *
13469581-C-G 11313905-C-G *
13469577-T-A 11313901-T-A *
10998836-C-G *
10998827-T-C *
13461776-G-A 11306100-G-A *
13480835-T-C 11325159-T-C *
22485141-T-A 20323255-T-A DYZ19 *
14564318-C-CA 12452518-C-CA 8×A*
13462652-G-A 11306976-G-A FT262765 *
13477493-GA-G 11321817-GA-G *
10917971-T-C *
11648093-C-A *
10918551-A-C *
10918537-T-C *
13708735-C-G 11553059-C-G *
13708722-A-G 11553046-A-G *
13474637-A-T 11318961-A-T *
10952516-A-G *
10794021-C-A *
19092551-T-C 16980671-T-C YY*
28794150-G-T 26648003-G-T *
13482276-C-A 11326600-C-A *
13485346-C-A 11329670-C-A *
11032198-A-ATTCCG *
6630528-G-T 6762487-G-T YY*
10971459-A-C *
10982928-T-C *
10799656-A-C *
13482355-T-C 11326679-T-C *
10879479-T-C *
10879474-T-C *
10953594-C-T *
10821517-A-C *
56742783-A-C *
10889328-A-C *
13487898-C-A 11332222-C-A *
10796904-T-C *
10914764-C-T *
13474391-T-A,C 11318715-T-A,C *
10929611-C-T *
10006050-C-A 10168441-C-A Y*
13463646-T-G 11307970-T-G *
9990546-CCT-C 10152937-CCT-C *
13471053-G-T 11315377-G-T *
13469393-C-T 11313717-C-T *
13460329-G-C 11304653-G-C *
13460300-T-A 11304624-T-A *
13460268-G-T 11304592-G-T *
13726363-T-G 11570687-T-G *
13461749-G-T 11306073-G-T *
10915045-T-C *
10912334-G-A *
13611136-G-A 11455460-G-A *
10879483-T-A *
11032189-T-C *
23858684-CA-C 21696798-CA-C 9×A*
13487533-A-C 11331857-A-C *
10792282-T-A *
10766397-C-A *
13471171-A-C 11315495-A-C *
10925029-A-C *
23053038-T-C 20891152-T-C YY*
10884836-G-C *
13357129-G-A 11201453-G-A *
10808037-A-C *
7730-T-G *
7707-G-T *
15484956-G-A 13373076-G-A BY178829 YY*
10657331-A-T *
6984544-T-C 7116503-T-C Y*
13466507-G-A 11310831-G-A *
14825706-C-CT 12713773-C-CT 8×T*
56859657-A-G *
10936971-C-A *
13484675-C-T 11328999-C-T *
13470060-G-C 11314384-G-C *
10889334-T-A *
9936519-T-C 10098910-T-C Y*
13489731-GGCC-G 11334055-GGCC-G *
10906162-C-T *
13488960-C-CA 11333284-C-CA *
13465553-G-T 11309877-G-T *
10930264-T-C *
13489818-G-A 11334142-G-A *
13470057-A-G 11314381-A-G *
10990698-C-T *
10951075-C-T *
13463256-C-G 11307580-C-G *
10815185-ATG-A *
13489105-C-T 11333429-C-T *
13464022-C-A 11308346-C-A *
13481861-C-A 11326185-C-A *
13488450-G-A 11332774-G-A *
13463190-G-T 11307514-G-T *
13525718-G-A 11370042-G-A *
10907670-G-C *
6984521-G-A 7116480-G-A Y*
10981248-T-A *
22811753-G-GA 20649867-G-GA *
56722464-G-GCCACGGAATGGAATGGACAC *
13464406-C-A 11308730-C-A *
10930268-C-G *
13516616-A-G 11360940-A-G *
9013206-C-G 9175597-C-G Y*
13486038-C-A 11330362-C-A *
28800441-T-C 26654294-T-C *
16922884-TA-T 14811004-TA-T *
10930259-T-C *
10657389-C-G *
13469537-C-T 11313861-C-T *
10823091-C-T FT432768 *
28797160-G-C 26651013-G-C *
10859385-T-C *
10954351-C-T *
13461835-C-G 11306159-C-G *
27370827-G-GA 25224680-G-GA P1_g3 11×A*
13477606-T-G 11321930-T-G *
3873186-CAA-C 4005145-CAA-C 15×A*
10784066-A-T *
13434575-T-A 11278899-T-A *
10803258-T-C *
13488844-G-GCC 11333168-G-GCC *
13472026-C-A 11316350-C-A *
10667826-T-C *
13499445-A-C 11343769-A-C *
13461754-T-A 11306078-T-A *
29764-T-G *
27353-A-C *
27336-T-C *
16395-C-G *
16387-G-T *
16381-T-G *
5567707-GA-G 5699666-GA-G 8×A*
10806412-A-T *
10655439-C-G *
22485573-A-T 20323687-A-T DYZ19 *
9986279-T-C 10148670-T-C Y*
9986272-G-C 10148663-G-C Y*
9986257-C-T 10148648-C-T Y*
9986255-T-C 10148646-T-C Y*
10930257-T-A *
13484855-G-A 11329179-G-A *
10846969-A-G *
10794028-C-T *
7746-G-C *

In the table above, the meaning of the confidence field depends on whether the data comes from an FTDNA kit or an FGC kit. For FTDNA kits, + implies a "PASS" result with just one possible variant, * indicates a "PASS" but with multiple variants, ** indicates "REJECTED" with just a single variant, and *** indicates "REJECTED" with multiple possible variants. 'A*' are heterozygous variants not called by FTDNA, but still pulled from the VCF file. For FGC kits, + indicates over 99% likely genuine (95% for INDELs); * over 95% likely genuine (90% for INDELs); ** about 40% likely genuine; *** about 10% likely genuine. Manual entries read directly from a BAM file will be either + indicating positive, or * indicating that the data show a mixture of possible variants.

For the FTDNA kits, the BED data is encoded in the background color of the cells. Those cells with a white background have coverage, those with a grey background indicate no coverage in the BED file, and those with a pink background indicate the mutation is on the edge of a coverage region. These pink regions often indicate that the individual may be positive for a SNP even if there is no corresponding entry in the vcf file.

The combBED column indicates whether or not the mutation is a SNP and falls in the combBED region defined in Defining a New Rate Constant for Y-Chromosome SNPs based on Full Sequencing Data by Dmitry Adamov, Vladimir Guryanov, Sergey Karzhavin, Vladimir Tagankin, Vadim Urasin.

The McDonald BED column indicates whether or not the mutation is a SNP and falls in the BED region used by Dr. Iain McDonald in the age analysis he does for R-U106 men.

Age Analysis Information (work in progress)

AllMcDonaldYFull
Kit: 7EK9X73D1504767197209277843735
Used in age calculations1504767197209277843735
Counts of SNPs856371
Variant counts last updated 2022-05-14 07:27:51.



Big Tree Main Page