Tree Position

R-P312/S116 > Z290 > L21/S145 > S552 > DF13 > DF21/S192 > Z30233 > FGC3903/S5201 > S5199 > Z246 > DF25 > DF5 > ZZ32 > CTS3655 > FT135171 > L627 > BY3364 > BY3368 > BY50703 > 13611134-T-C

Unique Mutations

The mutations unique to this man are summarized in the table below. Those with a '+' or '*' confidence level are considered by FamilyTreeDNA or FullGenomesCorp to be high quality SNPs/INDELs. For completeness, all other mutations of lesser confidence are included as well. These additional mutations may be useful for distinguishing between very closely related men.

Occasionally, some of the mutations listed here will be thought to be shared with other men in which case they might appear in upstream blocks on the tree. When this happens, the 'Blocks' field will indicate what block they appear in. Such a situation might arise with BigY men if the BED data suggests another man may be positive for a SNP, even though it doesn't appear in his VCF data. It might also happen if Chromo2 testing or Sanger sequencing of other men not on the tree show the SNP to be shared.

POS-REF-ALT (hg19) POS-REF-ALT (hg38) Blocks Names Region McDonald BED combBED STRKane38
NBQ47G32
3428687-G-GAT 3560646-G-GAT 22×AT+
4826400-T-TTATA 4958359-T-TTATA 22×TA+
18395723-T-TTATA 16283843-T-TTATA P6_Gap 27×TA+
13545399-G-GA 11389723-G-GA +
10763233-T-TTTCATTCCACTCCACTCCATTCCACTCCACTCCATTCCATTCCATTCCACTTCATTCCATTCTATTCCATTACATTCCTTTCCAC +
10776042-TTCCATTCCATTCCATTCCATTCCGCTCCACTCAATTCCACTCCACTCCACTCCACTCCATTCCAC-T +
28802523-GC-G 26656376-GC-G +
28802526-ATGAGGTGGAGGGC-A 26656379-ATGAGGTGGAGGGC-A +
28802542-T-G 26656395-T-G +
28802546-ACGGAGTTGAAT-A 26656399-ACGGAGTTGAAT-A +
28802563-GGGGTGTAATT-G 26656416-GGGGTGTAATT-G +
28802574-G-C 26656427-G-C +
28802582-T-C 26656435-T-C +
13545402-G-GAAA 11389726-G-GAAA +
14751-TGGGG-T +
14755-G-GTCAT +
10908517-G-GTGACACATCTCTGAAC +
18060356-ACATATATATATGTACATATATATATATGTATGTG-A 15948476-ACATATATATATGTACATATATATATATGTATGTG-A +
22508174-C-A 20346288-C-A DYZ19 +
27334929-A-G 25188782-A-G P1_g3 +
13478497-C-T 11322821-C-T *
22508574-T-C 20346688-T-C DYZ19 *
13476793-C-G 11321117-C-G *
13469743-C-CT 11314067-C-CT *
58833932-C-A 56756939-G-T *
28808707-A-G 26662560-A-G ZS4485 GG346 *
13474430-C-G 11318754-C-G *
22508573-G-A 20346687-G-A DYZ19 *
22430289-A-T 20268403-A-T DYZ19 *
13489636-C-A 11333960-C-A *
13479209-T-C 11323533-T-C *
13479211-G-C 11323535-G-C *
9977749-G-A 10140140-G-A FTA6364 Y*
10022511-G-C 10184902-G-C Y*
22444290-T-A 20282404-T-A DYZ19 *
22444294-T-G 20282408-T-G FT456772 DYZ19 *
22444295-C-T 20282409-C-T DYZ19 *
58819795-C-T 56771076-G-A *
13445789-C-T 11290113-C-T *
9962644-C-T 10125035-C-T Y*
13480905-C-T 11325229-C-T *
9962327-T-C 10124718-T-C Y*
9952738-T-C 10115129-T-C Y*
9952737-T-G 10115128-T-G Y*
10022507-A-C 10184898-A-C Y*
58884077-G-C 56706794-C-G *
13445808-A-T 11290132-A-T *
13136965-T-C 10626451-T-C *
9952729-A-T 10115120-A-T Y*
13489729-C-T 11334053-C-T *
58833894-A-T 56756977-T-A *
58866272-G-C 56724599-C-G *
9962654-A-T 10125045-A-T Y*
13480124-T-A 11324448-T-A *
3577098-T-TGACAG 3709057-T-TGACAG *
4424172-A-G 4556131-A-G *
9951247-C-T 10113638-C-T Y*
9964758-G-T 10127149-G-T Y*
9964760-G-A 10127151-G-A Y*
10042192-T-G 10204583-T-G *
10042206-C-G 10204597-C-G *
10093259-G-A 10255650-G-A FT91461 *
10093273-G-A 10255664-G-A *
13269587-AC-A 11113911-AC-A *
13305977-TG-T 11150301-TG-T *
13439250-T-G 11283574-T-G *
13439252-A-G 11283576-A-G *
13439275-GT-G 11283599-GT-G *
13480875-G-A 11325199-G-A *
13640645-T-C 11484969-T-C *
13640780-T-A 11485104-T-A *
13640909-G-T 11485233-G-T *
14443735-C-T 12323008-C-T CTS2718 Y*
58869341-T-C 56721530-A-G *
58995859-A-G 56849712-A-G *
59003980-C-T 56857833-C-T *
59027100-G-C 56880953-G-C *
59027107-C-A 56880960-C-A *
22479390-G-C 20317504-G-C DYZ19 *
59006962-T-TAAA 56860815-T-TAAA 8×A*
13471757-T-A 11316081-T-A *
9962556-G-A 10124947-G-A Y*
13474745-C-A 11319069-C-A *
13489358-C-T 11333682-C-T *
22298327-C-G 20136441-C-G FT455398 DYZ19 *
22298332-A-G 20136446-A-G BY216669 DYZ19 *
9964086-TA-T 10126477-TA-T *
10042211-T-C 10204602-T-C FT376822 *
10042212-G-A 10204603-G-A *
13265490-G-A 11109814-G-A *
13446330-G-T 11290654-G-T *
13447333-ACTC-A 11291657-ACTC-A *
13486587-A-C 11330911-A-C *
13523341-C-CG 11367665-C-CG *
13688538-A-C 11532862-A-C *
13692970-T-G 11537294-T-G *
13706796-C-T 11551120-C-T BY54412 *
28586890-A-T 26440743-A-T *
58979107-C-CCACTCCA 56832960-C-CCACTCCA *
59024223-C-T 56878076-C-T *
59027648-G-C 56881501-G-C *
10070058-G-A 10232449-G-A *
13481082-T-G 11325406-T-G *
13136942-G-A 10626428-G-A *
58874760-A-T 56716111-T-A *
13480867-C-T 11325191-C-T *
9188489-GTCT-G 9350880-GTCT-G *
58848412-T-C 56742459-A-G *
3167079-C-A 3299038-C-A FGC53497 *
9963286-T-A 10125677-T-A Y*
9963287-T-A 10125678-T-A Y*
9965063-T-TTAGG 10127454-T-TTAGG *
58995193-T-C 56849046-T-C *
58995194-G-C 56849047-G-C *
13465573-A-C 11309897-A-C *
9946313-C-T 10108704-C-T Y*
58980934-T-TTCCAG 56834787-T-TTCCAG *
58982716-T-C 56836569-T-C *
58980929-T-TTCCATTCCAG 56834782-T-TTCCATTCCAG *
13445754-TTTTA-T 11290078-TTTTA-T *
13474613-C-G 11318937-C-G *
58912483-C-A 56678388-G-T *
9962310-A-G 10124701-A-G Y*
13136902-T-A 10626388-T-A *
13136953-T-G 10626439-T-G *
22279895-C-T 20118009-C-T BY31739 DYZ19 *
13712671-C-A,G 11556995-C-A,G *
59020952-C-CAG 56874805-C-CAG *
13480123-C-T 11324447-C-T *
13474546-CG-C 11318870-CG-C *
13700543-C-G,T 11544867-C-G,T *
13489678-C-T 11334002-C-T *
58848204-C-CCATTG 56742657-G-GAATGC *
13468314-C-T 11312638-C-T *
13468321-GC-G 11312645-GC-G *
13451476-TTCCATTCTATTCTGC-T 11295800-TTCCATTCTATTCTGC-T *
13449054-AATGAG-A 11293378-AATGAG-A *
22465073-A-C 20303187-A-C BY45801 DYZ19 *
22430287-C-T 20268401-C-T DYZ19 *
58868981-C-G 56721890-G-C *
13466466-C-T 11310790-C-T *
13489167-T-A 11333491-T-A *
13478473-G-T 11322797-G-T *
13489700-C-T 11334024-C-T *
13489704-C-G 11334028-C-G *
13489738-C-G 11334062-C-G *
13468457-G-A 11312781-G-A *
13468434-G-A 11312758-G-A *
10081944-G-A 10244335-G-A *
58868344-G-C 56722527-C-G *
13345159-T-A 11189483-T-A A3795 *
9962270-G-A 10124661-G-A Y*
9962295-G-A 10124686-G-A Y*
58865819-A-G 56725052-T-C *
13489571-G-T 11333895-G-T *
13489586-C-T 11333910-C-T *
13489609-C-T 11333933-C-T *
13474539-A-G 11318863-A-G *
13489612-AC-A 11333936-AC-A *
28810823-T-G 26664676-T-G *
13474600-G-T 11318924-G-T *
13478532-G-T 11322856-G-T *
58979510-C-CTCCACACCATTCCAT,CTCCATTCCATTCCATTCTACTCCATTCCAT 56833363-C-CTCCACACCATTCCAT,CTCCATTCCATTCCATTCTACTCCATTCCAT *
13486532-G-A 11330856-G-A *
13468338-GC-G 11312662-GC-G *
13476500-A-C 11320824-A-C *
13474615-T-A,C 11318939-T-A,C *
13462091-A-G 11306415-A-G *
13135848-A-G 10625334-A-G *
13135853-G-A 10625339-G-A *
13135866-G-A 10625352-G-A *
13136141-C-CTG 10625627-C-CTG *
13136145-G-A 10625631-G-A *
13483954-G-A 11328278-G-A *
13489311-G-C 11333635-G-C *
13726149-T-C 11570473-T-C *
13726154-C-G 11570478-C-G *
13474516-G-C 11318840-G-C *
13489415-G-A 11333739-G-A *
13476164-G-T 11320488-G-T *
56833323-C-CTCCATTCCAG *
13478310-G-T 11322634-G-T *
13478244-C-T 11322568-C-T *
13478208-C-A 11322532-C-A *
13476776-C-T 11321100-C-T *
13476182-G-T 11320506-G-T *
13474524-G-T 11318848-G-T *
13474544-G-GT 11318868-G-GT *
13461883-C-A 11306207-C-A *
9962669-T-C 10125060-T-C Y*
13476853-C-G 11321177-C-G *
56828284-A-AATTCCTATCC *
13462044-C-A 11306368-C-A *
13462069-A-C 11306393-A-C *
13489698-T-A,G 11334022-T-A,G *
13489595-C-A 11333919-C-A *
56838232-G-C *
13447896-C-CA 11292220-C-CA *
10081655-G-T 10244046-G-T *
10081656-A-G 10244047-A-G *
10081658-G-A 10244049-G-A FT427376 *
10081659-G-T 10244050-G-T *
13474593-G-A 11318917-G-A *
13476208-G-T 11320532-G-T *
13474560-G-T 11318884-G-T *
13476469-A-G 11320793-A-G *
13470501-C-T 11314825-C-T *
13466477-C-A 11310801-C-A *
13480845-G-C 11325169-G-C *
56832336-A-ACTCCT *
13478299-G-A 11322623-G-A *
13466533-GC-G 11310857-GC-G *
10693710-GTTGCA-G *
13466473-T-C 11310797-T-C *
13478391-A-T 11322715-A-T *
13478322-G-A 11322646-G-A *
13480858-C-A 11325182-C-A *
9931316-T-C 10093707-T-C Y*
13474556-C-G 11318880-C-G *
13483936-C-G 11328260-C-G *
28815441-T-C 26669294-T-C *
28815453-A-T 26669306-A-T *
13472024-A-C 11316348-A-C *
58883917-G-A 56706954-C-T *
56829854-G-GTT *
13439463-A-C 11283787-A-C *
13439472-T-C 11283796-T-C *
13439474-T-C 11283798-T-C *
13486489-C-A 11330813-C-A *
56838224-T-C *
56838228-C-T *
13480782-G-C 11325106-G-C *
13480798-A-T 11325122-A-T *
13480816-C-T 11325140-C-T *
13489439-A-G 11333763-A-G *
56831691-AACTCC-A *
13721022-G-C 11565346-G-C *
13721029-T-G 11565353-T-G *
13721050-A-T 11565374-A-T *
22510056-G-C 20348170-G-C DYZ19 *
9931285-T-C 10093676-T-C Y*
13465564-T-A 11309888-T-A *
13474637-A-T 11318961-A-T *
13489608-C-G 11333932-C-G *
13489660-C-A 11333984-C-A *
58858906-C-G 56731965-G-C *
13428056-G-A 11272380-G-A *
13489527-C-G,T 11333851-C-G,T *
13476735-C-A 11321059-C-A *
9962676-C-T 10125067-C-T Y*
13584131-C-A 11428455-C-A *
13461782-C-G 11306106-C-G *
56838239-A-T *
13721142-C-T 11565466-C-T *
13478295-C-A 11322619-C-A *
13693639-C-T 11537963-C-T *
13470533-C-G 11314857-C-G *
13480851-G-A 11325175-G-A *
9952607-G-T 10114998-G-T Y*
56833841-A-AC *
13489424-C-T 11333748-C-T *
13494067-G-T 11338391-G-T FT444312 *
13494068-T-G 11338392-T-G *
13487956-G-A 11332280-G-A *
9965224-G-A 10127615-G-A Y*
13487962-C-A 11332286-C-A *
13466507-G-A 11310831-G-A *
13478412-C-A 11322736-C-A *
13461909-C-A 11306233-C-A *
13489410-T-A 11333734-T-A *
56722464-G-GCCACGGAATGGAATGGACAC *
56676499-G-T *
56832352-T-TTCAAC *
13470530-G-A 11314854-G-A *
10056412-T-G 10218803-T-G *
13470471-C-T 11314795-C-T *
13461930-G-A 11306254-G-A *
13474404-C-A 11318728-C-A *
13701922-C-A 11546246-C-A *
13701928-C-G 11546252-C-G *
13465684-C-A 11310008-C-A *
13466440-G-T 11310764-G-T *
13135256-C-A 10624742-C-A *
13135260-T-C 10624746-T-C *
13135261-G-T 10624747-G-T *
13476821-T-G 11321145-T-G *
13476832-G-A 11321156-G-A *
13476836-G-A 11321160-G-A *
13476842-A-G 11321166-A-G *
9962276-GCC-G 10124667-GCC-G *
9980235-GCC-G 10142626-GCC-G *
10093297-A-AAG 10255688-A-AAG *
13476795-ACC-A 11321119-ACC-A *
13476800-C-CTT 11321124-C-CTT *
13488716-A-ATGG 11333040-A-ATGG *
13489627-CA-C 11333951-CA-C *
13489630-C-CAA 11333954-C-CAA *
13691798-T-TGGA 11536122-T-TGGA *
58974480-C-CTTTG 56828333-C-CTTTG *
58974481-C-CA 56828334-C-CA *
59006822-A-AC 56860675-A-AC *
13476525-T-A 11320849-T-A *
10626136-C-T *
13470622-G-A 11314946-G-A *
13445827-T-A 11290151-T-A *
13446028-A-C 11290352-A-C *
13469437-C-G 11313761-C-G *
13482161-A-T 11326485-A-T *
13482199-A-C 11326523-A-C *
13482756-G-T 11327080-G-T *
13489441-A-G 11333765-A-G *
13721130-T-C 11565454-T-C *
22511304-G-T 20349418-G-T DYZ19 *
28583970-A-G 26437823-A-G *
28815411-A-G 26669264-A-G *
56857603-TA-T,TAAAA 11×A*
9961067-A-T 10123458-A-T Y*
13465551-G-T 11309875-G-T *
13465562-A-G 11309886-A-G *
13584117-C-T 11428441-C-T *
22511305-A-T 20349419-A-T DYZ19 *
28795420-A-C 26649273-A-C *
13497335-G-A,C 11341659-G-A,C *
13466551-C-G 11310875-C-G *
13482547-C-CA 11326871-C-CA *
56859636-G-A *
56880582-T-TA,TAA 9×A*
13519152-T-C 11363476-T-C *
13480891-G-C 11325215-G-C *
13470635-G-A 11314959-G-A *
9946217-T-C 10108608-T-C Y*
9946220-C-T 10108611-C-T Y*
9946225-G-C 10108616-G-C Y*
9946252-C-T 10108643-C-T Y*
13264057-G-T 11108381-G-T *
13264058-T-A 11108382-T-A *
13279998-CAAAA-C 11124322-CAAAA-C 26×A*
9946151-A-G 10108542-A-G Y*
9931976-T-TC 10094367-T-TC *
13475438-G-T 11319762-G-T *
13476489-A-T 11320813-A-T *
13476491-A-G 11320815-A-G *
13490000-A-T 11334324-A-T *
13476520-T-G 11320844-T-G *
13476608-C-T 11320932-C-T *
13469969-A-G 11314293-A-G *
13473844-C-A 11318168-C-A *
13345169-T-G 11189493-T-G *
13480159-G-A,C 11324483-G-A,C *
13480191-C-T 11324515-C-T *
22359671-A-G 20197785-A-G DYZ19 *
13466516-G-T 11310840-G-T *
10022522-G-C 10184913-G-C Y*
10054175-A-AC 10216566-A-AC *
13720852-T-C,G 11565176-T-C,G *
56706249-T-A,C *
10081958-T-A 10244349-T-A *
10625043-C-T *
13470572-G-T 11314896-G-T *
13476574-T-A 11320898-T-A *
13467494-T-C 11311818-T-C *
13467495-C-A 11311819-C-A *
56833934-C-T *
13465116-C-T 11309440-C-T *
13478466-C-T 11322790-C-T *
13489984-T-A 11334308-T-A *
3167067-G-C 3299026-G-C *
10057192-C-G 10219583-C-G *
13427975-C-A 11272299-C-A *
13427979-T-C 11272303-T-C *
13465561-T-A 11309885-T-A *
13723073-G-T 11567397-G-T *
56885327-G-A *
9057155-C-CA *
9057158-T-C *
9962672-C-T 10125063-C-T Y*
9962678-G-A 10125069-G-A FT369810 Y*
10632709-A-C,C *
10632714-CA-C,C *
10632717-G-C,C *
10661491-TTTCAC-T *
10661500-TTTCCATTCCATTCCTTTCTA-T *
10661524-CTTTCCATTCCATTCCTTTCT-C *
10661551-TTCCATTCCATTCCACTCCAG-T *
10693381-C-CT *
10693383-C-CACTCCACTCCAT *
13446323-G-T 11290647-G-T *
13447338-ACTCCACTCCACT-A 11291662-ACTCCACTCCACT-A *
13447897-G-GTGCATTCCA 11292221-G-GTGCATTCCA *
13448026-CAT-C 11292350-CAT-C *
13448030-CCACTCCA-C 11292354-CCACTCCA-C *
13468464-C-T 11312788-C-T *
13468474-G-T 11312798-G-T *
13470115-C-G 11314439-C-G *
13489829-G-A 11334153-G-A *
13687695-TATA-T 11532019-TATA-T *
13718773-C-G,G 11563097-C-G,G *
22299719-CACTTAAAGTTGTTATGTCCAGAGTTTGTTCTTTCAGATGTGTCCAGAGTTTCTTTCTACTGGCAGGTTCATGGTCTTGCTCACTTCAATAATGAAGCTCCAGTCCGTTACGGTGAGTGTTACAGT-C 20137833-CACTTAAAGTTGTTATGTCCAGAGTTTGTTCTTTCAGATGTGTCCAGAGTTTCTTTCTACTGGCAGGTTCATGGTCTTGCTCACTTCAATAATGAAGCTCCAGTCCGTTACGGTGAGTGTTACAGT-C DYZ19 *
22511231-G-T 20349345-G-T DYZ19 *
23354909-A-C,C 21193023-A-C,C *
56825934-T-TAATTCCATTCGATTGCATTCCATTCGATTGCATTCCATTCGATTGCATTCCATTCGATTG *
56826835-TCC-T *
56826838-ATTCCATTC-A *
56826847-GATTCCATTCCATTCAATTCC-G *
56829342-T-TTC *
56829344-TGA-T *
56832309-C-CAATTCAGCTCCACTCCACTCCAATG *
56833283-C-CTCCTTTCCATTCCATTCCACTCCACTCCATTCCACTCCACTCCATTCCACTCTACTCCCCTCCACTCCACTCCAT *
56834400-C-CCTGTCCACTCCATTCCACTCCACTTCACTCCAT *
56834614-AC-A *
56834616-TCCATTCCATTCCATTTCAC-T *
56834809-C-CCA *
56843830-T-TTGCCTACAGGGGACTTTTTGACATAGCTCTGCACTGATCACCCGGGTGATGCAACTCTTCTCTATGTTC *
56860115-G-GA,GA *
9055886-T-TG *
9055889-G-T *
9055890-T-A *
9056619-T-TTTGTGTTC *
9056621-A-ACTATTTCTCCATTTTGTATTTCTATTGTCTTTTTTTTTTTCTTGAGTT *
9056624-A-AC *
9056626-A-AGTCTTCATATGTTGTGGATAACAGACTTCTTACATCTACAAC *
9056671-ACC-A *
9056674-G-GTA *
10093305-C-T 10255696-C-T *
10093312-C-G 10255703-C-G *
10093314-T-C 10255705-T-C *
10625022-T-A *
10625024-CACTATA-C *
10625033-C-CAT *
10625034-G-GGGAC *
10625038-AAGCC-A *
10625045-C-CGTTT *
10625511-G-A,T *
10626296-A-G *
10626311-G-A *
10626314-C-G *
10626317-T-C *
10626321-T-C *
10626326-C-G *
10626335-G-C *
10626363-T-C *
10626375-G-T *
10626392-G-A *
10626395-T-A *
10626410-T-G *
10626477-G-C *
10626484-G-A *
13445780-C-T 11290104-C-T *
13446026-A-G 11290350-A-G *
13447118-ATT-A 11291442-ATT-A *
13447121-CCATTCCATTCCATTCCAT-C 11291445-CCATTCCATTCCATTCCAT-C *
13448454-C-CGTTTT 11292778-C-CGTTTT *
13466488-C-T 11310812-C-T *
13469366-A-T 11313690-A-T *
13469372-A-T 11313696-A-T *
13470480-C-A 11314804-C-A *
13470513-C-T 11314837-C-T *
13470514-A-G 11314838-A-G *
13470547-C-G 11314871-C-G *
13470575-A-T 11314899-A-T *
13472744-G-T 11317068-G-T *
13472752-C-A 11317076-C-A *
13478429-C-A 11322753-C-A *
13482231-G-C 11326555-G-C *
13489238-G-C 11333562-G-C *
13489249-T-TA 11333573-T-TA *
13489251-C-A 11333575-C-A *
13489685-C-A 11334009-C-A *
13489938-T-G 11334262-T-G *
22509037-C-T 20347151-C-T DYZ19 *
22510054-G-A 20348168-G-A DYZ19 *
21753670-A-AT *
28795154-T-A 26649007-T-A *
28795161-G-A 26649014-G-A *
28795162-C-T 26649015-C-T *
28795194-TCAAATGGAATG-T 26649047-TCAAATGGAATG-T *
56676514-A-C *
56731724-T-C,G *
56734060-G-T *
56734061-G-T *
56829760-C-CCATCT *
56830986-C-CTA *
56830987-C-CTCT *
56834078-A-ACTG *
56836153-T-TTCCGC *
56884423-T-TAATATATATATATATATATATATATA *
9946235-TC-T 10108626-TC-T *
9992568-TTC-T 10154959-TTC-T *
9992572-C-T 10154963-C-T Y*
9992575-A-ATG 10154966-A-ATG *
9994853-TATAA-AATAA,T 10157244-TATAA-AATAA,T *
9994892-TA-T,TAA 10157283-TA-T,TAA *
10070067-A-AGC 10232458-A-AGC *
10070068-ATT-A 10232459-ATT-A *
13450790-TGG-CGG,T 11295114-TGG-CGG,T *
13472739-T-A 11317063-T-A *
13474757-T-C 11319081-T-C *
13478485-C-T 11322809-C-T *
13478522-G-A 11322846-G-A *
13479059-A-T 11323383-A-T *
13480876-G-T 11325200-G-T *
13487833-T-A 11332157-T-A *
13489407-G-C 11333731-G-C *
21757208-G-C *
21757212-T-A *
28805796-C-T,T 26659649-C-T,T *
56829850-CCA-C *
56838241-C-T *
56844998-CCACGCG-C *
2786276-T-C 2918235-T-C Y*
2786278-G-A 2918237-G-A Y*
9936522-G-C 10098913-G-C Y*
9936525-A-AG 10098916-A-AG *
13287958-T-TATA 11132282-T-TATA *
13466605-T-A 11310929-T-A *
13466606-C-A 11310930-C-A *
13476594-T-C 11320918-T-C *
13476599-A-T 11320923-A-T *
13476763-T-A 11321087-T-A *
13476765-C-A 11321089-C-A *
13476783-A-C 11321107-A-C *
13481074-T-A 11325398-T-A *
13481092-T-A 11325416-T-A *
13482293-AC-A 11326617-AC-A *
56829190-A-ACTCCATTCCATTCCCTTCTTTTCCATTCCATTCCT *
56834769-G-GTATTCCATTCCAGTCCATTCCATTACATTCCA *
56834771-T-TCCACTCCA *
56836576-C-CTACTCGACTTCACTG *
56836585-T-TCCGC *
56874786-C-CTTTTTTTTTTTT 11×T*
5308801-G-T,T 5440760-G-T,T *
9952731-A-T 10115122-A-T Y*
9952733-C-T 10115124-C-T Y*
13476733-C-A 11321057-C-A *
13476856-T-A 11321180-T-A *
13712867-G-A 11557191-G-A *
15866816-A-ATTGCCCCTTATATTTGACATAATTGATAACGGATTTGATAACCAGAATATTATTCTTTTC 13754936-A-ATTGCCCCTTATATTTGACATAATTGATAACGGATTTGATAACCAGAATATTATTCTTTTC *
15866819-C-CGG 13754939-C-CGG *
15866822-G-GCTAAA 13754942-G-GCTAAA *
15866824-C-CCCCT 13754944-C-CCCCT *
56721267-T-G *
56832860-ATTCCATTCCACTCTATTCCACTCCACTCAACTCAATTCCACTCCCCTCCACTCCACTCCATTCCACTCCATTCCACTCCCCTCCCCTCCATTGCATTCCC-A *
56833823-A-ATCATT *
56833829-C-G *
56833885-C-G *
56833891-AC-A *
56833893-GCCAT-G,TCCAT *
56833957-C-CACCAA *
56833958-T-TCCTCC *
56862918-G-C *
56871655-A-ATAT *
13452064-G-GCCCCA 11296388-G-GCCCCA *
13688532-C-T 11532856-C-T BY88495 *
56678030-G-A,A *
56832357-C-CTCCCCTCCAA *
56835865-G-A,C *
10081993-C-A 10244384-C-A *
13476859-CTG-C 11321183-CTG-C *
13476863-T-TCG 11321187-T-TCG *
13476870-C-G 11321194-C-G *
13484089-T-G 11328413-T-G *
56838244-A-C *
56848976-A-G,T *
13487906-G-C,T 11332230-G-C,T *
13869537-ATGGAATTGACTTGAATGGTATGGACTGGAGTGG-A 11748831-ATGGAATTGACTTGAATGGTATGGACTGGAGTGG-A *
56833843-CCCACT-C,CTATTCCACT 4×CCACT*
56834810-T-TTCCATTCCATTCCATTCCATTCCATTCCATTCCATTCCATTCCACGCC *
56835940-A-ACTCCACTCAATTCCACTCCACGCAATTCCACTCCACTCAATTCCACTCCACTCTG *
56850366-C-CCGATCACTCAGGTGATGTAACTATTGTCTTGGCTCTGCTTAAAGGGACCTTGTCATATACCTCTGCAA *
13480981-A-C 11325305-A-C *
13480983-C-G 11325307-C-G *
10624483-T-TA *
10624485-G-T *
13474753-C-T 11319077-C-T *
13470482-G-A 11314806-G-A *
13478455-G-C 11322779-G-C *
13687698-A-ACC 11532022-A-ACC *
56827914-C-CAATCCATTCCATTCCATTCCATTAAATTCG *
56836578-A-ACTCCG *
9946136-G-T 10108527-G-T Y*
9946140-T-C 10108531-T-C Y*
9983986-CACCAGTGGCTCATGGCTCACTCCCTCCCTTGCAAACCAGCAGCTCACGGCCTGCTCCCTCCCCTGCAT-C 10146377-CACCAGTGGCTCATGGCTCACTCCCTCCCTTGCAAACCAGCAGCTCACGGCCTGCTCCCTCCCCTGCAT-C *
56835847-C-CCACTCCATTCCACT *
9964551-C-A,G 10126942-C-A,G *
13486322-A-G 11330646-A-G *
13467440-G-T 11311764-G-T *
13467441-C-A 11311765-C-A *
13467468-G-C 11311792-G-C *
13451308-A-G,G 11295632-A-G,G *
13465105-T-C 11309429-T-C *
13465147-A-G 11309471-A-G *
13465164-G-A 11309488-G-A *
13474374-C-A 11318698-C-A *
13474424-T-C 11318748-T-C *
56860676-A-ACACAC *
9221660-CATAT-C,CAT 9384051-CATAT-C,CAT 27×AT*
9946142-AAT-A 10108533-AAT-A *
9946147-A-C 10108538-A-C Y*
9964215-A-G,T 10126606-A-G,T *
9980754-AGGAAGGAAGGGGACAAAGAAAGAG-A 10143145-AGGAAGGAAGGGGACAAAGAAAGAG-A *
9980795-T-C 10143186-T-C Y*
10693311-A-C *
13390479-G-A 11234803-G-A *
13390483-T-G 11234807-T-G *
13428237-G-A 11272561-G-A *
13448640-ATTCCATTCCATTCCATTCCATTCCATTCCATTCCAT-A 11292964-ATTCCATTCCATTCCATTCCATTCCATTCCATTCCAT-A *
13461879-C-T 11306203-C-T *
13462074-C-G 11306398-C-G *
13462094-G-T 11306418-G-T *
13462096-G-C 11306420-G-C *
13466538-C-T 11310862-C-T *
13469382-C-T 11313706-C-T *
13469748-G-T 11314072-G-T *
13469749-C-T 11314073-C-T *
13469773-A-C 11314097-A-C *
13474380-G-C 11318704-G-C *
13476137-A-G 11320461-A-G *
13476192-A-G 11320516-A-G *
13476198-C-T 11320522-C-T *
13478286-G-T 11322610-G-T *
13478301-G-C 11322625-G-C *
13478338-G-C 11322662-G-C *
13478339-G-A 11322663-G-A *
13478463-C-G 11322787-C-G *
13482742-C-T 11327066-C-T *
13482753-G-A 11327077-G-A *
13486498-G-A 11330822-G-A *
13487944-G-A 11332268-G-A *
13487953-C-T 11332277-C-T BY86192 *
13487972-G-A 11332296-G-A *
13489366-C-A 11333690-C-A *
13489854-C-G 11334178-C-G *
13489855-C-A 11334179-C-A *
13489860-G-A 11334184-G-A *
13591179-A-G,T 11435503-A-G,T *
13591861-T-C 11436185-T-C *
13591865-C-T 11436189-C-T FT127720 *
13641025-A-T 11485349-A-T *
13692889-G-A 11537213-G-A *
13692963-T-TGGAAA 11537287-T-TGGAAA *
13692974-G-GAACTC 11537298-G-GAACTC *
13730459-T-A,G 11574783-T-A,G *
14172757-A-ACAAATCATGCTAATTAAAATAATCATCACTTCACATATTTGT 12052051-A-ACAAATCATGCTAATTAAAATAATCATCACTTCACATATTTGT *
15866827-T-TTGGAGCAGTTGCGAAACACGTTGGCGCGAGAGTCC 13754947-T-TTGGAGCAGTTGCGAAACACGTTGGCGCGAGAGTCC *
16642970-G-GAAATAAT 14531090-G-GAAATAAT *
16750324-C-CGTATGTACTTTGATTTCTGTAACTATCCTGGTTATGATAAGCTCCGATATGAACCGTTTGATCCTAAGATTCCTAGTGAATTAGTTGATCATGAAGGTGATAGCT 14638444-C-CGTATGTACTTTGATTTCTGTAACTATCCTGGTTATGATAAGCTCCGATATGAACCGTTTGATCCTAAGATTCCTAGTGAATTAGTTGATCATGAAGGTGATAGCT *
21595355-A-AGTATTTAGCTCTACCCCAACGTGGTTTACTACAGTTTCAACTACTTGGTCTAAGGTATGTGTCAATTGTTTTTGATTTACATCATGTTGATATTGACCTACGCCGATAGATTTAGGATCGATT 19433469-A-AGTATTTAGCTCTACCCCAACGTGGTTTACTACAGTTTCAACTACTTGGTCTAAGGTATGTGTCAATTGTTTTTGATTTACATCATGTTGATATTGACCTACGCCGATAGATTTAGGATCGATT *
22238377-A-AT 20076491-A-AT DYZ19 *
22238379-CTGCCAGAAGGAAGAAACTCTGAACACATCTGAAGGAACAAACTCTGGACATAACACCTTTAAGTGCTATGACACTCACCGTAAAGTTCTGCAGCTTCATTCTTGAAGTGTGCAAGACCATGAA-C 20076493-CTGCCAGAAGGAAGAAACTCTGAACACATCTGAAGGAACAAACTCTGGACATAACACCTTTAAGTGCTATGACACTCACCGTAAAGTTCTGCAGCTTCATTCTTGAAGTGTGCAAGACCATGAA-C DYZ19 *
22440116-C-T 20278230-C-T DYZ19 *
22465103-G-C 20303217-G-C DYZ19 *
22509479-G-GTGTCCAGTGTTTCTTCCTTCTGACAGGTTCATGGTGTTGCTCACTTCAAGAATGAAGCTGCCGACCTTACTGGTGAGTGTCACAGCACTTAAAGGTATTATGTGCAGAGTTTGTTCCTTCAGAAT 20347593-G-GTGTCCAGTGTTTCTTCCTTCTGACAGGTTCATGGTGTTGCTCACTTCAAGAATGAAGCTGCCGACCTTACTGGTGAGTGTCACAGCACTTAAAGGTATTATGTGCAGAGTTTGTTCCTTCAGAAT DYZ19 *
22510456-G-T 20348570-G-T DYZ19 *
22859921-G-GTGTTCTGGATTTATCAAGACCAGACAAACAGCTTAGATGTCCTTGAAGATAAGTATAATGTCCACTATTGGAATGATTGGGAAGTTGAAGACGTGCCTGCTAATAATGGGGACAAGC 20698035-G-GTGTTCTGGATTTATCAAGACCAGACAAACAGCTTAGATGTCCTTGAAGATAAGTATAATGTCCACTATTGGAATGATTGGGAAGTTGAAGACGTGCCTGCTAATAATGGGGACAAGC *
23723544-CATAT-C,CATATAT 21561658-CATAT-C,CATATAT 27×AT*
24475903-T-TAGGTAAACCG 22329756-T-TAGGTAAACCG *
24475904-CT-C 22329757-CT-C *
24475908-C-CTAGCATCCCTTGTTACGGCAGGGAATCT 22329761-C-CTAGCATCCCTTGTTACGGCAGGGAATCT *
24475911-A-ACTCAATGCTCAATAAATT 22329764-A-ACTCAATGCTCAATAAATT *
24475915-G-GGCAGCAAAGAAAA 22329768-G-GGCAGCAAAGAAAA *
24475917-T-TCGTCGTCAAG 22329770-T-TCGTCGTCAAG *
24475919-T-TG 22329772-T-TG *
25720386-A-ACAGTCT 23574239-A-ACAGTCT P1_b3 *
25720389-A-AATTGCTCAAATTGCTATCTTCTTTGCCATTATGTTGGTACTGCATCTGCTTAGCTCAGTGATTTTCAACCTTCTGCCAGTACCAATTAAAC 23574242-A-AATTGCTCAAATTGCTATCTTCTTTGCCATTATGTTGGTACTGCATCTGCTTAGCTCAGTGATTTTCAACCTTCTGCCAGTACCAATTAAAC P1_b3 *
56824113-G-T *
56831448-CCAT-C *
56831454-C-T *
56831458-C-T *
56831465-ACTCCT-A *
56831585-CCATTCCATTGCATTCCAT-C *
56832539-C-CTCCAATCCATTCCAT,CTCCACTCCATTCCATTCCATTCCAT *
56833327-A-ATT *
56833328-C-CCAGTCCAT *
56833501-TCCAC-T *
56833506-TA-T *
56834380-T-TTCCATTCCATTCCAC,TTCCATTTCATTCCAC *
56834798-T-TCCATTCCATTCCATTCCACG *
56835220-A-ATT *
56836564-C-CCAGA *
56836586-T-TC *
56850358-T-TCTCTGCACCGATCACTCAGGTGATGTAACTATTGTCTTGGCTCTGCTTAAAGGGGCTTTGTCATATAC *
56866866-C-CAA *
56871631-A-ATATATATATATATATGT 10×AT*
56878253-G-GCA,GCACACACACA 9×CA*
13699355-C-A 11543679-C-A **
22366844-G-C 20204958-G-C DYZ19 **
58854217-C-G 56736654-G-C **
10791163-G-T **
28802604-G-C 26656457-G-C **
10686520-C-CCACTCCACTCCATTCCACTCCATTG **
24420879-A-AT 22274732-A-AT 43×T**
19113723-T-TAAA 17001843-T-TAAA 28×A**
4650472-G-GAT 4782431-G-GAT 24×AT**
10791165-C-A FTA21671 **
10791172-A-T **
10791155-G-C **
10791174-T-A **
22480677-TGTTG-T 20318791-TGTTG-T DYZ19 **
28802597-T-A 26656450-T-A **
13730110-G-GAAT 11574434-G-GAAT **
13730111-G-GGAATGGA 11574435-G-GGAATGGA **
10525601-A-T FT89951 **
10525608-T-A FT89952 **
10791160-C-T **
10791168-T-A **
13699365-G-C 11543689-G-C **
13699392-A-ATC 11543716-A-ATC **
13744351-C-G 11588675-C-G **
22261017-TTTACGGTGAGTGTTACAGCACTTAAAAGTGTTATGTCCAGAGCTTTTTTCCTTCAGATGTGTCCAGAGTTTCTTCCTTCTGGCAGGTTCATGGTCTTGCTCACTTCAAAAATGAAACTGCAGACGA-T 20099131-TTTACGGTGAGTGTTACAGCACTTAAAAGTGTTATGTCCAGAGCTTTTTTCCTTCAGATGTGTCCAGAGTTTCTTCCTTCTGGCAGGTTCATGGTCTTGCTCACTTCAAAAATGAAACTGCAGACGA-T DYZ19 **
22440118-C-T 20278232-C-T BY32328 FGC78051 DYZ19 ***
9215342-T-G 9377733-T-G ***
9974216-T-G 10136607-T-G ***
58844546-T-C 56746325-A-G FGC44146 FGC77541 ***
13469851-G-C 11314175-G-C ***
13469853-AG-A 11314177-AG-A ***
28808685-A-G 26662538-A-G ***
58981936-T-C 56835789-T-C ***
58981950-C-A 56835803-C-A ***
22485031-G-C 20323145-G-C BY2879 DYZ19 ***
13474129-T-C 11318453-T-C ***
13474133-AT-A 11318457-AT-A ***
13474136-C-G 11318460-C-G ***
28808785-A-G 26662638-A-G PF1352 ***
9958256-G-A 10120647-G-A ***
13469902-C-A 11314226-C-A ***
28588105-A-T 26441958-A-T ***
28814748-T-C 26668601-T-C ***
13710486-G-A 11554810-G-A ***
22229188-A-C 20067302-A-C BY23224 DYZ19 ***
22229193-T-A 20067307-T-A BY23226 DYZ19 ***
22229194-A-G 20067308-A-G BY23227 DYZ19 ***
13466206-G-A 11310530-G-A ***
58858901-C-G 56731970-G-C ***
58980228-G-GCACTCCACTC 56834081-G-GCACTCCACTC ***
13730124-C-G 11574448-C-G ***
13811151-A-G 11690445-A-G ***
13470655-G-A 11314979-G-A ***
22444316-A-G 20282430-A-G DYZ19 ***
22444318-T-A 20282432-T-A DYZ19 ***
13469904-G-T 11314228-G-T ***
58843030-GATTCCATTCCATTCT-G 56747815-AGGAATGGAATAGAAT-A ***
13739907-A-G 11584231-A-G ***
9963199-A-G 10125590-A-G ***
9992791-T-C 10155182-T-C ***
13253161-G-A 11097485-G-A ***
13253192-C-T 11097516-C-T ***
13473737-A-C 11318061-A-C ***
13487966-G-C 11332290-G-C ***
58877030-A-G 56713841-T-C ***
13353859-C-T 11198183-C-T ***
10022318-A-AAATAAATG 10184709-A-AAATAAATG ***
13436306-A-T 11280630-A-T ***
13713598-G-A 11557922-G-A BY156303 ***
13465321-C-A 11309645-C-A ***
28808679-C-G 26662532-C-G ***
28808683-T-C 26662536-T-C ***
58881608-C-A 56709263-G-T ***
58906804-C-G 56684067-G-C ***
22477936-AG-A 20316050-AG-A DYZ19 ***
9996870-AG-A 10159261-AG-A ***
9996872-A-C 10159263-A-C ***
58982301-T-C 56836154-T-C ***
58854376-C-A 56736495-G-T 4×CCATT***
13526417-G-T 11370741-G-T ***
13485845-A-T 11330169-A-T ***
13478257-G-GCAC 11322581-G-GCAC ***
13427838-A-G 11272162-A-G ***
9944244-T-C 10106635-T-C ***
9964094-C-T 10126485-C-T FT426636 ***
28586490-G-T 26440343-G-T ***
13467450-G-T 11311774-G-T ***
13480079-A-T 11324403-A-T ***
2786264-G-A 2918223-G-A ***
58830402-T-C 56760469-A-G ***
13699046-G-A 11543370-G-A ***
13467385-T-A 11311709-T-A ***
13465386-G-C 11309710-G-C ***
13704602-TCA-T 11548926-TCA-T ***
9983930-T-A 10146321-T-A ***
10026645-A-G 10189036-A-G A3312 ***
3096866-TTTTTA-T 3228825-TTTTTA-T ***
3110420-T-C 3242379-T-C ***
3110448-C-A 3242407-C-A ***
3201688-A-G 3333647-A-G ***
3257945-C-G 3389904-C-G ***
3387992-C-T 3519951-C-T ***
3507002-A-C 3638961-A-C ***
3709722-C-T 3841681-C-T ***
3727085-C-G 3859044-C-G ***
3790951-T-C 3922910-T-C ***
3790952-G-A 3922911-G-A ***
3861383-C-T 3993342-C-T ***
4416473-A-T 4548432-A-T ***
4431531-A-G 4563490-A-G ***
9944642-G-A 10107033-G-A ***
9995947-T-C 10158338-T-C ***
9995971-T-C 10158362-T-C ***
10022560-T-C 10184951-T-C ***
10042288-A-T 10204679-A-T ***
10054486-A-G 10216877-A-G ***
13287080-T-C 11131404-T-C ***
13287081-G-A 11131405-G-A ***
13297914-A-C 11142238-A-C ***
13308277-A-C 11152601-A-C ***
13362309-G-A 11206633-G-A ***
13362514-C-A 11206838-C-A 11×A***
13373903-A-C 11218227-A-C ***
13374125-G-C 11218449-G-C ***
13390397-C-T 11234721-C-T ***
13390815-A-G 11235139-A-G ***
13440146-C-T 11284470-C-T ***
13469455-G-A 11313779-G-A ***
13515650-AG-A 11359974-AG-A ***
13516928-T-C 11361252-T-C ***
13524548-T-G 11368872-T-G ***
13524938-A-G 11369262-A-G ***
13554812-C-T 11399136-C-T ***
13622243-TA-T 11466567-TA-T ***
13622526-C-T 11466850-C-T ***
13640469-C-T 11484793-C-T ***
13743966-C-T 11588290-C-T ***
14443507-T-C 12322780-T-C CTS2714 ***
14443707-A-G 12322980-A-G CTS2716 ***
14443713-A-T 12322986-A-T CTS2717 ***
16642612-G-C 14530732-G-C ***
23100301-C-T 20938415-C-T ***
23100309-G-A 20938423-G-A ***
28813484-A-G 26667337-A-G ***
59017800-AGAGG-A 56871653-AGAGG-A ***
59033650-G-T 56887503-G-T ***
22359973-G-A 20198087-G-A DYZ19 ***
9983966-G-A 10146357-G-A ***
13363400-G-C 11207724-G-C ***
13488775-C-G 11333099-C-G ***
58870110-C-A 56720761-G-T ***
58847882-C-T 56742989-G-A ***
58914329-A-T 56676542-T-A ***
13730448-C-G 11574772-C-G ***
58859096-G-C 56731775-C-G ***
13709316-G-C 11553640-G-C ***
22298291-A-G 20136405-A-G DYZ19 ***
13404412-A-G 11248736-A-G ***
13467357-G-A 11311681-G-A ***
22288235-G-A 20126349-G-A DYZ19 ***
9962084-C-G 10124475-C-G ***
6403070-T-C 6535029-T-C ***
9944624-G-A 10107015-G-A ***
9964884-G-T 10127275-G-T ***
9983976-C-A 10146367-C-A ***
10026685-G-A 10189076-G-A ***
10026730-G-A 10189121-G-A FT376502 ***
10042291-G-C 10204682-G-C ***
13135620-G-A 10625106-G-A ***
13136703-G-A 10626189-G-A ***
13253212-T-C 11097536-T-C ***
13276411-C-T 11120735-C-T ***
13307024-A-T 11151348-A-T ***
13398353-C-A 11242677-C-A ***
13400099-G-A 11244423-G-A ***
13433607-A-T 11277931-A-T ***
13439417-T-C 11283741-T-C ***
13494512-T-A 11338836-T-A ***
13692732-C-T 11537056-C-T ***
13692829-G-A 11537153-G-A BY211037 ***
13694690-T-A 11539014-T-A BY48796 ***
13695165-T-TGGAATGGAATCGAAA 11539489-T-TGGAATGGAATCGAAA ***
13718736-T-C 11563060-T-C ***
13722664-A-C 11566988-A-C ***
14442931-T-C 12322204-T-C CTS2713 ***
14443519-T-C 12322792-T-C CTS2715 ***
22476562-G-A 20314676-G-A DYZ19 ***
22507990-T-A 20346104-T-A DYZ19 ***
22508571-A-T 20346685-A-T BY46401 DYZ19 ***
22510013-G-A 20348127-G-A BY225599 DYZ19 ***
28582492-A-G 26436345-A-G FTB18381 ***
28794310-A-T 26648163-A-T ***
28814769-CG-C 26668622-CG-C ***
28814785-A-T 26668638-A-T ***
58866756-C-T 56724115-G-A ***
58881606-C-A 56709265-G-T ***
58881607-C-G 56709264-G-C ***
58980708-TCCATTCCATTCCAC-T 56834561-TCCATTCCATTCCAC-T ***
58994390-G-T 56848243-G-T ***
59013931-C-G 56867784-C-G ***
59018408-T-A 56872261-T-A ***
59019562-G-A 56873415-G-A ***
59029428-G-A 56883281-G-A ***
59029638-G-A 56883491-G-A ***
9940541-T-A 10102932-T-A ***
9940577-G-GTA 10102968-G-GTA ***
9940586-TAA-T 10102977-TAA-T ***
22279914-G-T 20118028-G-T DYZ19 ***
13744305-T-C 11588629-T-C ***
9909159-A-G 10071550-A-G ***
58855789-A-T 56735082-T-A ***
58869371-G-C 56721500-C-G ***
9974158-G-C 10136549-G-C ***
58912456-T-A 56678415-A-T ***
22477956-A-C 20316070-A-C BY25214 DYZ19 ***
22477957-A-C 20316071-A-C BY25215 DYZ19 ***
16642879-T-A 14530999-T-A ***
16642880-A-G 14531000-A-G ***
16642884-A-C 14531004-A-C ***
16642886-G-A 14531006-G-A ***
16642890-T-G 14531010-T-G ***
16642893-G-A 14531013-G-A ***
13463234-C-T 11307558-C-T ***
22298483-G-T 20136597-G-T DYZ19 ***
13488292-C-T 11332616-C-T ***
13253199-GTT-G 11097523-GTT-G 14×T***
13433252-C-A 11277576-C-A ***
9909109-C-A 10071500-C-A ***
13332210-C-G 11176534-C-G ***
10068267-T-C 10230658-T-C ***
58881619-T-C 56709252-A-G ***
22642122-T-A 20480236-T-A ***
58869411-C-A 56721460-G-T ***
58869425-C-G 56721446-G-C ***
13711744-GAATGGAACGGAATGGAATTAAATGGAACGGAATGGAATGGCATGGAATGGAATGGCATGGCATGGAATGGAATGGAATGGAATGGAATGA-G 11556068-GAATGGAACGGAATGGAATTAAATGGAACGGAATGGAATGGCATGGAATGGAATGGCATGGCATGGAATGGAATGGAATGGAATGGAATGA-G ***
28819096-T-A 26672949-T-A ***
10043014-G-T 10205405-G-T ***
9946318-G-T 10108709-G-T ***
13470627-C-G 11314951-C-G ***
22467206-T-G 20305320-T-G DYZ19 ***
9226878-C-T 9389269-C-T ***
58859307-C-T 56731564-G-A ***
58872680-C-G 56718191-G-C ***
13466460-A-T 11310784-A-T ***
13482663-G-C 11326987-G-C ***
13390782-C-A 11235106-C-A ***
13390788-T-C 11235112-T-C ***
13473767-T-C 11318091-T-C ***
13711679-G-A 11556003-G-A BY211266 ***
58893863-T-C 56697008-A-G ***
58893894-G-C 56696977-C-G 4×CATTC***
13484124-C-G 11328448-C-G ***
13468404-G-T 11312728-G-T ***
13450000-CTCCACTCCACTCCCG-C 11294324-CTCCACTCCACTCCCG-C ***
13721186-CGAATG-C 11565510-CGAATG-C 5×GAATG***
13748250-T-A 11592574-T-A ***
13748255-T-A 11592579-T-A ***
13469764-A-T 11314088-A-T ***
58914107-C-G 56676764-G-C ***
58855194-A-G 56735677-T-C ***
58862663-C-G 56728208-G-C ***
13475381-C-A 11319705-C-A ***
13475395-C-T 11319719-C-T BY85949 ***
13471870-G-A 11316194-G-A ***
9198800-G-T 9361191-G-T ***
13489849-G-T 11334173-G-T ***
58868869-G-C 56722002-C-G ***
58854902-G-A 56735969-C-T ***
58859101-C-T 56731770-G-A ***
13701724-G-C 11546048-G-C ***
22506513-G-T 20344627-G-T DYZ19 ***
21575567-C-T 19413681-C-T ***
21575573-T-G 19413687-T-G ***
13476913-A-C 11321237-A-C ***
22298474-A-T 20136588-A-T A4068 DYZ19 ***
22508036-G-T 20346150-G-T DYZ19 ***
58844833-T-C 56746038-A-G ***
13478260-T-TCCC 11322584-T-TCCC ***
14443637-G-A 12322910-G-A ***
13347750-A-C 11192074-A-C ***
58829308-C-G 56761563-G-C ***
58914140-T-G 56676731-A-C ***
58885032-A-G 56705839-T-C ***
58866199-A-C 56724672-T-G ***
58819868-A-G 56771003-T-C ***
22298494-G-T 20136608-G-T DYZ19 ***
58844636-C-A 56746235-G-T ***
22510448-G-T 20348562-G-T DYZ19 ***
9188703-A-C 9351094-A-C ***
9909137-C-T 10071528-C-T ***
59022943-G-C 56876796-G-C ***
13433281-C-CT 11277605-C-CT ***
13433300-C-T 11277624-C-T ***
13480691-A-G 11325015-A-G ***
13484242-A-C 11328566-A-C ***
10022219-A-G 10184610-A-G ***
13465414-T-A 11309738-T-A ***
13465389-C-G 11309713-C-G ***
22298450-T-C 20136564-T-C A4067 DYZ19 ***
22298454-G-C 20136568-G-C DYZ19 ***
58893731-T-C 56697140-A-G ***
13483965-C-G 11328289-C-G ***
13516632-C-T 11360956-C-T ***
13516633-T-G 11360957-T-G ***
13688193-A-AATGGAATGGAATGGAATGGC 11532517-A-AATGGAATGGAATGGAATGGC ***
13486615-T-A 11330939-T-A ***
13486598-G-A 11330922-G-A ***
13448841-T-G 11293165-T-G ***
13486559-A-T 11330883-A-T ***
28814583-T-A 26668436-T-A ***
58857626-C-T 56733245-G-A ***
22229191-T-C 20067305-T-C BY23225 DYZ19 ***
22229201-A-G 20067315-A-G BY23228 DYZ19 ***
28586459-A-T 26440312-A-T FGC72148 ***
13254491-C-T 11098815-C-T ***
13688984-T-A 11533308-T-A ***
13721237-G-T 11565561-G-T ***
22510212-A-C 20348326-A-C DYZ19 ***
58894620-C-A 56696251-G-T ***
58842941-ATTCCT-A 56747920-TGGAAA-T ***
58910397-C-G 56680474-G-C ***
13719788-A-G 11564112-A-G ***
10988659-C-A ***
10988666-A-G ***
13489416-G-T 11333740-G-T ***
56835216-G-T ***
58912457-C-A 56678414-G-T ***
13487808-C-T 11332132-C-T ***
13712635-A-C 11556959-A-C ***
13460384-G-T 11304708-G-T ***
13480909-CT-C 11325233-CT-C ***
13448846-TTCCACTACAG-T 11293170-TTCCACTACAG-T ***
13721325-T-C 11565649-T-C ***
13721329-A-T 11565653-A-T ***
13478261-GGCA-G 11322585-GGCA-G ***
13720611-G-A 11564935-G-A ***
13461887-G-C 11306211-G-C ***
10994363-A-T ***
13433361-G-A 11277685-G-A ***
10994353-T-A ***
10651656-G-C ***
10651672-C-A ***
10651645-G-T ***
10651648-G-A ***
13489631-A-AT 11333955-A-AT ***
13489346-G-T 11333670-G-T ***
13486406-C-A 11330730-C-A ***
56830680-CATTCCACTCT-C ***
9966108-G-A 10128499-G-A ***
13483715-C-A 11328039-C-A ***
9943708-C-A 10106099-C-A ***
10688063-T-G ***
10791220-C-A ***
13466109-C-A 11310433-C-A ***
9941592-T-C 10103983-T-C ***
10668343-T-TCAA ***
10791180-G-C ***
13475445-A-C 11319769-A-C ***
9956726-G-A 10119117-G-A ***
9956746-C-T 10119137-C-T ***
9956752-T-C 10119143-T-C ***
9956761-T-A 10119152-T-A ***
13463871-G-T 11308195-G-T ***
13468293-G-T 11312617-G-T ***
13466389-G-T 11310713-G-T ***
56761521-T-A ***
56860285-G-A ***
56860291-C-T ***
13480088-C-A 11324412-C-A ***
10807321-A-G ***
13465371-A-G 11309695-A-G ***
10994348-A-G ***
13476458-T-G 11320782-T-G ***
13488922-G-C 11333246-G-C ***
13374084-C-G 11218408-C-G ***
9909135-G-T 10071526-G-T ***
13748275-A-T 11592599-A-T ***
10625044-T-G ***
13458072-A-T 11302396-A-T ***
13466447-G-A 11310771-G-A ***
10807324-T-G ***
10678024-T-TCCACTCCAC ***
13460674-A-G 11304998-A-G ***
9931339-T-A 10093730-T-A ***
13474526-G-T 11318850-G-T ***
13483395-A-T 11327719-A-T ***
13497529-A-T 11341853-A-T ***
13721345-T-A 11565669-T-A ***
14443624-C-T 12322897-C-T ***
13428228-A-G 11272552-A-G ***
58857613-A-G 56733258-T-C ***
13689288-C-A 11533612-C-A ***
13705675-C-A 11549999-C-A ***
22511229-G-C 20349343-G-C DYZ19 ***
13496234-A-C 11340558-A-C ***
13730401-A-T 11574725-A-T ***
22510127-G-A 20348241-G-A FT460741 DYZ19 ***
10677533-C-T ***
13398319-C-A 11242643-C-A ***
13690464-G-C 11534788-G-C BY48173 ***
13489783-C-A 11334107-C-A ***
13710557-G-A 11554881-G-A ***
13719245-G-T 11563569-G-T ***
13478156-C-A 11322480-C-A ***
13480861-G-A 11325185-G-A ***
13466253-T-A 11310577-T-A ***
13720429-G-T 11564753-G-T ***
28805807-G-A 26659660-G-A ***
13723525-T-A 11567849-T-A ***
13489777-C-G 11334101-C-G ***
13392768-CAA-C 11237092-CAA-C 11×A***
58891275-C-A 56699596-G-T ***
13460518-C-T 11304842-C-T ***
13466328-T-C 11310652-T-C ***
10791198-T-C ***
13478176-G-C 11322500-G-C ***
13708683-T-A 11553007-T-A ***
56850172-G-A ***
13480903-T-A 11325227-T-A ***
13473721-C-A 11318045-C-A ***
13734604-T-A 11578928-T-A ***
13707409-A-T 11551733-A-T ***
13478133-A-C 11322457-A-C ***
10690890-C-T FT429213 ***
13354869-A-AC 11199193-A-AC ***
13705347-A-T 11549671-A-T ***
13489788-C-T 11334112-C-T ***
14443634-C-T 12322907-C-T ***
14443676-T-C 12322949-T-C ***
14443679-C-T 12322952-C-T ***
14443691-A-G 12322964-A-G ***
22510171-T-A 20348285-T-A DYZ19 ***
10026654-C-A 10189045-C-A ***
13489830-C-G 11334154-C-G ***
13463684-G-A 11308008-G-A FT443966 ***
13485346-C-A 11329670-C-A ***
10859640-C-A ***
13473818-G-C 11318142-G-C ***
13474761-C-A 11319085-C-A ***
56826133-G-A ***
13480916-C-A 11325240-C-A ***
13491690-C-A 11336014-C-A ***
13704869-A-C 11549193-A-C ***
13485378-A-G 11329702-A-G ***
58905453-G-T 56685418-C-A ***
21575282-G-C 19413396-G-C ***
13480769-C-A 11325093-C-A ***
13489355-G-T 11333679-G-T ***
13489435-C-A 11333759-C-A ***
13298038-T-C 11142362-T-C ***
10801566-CTATAA-C ***
13433349-C-T 11277673-C-T ***
13462016-C-T 11306340-C-T ***
28806296-A-G 26660149-A-G ***
28811038-C-G 26664891-C-G ***
13489386-G-T 11333710-G-T ***
13480776-T-A 11325100-T-A ***
10791181-T-A ***
13478242-C-T 11322566-C-T ***
28811020-A-T 26664873-A-T ***
28811021-A-G 26664874-A-G ***
13476585-G-A 11320909-G-A ***
13462036-G-C 11306360-G-C ***
13480430-C-A 11324754-C-A ***
13462070-G-T 11306394-G-T ***
13463244-C-T 11307568-C-T ***
13475469-C-G 11319793-C-G ***
13475470-T-G 11319794-T-G ***
10807278-AC-A ***
13486522-C-T 11330846-C-T ***
22361551-G-T 20199665-G-T DYZ19 ***
10807276-C-CCG ***
10807300-A-AT ***
13474428-G-T 11318752-G-T ***
13465409-C-T 11309733-C-T ***
13701901-G-A 11546225-G-A ***
13701902-T-A 11546226-T-A ***
13462086-C-T 11306410-C-T ***
28241-G-T ***
13480805-C-G 11325129-C-G ***
9963156-C-G 10125547-C-G ***
13493105-T-C 11337429-T-C ***
13704614-G-T 11548938-G-T ***
13264601-GA-G 11108925-GA-G ***
13463917-GAA-G 11308241-GAA-G ***
13463922-C-CTT 11308246-C-CTT ***
13489256-C-CGT 11333580-C-CGT ***
58979479-ATTC-A 56833332-ATTC-A ***
58979499-AC-A 56833352-AC-A ***
13470499-C-T 11314823-C-T ***
13470500-A-G 11314824-A-G ***
13473888-A-T 11318212-A-T ***
10677538-C-T ***
12372603-T-A FTB17414 ***
13470642-C-A 11314966-C-A ***
9945008-C-A 10107399-C-A ***
9945022-T-C 10107413-T-C ***
10054162-G-A 10216553-G-A ***
10054483-G-C 10216874-G-C ***
10068269-T-C 10230660-T-C ***
10068275-A-T 10230666-A-T ***
10068280-A-T 10230671-A-T ***
10068284-C-T 10230675-C-T ***
10787651-A-G ***
13347718-C-A 11192042-C-A ***
13347800-A-G 11192124-A-G ***
13408469-G-T 11252793-G-T ***
13408496-A-G 11252820-A-G ***
13408497-T-C 11252821-T-C ***
13427928-C-T 11272252-C-T ***
13466831-C-A 11311155-C-A ***
13473682-G-C 11318006-G-C ***
13473708-C-A 11318032-C-A ***
13473717-G-C 11318041-G-C ***
13480155-C-G 11324479-C-G ***
13508454-A-G 11352778-A-G ***
13514707-G-T 11359031-G-T ***
13519185-C-A 11363509-C-A ***
13532685-A-G 11377009-A-G ***
13540422-T-C 11384746-T-C ***
13591306-T-C 11435630-T-C ***
13591312-T-C 11435636-T-C ***
13636788-C-T 11481112-C-T ***
13694587-G-A 11538911-G-A ***
13739898-T-C 11584222-T-C ***
14442874-G-A 12322147-G-A ***
14442882-G-A 12322155-G-A ***
14442906-T-G 12322179-T-G ***
14442911-C-A 12322184-C-A ***
14443601-A-G 12322874-A-G ***
28803332-A-C 26657185-A-C ***
28806818-A-T 26660671-A-T ***
28815383-C-G 26669236-C-G ***
28815387-T-C 26669240-T-C ***
28817499-T-C 26671352-T-C ***
28817882-GATTGT-G 26671735-GATTGT-G ***
10775673-A-C ***
13244834-C-T 11089158-C-T ***
13264132-T-C 11108456-T-C ***
13407043-C-A 11251367-C-A ***
13407044-C-T 11251368-C-T ***
13466190-C-A 11310514-C-A ***
13466201-T-C 11310525-T-C ***
13466213-A-G 11310537-A-G ***
13493109-A-G 11337433-A-G ***
13512434-T-C 11356758-T-C ***
13516655-T-C 11360979-T-C ***
13562665-T-A 11406989-T-A ***
13638540-C-T 11482864-C-T ***
13707315-C-A 11551639-C-A ***
28582612-G-A 26436465-G-A ***
28584356-T-G 26438209-T-G ***
28807416-G-C 26661269-G-C BY151890 ***
56856588-C-T ***
56863470-C-A ***
10787643-TTTCC-T ***
56862931-AG-A ***
10775668-C-G ***
28816647-CG-C 26670500-CG-C ***
56862117-T-A ***
10859654-C-T ***
13278756-T-A 11123080-T-A ***
13517758-A-G 11362082-A-G ***
13538393-A-G 11382717-A-G ***
13711308-T-C 11555632-T-C ***
28812701-C-T 26666554-C-T FT462619 ***
13468847-T-C 11313171-T-C ***
22512439-GCA-G 20350553-GCA-G DYZ19 ***
13264073-A-T 11108397-A-T ***
13347695-C-T 11192019-C-T ***
13347773-A-G 11192097-A-G ***
13347777-A-T 11192101-A-T ***
13391094-A-C 11235418-A-C ***
13391154-G-A 11235478-G-A FT229983 ***
13428108-AT-A 11272432-AT-A ***
13565515-T-G 11409839-T-G ***
13595227-G-T 11439551-G-T ***
13598418-A-T 11442742-A-T ***
13605913-C-T 11450237-C-T ***
13605958-C-A 11450282-C-A ***
13605976-A-G 11450300-A-G ***
13605982-A-G 11450306-A-G ***
13712422-G-T 11556746-G-T ***
28585353-C-T 26439206-C-T ***
28585441-C-T 26439294-C-T ***
22298476-G-T 20136590-G-T DYZ19 ***
13444720-C-G 11289044-C-G ***
13466428-C-A 11310752-C-A ***
13595233-A-G 11439557-A-G ***
13609180-C-T 11453504-C-T ***
9960733-T-C 10123124-T-C ***
9960734-G-A 10123125-G-A ***
13400177-A-C 11244501-A-C ***
13400289-G-A 11244613-G-A ***
13444805-G-A 11289129-G-A ***
13701578-G-T 11545902-G-T ***
13408299-G-C 11252623-G-C ***
13439544-T-G 11283868-T-G ***
13590859-C-T 11435183-C-T ***
22447434-G-A 20285548-G-A DYZ19 ***
22447444-G-C 20285558-G-C DYZ19 ***
56731807-C-G ***
13443599-A-T 11287923-A-T ***
13443743-G-A 11288067-G-A ***
13443755-C-G 11288079-C-G ***
13475405-G-A 11319729-G-A ***
13537086-T-C 11381410-T-C ***
27467-G-T ***
27470-T-A ***
27472-A-T ***
27477-A-C ***
13476615-G-A 11320939-G-A ***
9964967-G-C 10127358-G-C ***
13466392-A-T 11310716-A-T ***
13476549-C-T 11320873-C-T ***
13476616-A-T 11320940-A-T ***
13353898-A-T 11198222-A-T ***
13400124-T-C 11244448-T-C ***
13527964-G-C 11372288-G-C ***
13689283-A-G 11533607-A-G ***
13476582-C-T 11320906-C-T ***
13469793-G-T 11314117-G-T ***
13351341-G-T 11195665-G-T ***
13351353-A-G 11195677-A-G ***
13351764-C-T 11196088-C-T ***
13406696-G-A 11251020-G-A ***
13408500-G-T 11252824-G-T ***
22509272-A-C 20347386-A-C DYZ19 ***
22509646-C-A 20347760-C-A DYZ19 ***
22288244-C-A 20126358-C-A DYZ19 ***
56690219-G-C ***
13481034-T-A 11325358-T-A ***
13439458-G-A 11283782-G-A ***
9964105-C-T 10126496-C-T ***
9983938-C-A 10146329-C-A ***
10055448-A-G 10217839-A-G ***
13539438-A-G 11383762-A-G ***
9943700-T-A 10106091-T-A FT263042 ***
9965641-A-G 10128032-A-G ***
10022550-G-A 10184941-G-A ***
13583827-T-A 11428151-T-A ***
56720891-C-T ***
9965634-C-G 10128025-C-G ***
22512435-T-TAC 20350549-T-TAC DYZ19 ***
13468602-T-C 11312926-T-C ***
13428129-T-G 11272453-T-G ***
13428151-G-T 11272475-G-T ***
13427873-T-A 11272197-T-A ***
21757153-C-T ***
21757179-A-G ***
13523428-C-T 11367752-C-T ***
13534839-T-A 11379163-T-A ***
13480171-T-A 11324495-T-A ***
22510371-C-T 20348485-C-T DYZ19 ***
9946078-C-T 10108469-C-T ***
13711523-G-A 11555847-G-A ***
13711536-C-T 11555860-C-T ***
13461899-A-T 11306223-A-T ***
22508580-T-G 20346694-T-G DYZ19 ***
13467497-C-G 11311821-C-G ***
13467512-G-A 11311836-G-A ***
56832324-C-CCAATG ***
13469914-C-A 11314238-C-A ***
9946115-A-G 10108506-A-G ***
10062553-AG-A 10224944-AG-A ***
10814069-A-G ***
13443597-G-A 11287921-G-A ***
56734139-T-A ***
13469356-G-T 11313680-G-T ***
13584176-C-T 11428500-C-T ***
6402390-G-C 6534349-G-C ***
6402403-A-C 6534362-A-C FT75543 ***
10026747-G-A 10189138-G-A ***
10757170-C-A ***
13444778-A-AT 11289102-A-AT ***
56830384-A-T ***
56885333-A-G ***
9932082-T-C 10094473-T-C ***
9936518-CT-C 10098909-CT-C ***
9936520-G-C 10098911-G-C ***
9964089-T-C 10126480-T-C ***
10054519-C-T 10216910-C-T ***
10632738-ATTCCATCCATATCATTCCATTCCC-A,A ***
10632765-CAACTG-C,C ***
10632777-ACTCCTGTCCTCTTCT-A,A ***
10632799-TC-T,T ***
10632802-ATTCCATTCCACTCCAT-A,A ***
10693152-TCCACACCACTACACTCCACTACACTACACTCCCTGCCATTCCATC-T ***
10693203-TCTCTCCATTCCATTCCATTCCATTAGATTCCATTCC-T ***
10693240-A-AC ***
10693747-TCCTTTCC-T ***
13253194-GCA-G 11097518-GCA-G ***
13462217-A-T 11306541-A-T ***
13465380-T-A 11309704-T-A ***
13469912-T-C 11314236-T-C ***
13489514-C-G 11333838-C-G ***
13489538-G-A 11333862-G-A ***
13496205-TG-T 11340529-TG-T ***
13700749-C-CAA 11545073-C-CAA ***
13700750-T-TGGA 11545074-T-TGGA ***
13705504-TGGAATGGAATGGAATGGAA-T 11549828-TGGAATGGAATGGAATGGAA-T ***
13722919-AATGGAATGGAACGGAATTGAATGTCATGGAATGGAATGGC-A 11567243-AATGGAATGGAACGGAATTGAATGTCATGGAATGGAATGGC-A ***
16642835-AC-A 14530955-AC-A ***
16642838-C-A 14530958-C-A ***
16642841-G-GCACC 14530961-G-GCACC ***
16642845-TTATG-T 14530965-TTATG-T ***
16642866-C-T 14530986-C-T ***
16642873-A-G 14530993-A-G ***
16642875-T-C 14530995-T-C ***
16642876-A-G 14530996-A-G ***
22510132-T-A 20348246-T-A DYZ19 ***
56825979-GCATTCCATTCGAGTTCATTCCATTCGAGTTCCTTCCATTCGAGTT-G ***
56830265-CTCCATTCCTCTCCATTCCAT-C ***
56832312-T-TTCAAC ***
56833337-ACTCTACT-A ***
56851325-G-GTTTAGGCTCTGCCTACAGGGGGCTTTGTGACATATCTCTGCACTGATCACCTC ***
6012400-G-C 6144359-G-C ***
6012402-T-C 6144361-T-C ***
6012407-G-A 6144366-G-A ***
9909155-G-A 10071546-G-A ***
9941576-A-T 10103967-A-T ***
9941579-G-A 10103970-G-A ***
9941753-T-C 10104144-T-C ***
9944658-G-T 10107049-G-T ***
9974155-G-A 10136546-G-A ***
10081682-A-G 10244073-A-G ***
10093329-G-T 10255720-G-T ***
10093332-G-C 10255723-G-C ***
10093336-T-A 10255727-T-A ***
10093338-C-T 10255729-C-T ***
10093346-T-G 10255737-T-G ***
10625059-G-C ***
10859893-C-CTCCAT ***
13294509-GTTT-G 11138833-GTTT-G 12×T***
13294521-T-TCA 11138845-T-TCA ***
13347116-G-T 11191440-G-T ***
13447103-TTTCTA-T 11291427-TTTCTA-T ***
13461342-G-T 11305666-G-T ***
13461928-C-T 11306252-C-T ***
13462115-CCA-C 11306439-CCA-C ***
13469863-A-T 11314187-A-T ***
13469875-C-G 11314199-C-G ***
13469892-A-C 11314216-A-C ***
13469899-A-T 11314223-A-T ***
13469905-G-C 11314229-G-C ***
13472755-A-G 11317079-A-G ***
13476560-G-T 11320884-G-T ***
13476563-G-T 11320887-G-T ***
13476573-G-A 11320897-G-A ***
13478417-G-A 11322741-G-A ***
13478487-G-C 11322811-G-C ***
13478506-G-A 11322830-G-A ***
13479363-A-G 11323687-A-G ***
13480863-G-T 11325187-G-T ***
13482270-A-T 11326594-A-T ***
13482801-T-G 11327125-T-G ***
13482811-CA-C 11327135-CA-C ***
13483035-G-C 11327359-G-C ***
13483038-A-G 11327362-A-G ***
13483041-G-A 11327365-G-A ***
13483072-G-T 11327396-G-T ***
13483084-T-A 11327408-T-A ***
13483091-C-T 11327415-C-T ***
13485327-T-G 11329651-T-G ***
13485358-G-C 11329682-G-C ***
13489265-A-C 11333589-A-C ***
13489266-G-A 11333590-G-A ***
16642622-T-TTC 14530742-T-TTC ***
16642623-GGC-G 14530743-GGC-G ***
16642652-TACA-T 14530772-TACA-T ***
16642656-G-GTGGC 14530776-G-GTGGC ***
16642660-GCT-G 14530780-GCT-G ***
16642663-T-TCA 14530783-T-TCA ***
22509922-T-C 20348036-T-C DYZ19 ***
56676601-A-G ***
56678436-A-T ***
56746001-G-T ***
56828925-ATTCCATTCCATTCCATTCCATTCCATGTCATTCCATTCCATTCCATTCCCTTCGAATCCATTCCATTCCATTCCGTTTCC-A ***
56830821-AC-A ***
56849005-AGGT-A ***
56862453-G-GCA ***
56862457-GAT-G ***
56871627-A-AT ***
3712813-T-TGTGAGAGAGAGAGAGAGAGAGAGAGAGAGA 3844772-T-TGTGAGAGAGAGAGAGAGAGAGAGAGAGAGA ***
9909129-C-T 10071520-C-T ***
9909139-T-C 10071530-T-C ***
9909148-C-A 10071539-C-A ***
9909178-C-T 10071569-C-T ***
9959873-TAATAATAATAA-T 10122264-TAATAATAATAA-T ***
10668345-T-TCC ***
10780627-T-TTCCATTTCATTCCATTGCATTCCAC ***
13263826-G-T 11108150-G-T ***
13263828-G-C 11108152-G-C ***
13395387-G-C 11239711-G-C ***
13428116-A-C 11272440-A-C ***
13428120-A-G 11272444-A-G ***
13448930-G-GTA 11293254-G-GTA ***
13462081-C-A 11306405-C-A ***
13466448-C-G 11310772-C-G ***
13466808-G-A 11311132-G-A ***
13472030-A-T 11316354-A-T ***
13473725-GC-G 11318049-GC-G ***
13476588-A-T 11320912-A-T ***
13476591-C-A 11320915-C-A ***
13478418-G-C 11322742-G-C ***
13478431-T-G 11322755-T-G ***
13478462-T-A 11322786-T-A ***
13478929-CTG-C 11323253-CTG-C ***
13478935-A-ACG 11323259-A-ACG ***
13479001-C-A 11323325-C-A ***
13479009-G-T 11323333-G-T ***
13479013-C-A 11323337-C-A ***
13480920-GGC-G 11325244-GGC-G ***
13480925-G-A 11325249-G-A ***
13480961-A-T 11325285-A-T ***
13480974-C-T 11325298-C-T ***
13482539-A-G 11326863-A-G ***
22508270-TCACTTCAAGAATGAAGCTGCAGACATTACTGGTGAGTGTTACAGCACTTAAAGGTGTTATGTCCAGAGTTTGTTCCG-T 20346384-TCACTTCAAGAATGAAGCTGCAGACATTACTGGTGAGTGTTACAGCACTTAAAGGTGTTATGTCCAGAGTTTGTTCCG-T DYZ19 ***
21757200-T-C ***
21757201-C-T ***
56845015-ATATCACTGCACTGATCACCCATGTGATATAACTCTTGTCTAGGCTCTGCCTATAG-A ***
2786194-G-C 2918153-G-C ***
2786242-A-G 2918201-A-G ***
2786244-C-T 2918203-C-T ***
2786289-T-G 2918248-T-G ***
2856292-C-CCGTCATCGTCGGCAG 2988251-C-CCGTCATCGTCGGCAG ***
9974074-C-G 10136465-C-G ***
9983924-T-G 10146315-T-G ***
9983925-G-T 10146316-G-T ***
9992812-C-A 10155203-C-A ***
10668330-T-TTCCACTCC ***
10807295-CA-C ***
10814068-C-CTCCCT ***
13449064-AC-A 11293388-AC-A ***
13470542-GCCA-G 11314866-GCCA-G ***
13474754-C-T 11319078-C-T ***
13474776-A-G 11319100-A-G ***
13689478-A-G 11533802-A-G BY35210 ***
13707388-CAATACCATTGAATGG-C 11551712-CAATACCATTGAATGG-C ***
13712719-G-T 11557043-G-T ***
13712722-A-C 11557046-A-C ***
28812489-CAT-C 26666342-CAT-C ***
28812492-G-GAA 26666345-G-GAA ***
28819098-G-GA 26672951-G-GA ***
56828732-TCC-T ***
56828735-T-TGA ***
3387981-C-T 3519940-C-T ***
9963959-T-G 10126350-T-G ***
13433552-GAAAATTTTCTTTTTCTGTGTAATAGTTTATCAGCATGA-G 11277876-GAAAATTTTCTTTTTCTGTGTAATAGTTTATCAGCATGA-G ***
13465444-CAAG-C 11309768-CAAG-C ***
13474799-T-G 11319123-T-G ***
13480147-T-C 11324471-T-C ***
13480152-AAT-A 11324476-AAT-A ***
13480153-AT-A 11324477-AT-A ***
13599044-GAAGAAA-G 11443368-GAAGAAA-G ***
13599051-TGATGAGA-T 11443375-TGATGAGA-T ***
56763992-CAATGG-C 9×AATGG***
56833228-T-TTCCATTCCACTCCACTCCTTTCCATTCCATTCCACTCCAC ***
56833942-C-G ***
56834011-TG-T ***
56850025-A-G ***
56850026-TCA-T ***
56850031-C-CCT ***
13428161-T-C 11272485-T-C ***
13428165-C-G 11272489-C-G ***
13428206-A-T 11272530-A-T ***
13452075-C-CTCCAA 11296399-C-CTCCAA ***
13480915-G-A 11325239-G-A ***
13480953-G-T 11325277-G-T ***
13483365-T-TAA 11327689-T-TAA ***
13483697-G-T 11328021-G-T ***
13483726-A-T 11328050-A-T ***
13688556-G-T 11532880-G-T ***
13869678-T-TCA 11748972-T-TCA ***
13869679-TGA-T 11748973-TGA-T ***
22288071-T-TTAG 20126185-T-TTAG DYZ19 ***
56710337-G-C ***
56835864-C-CACTCTA ***
56835866-TG-T ***
9949798-A-T 10112189-A-T ***
9949800-G-A 10112191-G-A ***
9960519-G-A 10122910-G-A ***
9960520-C-A 10122911-C-A ***
9963962-T-G 10126353-T-G ***
9963993-T-A 10126384-T-A ***
10061590-C-T 10223981-C-T ***
10688065-C-CCT ***
10688068-TCC-T ***
13427837-T-G 11272161-T-G ***
13462634-A-T 11306958-A-T ***
13462635-A-T 11306959-A-T ***
13462673-C-A 11306997-C-A ***
13462695-G-T 11307019-G-T ***
13465290-G-T 11309614-G-T ***
13465312-T-A 11309636-T-A ***
13465440-G-A 11309764-G-A ***
13480125-G-T 11324449-G-T ***
13723193-A-C 11567517-A-C ***
56748415-A-T ***
3431064-T-A 3563023-T-A ***
13693648-G-A 11537972-G-A ***
9937955-A-G 10100346-A-G ***
13691698-G-C 11536022-G-C ***
17918311-A-ACGGGCTTCTT 15806431-A-ACGGGCTTCTT ***
17918315-A-AG 15806435-A-AG ***
17918316-A-AG 15806436-A-AG ***
28810677-G-A 26664530-G-A ***
56834817-C-CTCCACTCCAT ***
13484393-G-A 11328717-G-A ***
13269880-C-T 11114204-C-T ***
13400366-T-C 11244690-T-C ***
13466313-A-T 11310637-A-T ***
13466341-C-T 11310665-C-T ***
13638475-G-A 11482799-G-A ***
13638498-C-G 11482822-C-G ***
22288073-GTGT-G 20126187-GTGT-G DYZ19 ***
9993104-T-A 10155495-T-A ***
9993117-T-C 10155508-T-C ***
9993125-G-C 10155516-G-C ***
13468596-A-G 11312920-A-G ***
13481026-G-C 11325350-G-C BY210371 ***
13516696-C-T 11361020-C-T ***
13557839-A-G 11402163-A-G ***
13713642-G-T 11557966-G-T ***
13734128-AATGGAACGGAATTGAATGTC-A 11578452-AATGGAACGGAATTGAATGTC-A ***
9994916-A-T 10157307-A-T ***
13463862-C-G 11308186-C-G ***
10693754-C-CGA ***
22298486-C-G 20136600-C-G DYZ19 ***
22298508-G-A 20136622-G-A DYZ19 ***
22477952-A-T 20316066-A-T BY25213 DYZ19 ***
22477959-G-T 20316073-G-T BY25216 DYZ19 ***
13478228-C-T 11322552-C-T ***
13730150-G-A 11574474-G-A ***
13474464-A-T 11318788-A-T ***
22510963-G-C 20349077-G-C DYZ19 ***
10632823-ATTCCATTCCTTTTCTTCGACAGGATCTCGCTCTGTCACTCAGGCTGGAGTGCAGTGGCACAATCTCAGCTCACATTTCATTTCACCATTCC-A,A ***
13462007-G-A 11306331-G-A ***
13480234-G-A 11324558-G-A ***
13486304-C-A 11330628-C-A ***
22362001-G-T 20200115-G-T DYZ19 ***
24490816-G-A 22344669-G-A ***
13435739-T-A 11280063-T-A ***
13458038-CTGTGGTTAATTCCAT-C 11302362-CTGTGGTTAATTCCAT-C ***
13465357-AG-A 11309681-AG-A ***
13465383-G-C 11309707-G-C ***
13482319-A-C 11326643-A-C ***
13482320-G-A 11326644-G-A ***
13484391-ATG-A 11328715-ATG-A ***
13484394-C-CAG 11328718-C-CAG ***
28814727-A-G 26668580-A-G ***
56761546-T-C ***
6012416-C-T 6144375-C-T ***
6012430-C-T 6144389-C-T ***
13465204-C-G 11309528-C-G ***
2786326-T-C 2918285-T-C ***
2856295-T-TCGGGCGGTCAAAACACTCGATGTACAGGGTCTTTACCCGGAAAAGCTTCGCCGCAATAAAGAACGGGACCGCGACA 2988254-T-TCGGGCGGTCAAAACACTCGATGTACAGGGTCTTTACCCGGAAAAGCTTCGCCGCAATAAAGAACGGGACCGCGACA ***
2892827-C-T 3024786-C-T ***
2892828-A-G 3024787-A-G ***
2892835-G-A 3024794-G-A ***
2892837-T-C 3024796-T-C ***
2892840-G-T 3024799-G-T ***
2892843-C-T 3024802-C-T ***
2892844-A-G 3024803-A-G ***
2921348-G-GGCGTGAACCTTCCGAAAAGCATTCCAAGC 3053307-G-GGCGTGAACCTTCCGAAAAGCATTCCAAGC ***
2921351-T-TTC 3053310-T-TTC ***
2921352-G-GATAGTTCTGAATGGCATTAGCTTTCGTCAAACTATCAATTC 3053311-G-GATAGTTCTGAATGGCATTAGCTTTCGTCAAACTATCAATTC ***
3846989-G-A 3978948-G-A ***
4011926-C-T 4143885-C-T ***
4405917-G-A 4537876-G-A ***
5090184-G-A 5222143-G-A ***
5105631-G-A 5237590-G-A ***
5105637-A-G 5237596-A-G ***
5524993-T-TA 5656952-T-TA ***
6012479-T-C 6144438-T-C ***
6012481-C-G 6144440-C-G ***
6012491-ATTTTG-A 6144450-ATTTTG-A ***
6122251-T-C 6254210-T-C ***
6816311-G-A 6948270-G-A ***
6935455-C-CG 7067414-C-CG ***
6935457-A-ATCTGTCATTTTTGGCGACTTTTCAGCCGGCCGCAGGCGGCCCGTCGTTCAAGGCGACCCCGGTGACCTGCGGAAACGTGAATCGAGAGGACTTCGGTGCTCGGATTCGGCGCG 7067416-A-ATCTGTCATTTTTGGCGACTTTTCAGCCGGCCGCAGGCGGCCCGTCGTTCAAGGCGACCCCGGTGACCTGCGGAAACGTGAATCGAGAGGACTTCGGTGCTCGGATTCGGCGCG ***
7171412-C-G 7303371-C-G ***
7517707-T-TAC 7649666-T-TAC ***
7517708-G-GGTATGTGGCCATTGGTACTTATCGTAGGGGCCTTGAATGGTGCCATTACACCA 7649667-G-GGTATGTGGCCATTGGTACTTATCGTAGGGGCCTTGAATGGTGCCATTACACCA ***
7517712-T-TTATATATTCCGGCACAAC 7649671-T-TTATATATTCCGGCACAAC ***
7517714-T-TTTATTCTC 7649673-T-TTTATTCTC ***
7536515-G-A 7668474-G-A ***
7735418-G-A 7867377-G-A ***
7867733-G-C 7999692-G-C ***
7951046-G-GGTGTTTTTTACCGACTTGGGTGCAATAAAGAAATAAAATGACGAAATCAATATAGCAACAATCAGATAAAACATCCCTTCTCCTCCCTATAAATTATTCAGCTTCTGCTGCTT 8083005-G-GGTGTTTTTTACCGACTTGGGTGCAATAAAGAAATAAAATGACGAAATCAATATAGCAACAATCAGATAAAACATCCCTTCTCCTCCCTATAAATTATTCAGCTTCTGCTGCTT ***
8899495-G-A 9031454-G-A ***
9186895-C-T 9349286-C-T ***
9200466-G-A 9362857-G-A ***
9340831-A-AACACAC 9503222-A-AACACAC 22×AC***
9924402-G-A 10086793-G-A ***
9924403-C-T 10086794-C-T ***
9924411-C-A 10086802-C-A ***
9924414-T-C 10086805-T-C ***
9937947-G-A 10100338-G-A ***
9941558-G-A 10103949-G-A ***
9949865-G-A 10112256-G-A ***
9957178-T-A 10119569-T-A ***
9964886-AATTTCCTGGGAACTTG-A 10127277-AATTTCCTGGGAACTTG-A ***
9974070-A-C 10136461-A-C ***
9980213-AG-A 10142604-AG-A ***
9980216-A-T 10142607-A-T ***
9980800-T-C 10143191-T-C ***
9980803-G-A 10143194-G-A BY82378 ***
9984507-C-G 10146898-C-G ***
9995930-T-G 10158321-T-G ***
10026605-C-T 10188996-C-T ***
10668329-C-CCA ***
10690877-C-G ***
10690883-C-T ***
10791178-T-C ***
10791183-T-C ***
10791184-T-C ***
10791188-T-C ***
10791199-C-G ***
10791215-C-A ***
10791225-C-T ***
10791226-C-CAGTAA ***
10791238-T-G ***
10801556-C-T ***
10801574-G-C ***
10801586-C-G ***
10803765-C-T ***
10803766-C-T ***
10848078-A-T ***
10848082-C-G ***
10848084-T-G ***
10948057-G-A ***
10983930-T-TTG ***
11020734-C-T ***
11032985-CAATTCCATTACCTTCAATT-C ***
11033006-GAATTCACACCA-G ***
11033030-G-C ***
11033031-C-A ***
13239912-T-C 11084236-T-C ***
13239914-G-A 11084238-G-A ***
13373900-C-A 11218224-C-A ***
13390387-T-A 11234711-T-A ***
13390456-C-G 11234780-C-G ***
13391146-G-A 11235470-G-A ***
13395422-T-C 11239746-T-C ***
13412833-A-T 11257157-A-T ***
13412908-C-T 11257232-C-T ***
13423388-C-T 11267712-C-T ***
13444577-C-T 11288901-C-T ***
13444595-C-A 11288919-C-A ***
13448474-CA-C 11292798-CA-C ***
13448488-T-G 11292812-T-G ***
13448501-G-T 11292825-G-T ***
13460386-G-T 11304710-G-T ***
13461333-C-G 11305657-C-G ***
13461358-T-A 11305682-T-A ***
13461868-T-A 11306192-T-A ***
13461943-C-T 11306267-C-T ***
13461946-CGT-C 11306270-CGT-C ***
13461947-G-C 11306271-G-C ***
13461968-G-T 11306292-G-T ***
13461990-G-T 11306314-G-T ***
13462108-C-CAAG 11306432-C-CAAG ***
13462268-C-T 11306592-C-T ***
13463041-C-G 11307365-C-G ***
13463044-G-GTC 11307368-G-GTC ***
13463046-T-G 11307370-T-G ***
13463047-ATG-A 11307371-ATG-A ***
13463052-G-C 11307376-G-C ***
13463056-G-C 11307380-G-C ***
13463057-G-C 11307381-G-C ***
13463062-C-CCG 11307386-C-CCG ***
13463232-G-C 11307556-G-C ***
13463251-C-G 11307575-C-G ***
13464458-C-A 11308782-C-A ***
13465140-GGT-G 11309464-GGT-G ***
13465310-T-A 11309634-T-A ***
13465344-G-C 11309668-G-C ***
13467473-G-T 11311797-G-T ***
13469129-C-G 11313453-C-G ***
13469130-C-T 11313454-C-T ***
13469195-G-T 11313519-G-T ***
13469642-G-A 11313966-G-A ***
13469775-T-C 11314099-T-C ***
13469779-T-C 11314103-T-C ***
13469784-C-G 11314108-C-G ***
13470404-C-G 11314728-C-G ***
13470411-C-T 11314735-C-T ***
13470412-A-G 11314736-A-G ***
13472566-T-A 11316890-T-A ***
13472609-C-A 11316933-C-A ***
13473473-C-A 11317797-C-A ***
13473532-G-C 11317856-G-C ***
13473759-C-G 11318083-C-G ***
13474443-A-T 11318767-A-T ***
13474731-G-C 11319055-G-C ***
13474758-A-G 11319082-A-G ***
13474802-A-AGG 11319126-A-AGG ***
13475881-G-A 11320205-G-A ***
13476479-G-A 11320803-G-A ***
13476480-C-T 11320804-C-T ***
13476496-G-T 11320820-G-T ***
13476741-G-T 11321065-G-T ***
13476743-G-A 11321067-G-A ***
13478490-G-C 11322814-G-C ***
13478491-G-C 11322815-G-C ***
13478650-C-A 11322974-C-A BY86006 ***
13479073-C-G 11323397-C-G ***
13479435-G-T 11323759-G-T ***
13480269-T-A 11324593-T-A ***
13480285-T-C 11324609-T-C ***
13481086-T-C 11325410-T-C ***
13481097-A-C 11325421-A-C ***
13481101-G-A 11325425-G-A ***
13481120-G-T 11325444-G-T ***
13482191-G-A 11326515-G-A ***
13482323-C-T 11326647-C-T ***
13482664-A-G 11326988-A-G ***
13482783-C-G 11327107-C-G ***
13482786-A-C 11327110-A-C ***
13483671-C-G 11327995-C-G ***
13483727-C-T 11328051-C-T ***
13484174-A-T 11328498-A-T ***
13484367-T-C 11328691-T-C ***
13484398-C-CCGTAGGCAGAGACTACAAAAGAGTTATATCACCGGGGTGATCAG 11328722-C-CCGTAGGCAGAGACTACAAAAGAGTTATATCACCGGGGTGATCAG ***
13484427-T-A 11328751-T-A ***
13486373-C-T 11330697-C-T ***
13486427-A-T 11330751-A-T ***
13487981-T-A 11332305-T-A ***
13487998-C-T 11332322-C-T ***
13488919-C-T 11333243-C-T ***
13488930-G-C 11333254-G-C ***
13488954-C-CTG 11333278-C-CTG ***
13488985-GCC-G 11333309-GCC-G ***
13488997-C-A 11333321-C-A ***
13489268-A-T 11333592-A-T ***
13489280-C-G 11333604-C-G ***
13489323-C-G 11333647-C-G ***
13489329-C-A 11333653-C-A ***
13489391-CCT-C 11333715-CCT-C ***
13489394-G-GGA 11333718-G-GGA ***
13489436-T-C 11333760-T-C ***
13489744-C-A 11334068-C-A ***
13489773-C-G 11334097-C-G ***
13489859-T-A 11334183-T-A ***
13489868-C-G 11334192-C-G ***
13489886-CAGG-C 11334210-CAGG-C ***
13491708-T-C 11336032-T-C ***
13495889-G-A 11340213-G-A ***
13513141-CCA-C 11357465-CCA-C ***
13529018-G-A 11373342-G-A ***
13532646-T-G 11376970-T-G ***
13565519-A-G 11409843-A-G ***
13583816-G-T 11428140-G-T ***
13584247-T-A 11428571-T-A ***
13590878-C-T 11435202-C-T ***
13590892-A-G 11435216-A-G ***
13605698-C-T 11450022-C-T ***
13609197-C-A 11453521-C-A ***
13636640-G-T 11480964-G-T ***
13636850-TAA-T 11481174-TAA-T 10×A***
13638504-T-A 11482828-T-A ***
13638534-C-A 11482858-C-A ***
13638914-A-G 11483238-A-G ***
13640544-T-C 11484868-T-C ***
13688499-A-T 11532823-A-T ***
13688527-C-T 11532851-C-T FT448475 ***
13689370-C-CTG 11533694-C-CTG ***
13692308-A-T 11536632-A-T ***
13692310-TG-T 11536634-TG-T ***
13692813-T-C 11537137-T-C BY88743 ***
13693617-T-A 11537941-T-A BY88790 ***
13693633-G-T 11537957-G-T ***
13693692-TGGAATGAAATGGAATGGAATGGAATGGAAC-T 11538016-TGGAATGAAATGGAATGGAATGGAATGGAAC-T ***
13694296-G-C 11538620-G-C ***
13694482-G-A 11538806-G-A ***
13705871-C-T 11550195-C-T ***
13707770-T-C 11552094-T-C ***
13709071-A-C 11553395-A-C ***
13709559-G-T 11553883-G-T ***
13715097-G-T 11559421-G-T ***
13715115-T-C 11559439-T-C ***
13717813-T-A 11562137-T-A ***
13719740-A-ACTGG 11564064-A-ACTGG ***
13720932-G-T 11565256-G-T ***
13725839-A-T 11570163-A-T ***
13726208-G-A 11570532-G-A ***
13726226-G-A 11570550-G-A ***
13734620-T-A 11578944-T-A ***
13811145-A-ACCC 11690439-A-ACCC ***
13811146-ATGG-A 11690440-ATGG-A ***
13844073-T-TAAACCC 11723367-T-TAAACCC ***
13868444-T-C 11747738-T-C ***
13868449-T-A 11747743-T-A ***
14442820-C-G 12322093-C-G ***
14442824-CACA-C 12322097-CACA-C ***
14442829-GGGC-G 12322102-GGGC-G ***
14442833-TATTATAAA-T 12322106-TATTATAAA-T ***
14442844-CTTCTACTT-C 12322117-CTTCTACTT-C ***
14442857-T-G 12322130-T-G ***
14442859-T-C 12322132-T-C ***
14442861-CTGT-C 12322134-CTGT-C ***
14442865-ACCG-A 12322138-ACCG-A ***
14442900-C-CTTGAAGCACAAAGCTAGAGCTGCTATTCCCATATTCACCAAAGGGATCAATAAAAAGGGAATCACATATAGGAGGTTGAGAAGGACCGGTATCCCTACAATGAAAGACGCCCCGTTGTTA 12322173-C-CTTGAAGCACAAAGCTAGAGCTGCTATTCCCATATTCACCAAAGGGATCAATAAAAAGGGAATCACATATAGGAGGTTGAGAAGGACCGGTATCCCTACAATGAAAGACGCCCCGTTGTTA ***
14442914-T-TCG 12322187-T-TCG ***
14442916-GCA-G 12322189-GCA-G ***
14442932-G-A 12322205-G-A ***
14442946-T-C 12322219-T-C ***
14442949-C-G 12322222-C-G ***
14443495-C-A 12322768-C-A FT281592 ***
14493827-G-C 12382024-G-C ***
14535805-C-CCGTTTTTCAA 12424006-C-CCGTTTTTCAA ***
14535807-T-TCGTTCTAAGTTAGCAGTTAAAGATTGA 12424008-T-TCGTTCTAAGTTAGCAGTTAAAGATTGA ***
14535812-G-GTTCTTCAATTT 12424013-G-GTTCTTCAATTT ***
14535813-G-GTACTAACTCTTGTTCAAGGCTAGCAGCCTCTTCTTTGC 12424014-G-GTACTAACTCTTGTTCAAGGCTAGCAGCCTCTTCTTTGC ***
14912450-C-T 12800517-C-T ***
15099090-T-A 12987178-T-A ***
15324538-G-GT 13212656-G-GT ***
15324565-T-A 13212683-T-A ***
15401719-C-T 13289839-C-T ***
15918722-A-C 13806842-A-C ***
17687797-C-T 15575917-C-T ***
17687800-C-T 15575920-C-T ***
17687803-T-TCGTCAACTTTTGTTGGTGACTTTTTTATATTTTAGATTTTGAAAGA 15575923-T-TCGTCAACTTTTGTTGGTGACTTTTTTATATTTTAGATTTTGAAAGA ***
17687806-C-CCATAAATTTATACAAACTCTCGTAAATA 15575926-C-CCATAAATTTATACAAACTCTCGTAAATA ***
17918320-A-ATCTT 15806440-A-ATCTT ***
17918322-TCAAC-T 15806442-TCAAC-T ***
17918328-A-T 15806448-A-T ***
17918331-A-T 15806451-A-T ***
17918334-A-G 15806454-A-G ***
17918336-TAAAAAAA-T 15806456-TAAAAAAA-T ***
17918344-T-C 15806464-T-C ***
17918349-CCATGAAAAAGTGG-C 15806469-CCATGAAAAAGTGG-C ***
17920711-G-GGT 15808831-G-GGT ***
17920714-GGA-G 15808834-GGA-G ***
17920718-G-A 15808838-G-A FT424211 ***
17920724-C-CTT 15808844-C-CTT ***
17920736-A-T 15808856-A-T ***
18160182-A-ACAGC 16048302-A-ACAGC ***
18160185-A-ATGTCC 16048305-A-ATGTCC ***
18160191-A-ATC 16048311-A-ATC ***
18160192-A-ATCAAT 16048312-A-ATCAAT ***
18160196-A-ATGG 16048316-A-ATGG ***
18160197-A-ACGTTG 16048317-A-ACGTTG ***
18160200-G-GCAAGTTTATCA 16048320-G-GCAAGTTTATCA ***
18160203-T-TAGCTA 16048323-T-TAGCTA ***
18160205-A-AACCGTCGTACGGTT 16048325-A-AACCGTCGTACGGTT ***
18160210-T-TGCAGATTGACAC 16048330-T-TGCAGATTGACAC ***
18160217-A-ACC 16048337-A-ACC ***
18160218-A-AGGACGTGT 16048338-A-AGGACGTGT ***
18596295-A-G 16484415-A-G ***
19233074-T-TCGGCATGGAGAAGATCCGCGACAAGGGCACCCGCAGCGCCGTCAAGCGCGTGGACCCCATGCGCTCCCAGACCGGCC 17121194-T-TCGGCATGGAGAAGATCCGCGACAAGGGCACCCGCAGCGCCGTCAAGCGCGTGGACCCCATGCGCTCCCAGACCGGCC ***
19233076-T-TCCCCGCGAGGAGATCCTGAAGGTGTTCTTC 17121196-T-TCCCCGCGAGGAGATCCTGAAGGTGTTCTTC ***
19812800-G-A 17700920-G-A P5_Prx ***
20823165-C-CGACAGTACGCTCAACAGCCTTATTTGACTCCATAGCCCATGTATCTGGGTTATGGCAATATTGGCAACGCATCTTACAGCCTTGCATAAAAACAATAAAACGGATACCCGGACCATCTACGG 18661279-C-CGACAGTACGCTCAACAGCCTTATTTGACTCCATAGCCCATGTATCTGGGTTATGGCAATATTGGCAACGCATCTTACAGCCTTGCATAAAAACAATAAAACGGATACCCGGACCATCTACGG P4_Gap ***
20891954-A-G 18730068-A-G P4_Dst ***
21402778-AGTTTG-A 19240892-AGTTTG-A ***
22325693-TTCCAGAGTTTGTTCCTTGAGATGTGTCCAGAGTTTCTTCCTTCTGGCAGGCTCATGGTCTTGCTCACTTCAAGAAAGAAGCTGCAGAACTTAGTGGTGAGTTTTGCAGCACTTAAAGGTTTTATG-T 20163807-TTCCAGAGTTTGTTCCTTGAGATGTGTCCAGAGTTTCTTCCTTCTGGCAGGCTCATGGTCTTGCTCACTTCAAGAAAGAAGCTGCAGAACTTAGTGGTGAGTTTTGCAGCACTTAAAGGTTTTATG-T DYZ19 ***
22424433-G-C 20262547-G-C DYZ19 ***
22438070-CCTTCTGGCAGGTTCATGGTCTTGCTCACTTCAAGAATGAAACTGTAGAACATTACGGTGAGTGTTACAGCAATGAAAGATGGTATATCCAGAGTTTGTTCCTTCAGATGTGTCCAGAGTTTCTTT-C 20276184-CCTTCTGGCAGGTTCATGGTCTTGCTCACTTCAAGAATGAAACTGTAGAACATTACGGTGAGTGTTACAGCAATGAAAGATGGTATATCCAGAGTTTGTTCCTTCAGATGTGTCCAGAGTTTCTTT-C DYZ19 ***
22440117-C-A 20278231-C-A FT456411 DYZ19 ***
22474707-TTCCAGAGTTTGTTACTTCAGATATGTCCAGAGTTTCTTCCTTCTGGCAGGTTCATGGTCTTGCTCACTTCAAGAACGAAGCTGCAGACCTTTGCGGTGAGTGATACAACACCGAAAGGTGTTATA-T 20312821-TTCCAGAGTTTGTTACTTCAGATATGTCCAGAGTTTCTTCCTTCTGGCAGGTTCATGGTCTTGCTCACTTCAAGAACGAAGCTGCAGACCTTTGCGGTGAGTGATACAACACCGAAAGGTGTTATA-T DYZ19 ***
22479351-G-A 20317465-G-A DYZ19 ***
22486865-G-T 20324979-G-T DYZ19 ***
22486926-G-C 20325040-G-C DYZ19 ***
22486932-A-T 20325046-A-T DYZ19 ***
22489905-TTAATGAAGCTGCAGACCTTACTGGTGAGTGTTACAGCACTTAAAGGTGTTATGTCCAGAGTTTGTTCCTTCAGATGTGTCCAGAGTGTCTTCCTTCTGGCAGGTTCGTGGTCTTGCTCACTTCAC-T 20328019-TTAATGAAGCTGCAGACCTTACTGGTGAGTGTTACAGCACTTAAAGGTGTTATGTCCAGAGTTTGTTCCTTCAGATGTGTCCAGAGTGTCTTCCTTCTGGCAGGTTCGTGGTCTTGCTCACTTCAC-T DYZ19 ***
22506523-A-T 20344637-A-T DYZ19 ***
22506524-C-T 20344638-C-T DYZ19 ***
22508606-T-A 20346720-T-A DYZ19 ***
22508614-T-G 20346728-T-G DYZ19 ***
22509632-T-C 20347746-T-C DYZ19 ***
22509653-T-A 20347767-T-A DYZ19 ***
22510439-G-C 20348553-G-C DYZ19 ***
22510967-G-T 20349081-G-T DYZ19 ***
22511393-G-C 20349507-G-C DYZ19 ***
22642131-A-C 20480245-A-C ***
22642142-T-C 20480256-T-C ***
22642143-G-A 20480257-G-A ***
22642148-C-T 20480262-C-T ***
22698080-T-TATCAATCCAATCAACCATAGCTTGGATAGCATTTGAGACCTTTTCAGCTTCGTCTCCCTCTAGCTTATCATCTGGTTGCTCTAGGGTTGCTATCGCCTTTTCTTCGGCTGTTCGG 20536194-T-TATCAATCCAATCAACCATAGCTTGGATAGCATTTGAGACCTTTTCAGCTTCGTCTCCCTCTAGCTTATCATCTGGTTGCTCTAGGGTTGCTATCGCCTTTTCTTCGGCTGTTCGG ***
22819067-A-ATTTATGATG 20657181-A-ATTTATGATG ***
22819068-C-CT 20657182-C-CT ***
22819070-C-CATACTATGCCTGGCAATGTCCAAATTGTCATAGCTTGATGGTATTCGGTGAGGATGAGAATCCAAATCGTTATACTTTCTATAAGTGGATAGATTTAGATAGTGAA 20657184-C-CATACTATGCCTGGCAATGTCCAAATTGTCATAGCTTGATGGTATTCGGTGAGGATGAGAATCCAAATCGTTATACTTTCTATAAGTGGATAGATTTAGATAGTGAA ***
23089047-T-C 20927161-T-C ***
23314052-G-GTAACTTCCAACTGTCGCCATCTATTTTAGCAGCCAGTTTTGGGACTAGCTACCGCCATGTCCAAAGAGTCATCAAACAGTTTATCGACCAAGGAATCATTGAAAAGGTAGCCTTTA 21152166-G-GTAACTTCCAACTGTCGCCATCTATTTTAGCAGCCAGTTTTGGGACTAGCTACCGCCATGTCCAAAGAGTCATCAAACAGTTTATCGACCAAGGAATCATTGAAAAGGTAGCCTTTA ***
24475914-C-CGGCAGCAAAGAAA 22329767-C-CGGCAGCAAAGAAA ***
24491020-T-A 22344873-T-A ***
28715418-G-GGCT 26569271-G-GGCT ***
28715419-A-ACCGTCAGCTCTTCCTACCATACAAGACCAATAATGAATGGCTCAAGACCAATACAAAAGCTTACATCGTTGAGGCTAAGTCAGATGTAGCAGAAGCGAGCCAGCTTC 26569272-A-ACCGTCAGCTCTTCCTACCATACAAGACCAATAATGAATGGCTCAAGACCAATACAAAAGCTTACATCGTTGAGGCTAAGTCAGATGTAGCAGAAGCGAGCCAGCTTC ***
28793490-GGAA-G 26647343-GGAA-G ***
28793865-A-G 26647718-A-G ***
28805782-G-T 26659635-G-T ***
28806174-T-C 26660027-T-C ***
28806195-CG-C 26660048-CG-C ***
28808740-A-T 26662593-A-T ***
28809824-T-G 26663677-T-G ***
28810267-T-A 26664120-T-A ***
28813031-G-A 26666884-G-A ***
28813495-G-A 26667348-G-A ***
28814593-T-A 26668446-T-A ***
28814602-A-ATTG 26668455-A-ATTG ***
28814603-A-AAC 26668456-A-AAC ***
28814746-C-T 26668599-C-T ***
28814783-T-A 26668636-T-A ***
28814790-G-T 26668643-G-T ***
28818852-G-T 26672705-G-T ***
56680589-A-G ***
56684183-G-C ***
56705738-T-C ***
56706250-G-C ***
56735852-T-C ***
56746287-A-AATGGAATGGG ***
56746292-A-G ***
56754492-C-G ***
56754730-T-A ***
56760263-G-C ***
56760434-A-T ***
56771084-T-C ***
56829240-A-G ***
56830816-ACTCC-A ***
56831480-ACTCCCTTCCATTCCATGCCATTCCGTTCCTTCCTTTCCAAAGGATGTCACTCTGTCACATAGGCTGGAGTGCAGTGGCACAATCTCAGCTCACATTTCT-A ***
56833966-A-ATTCCATTCCACTCGTTTCCT ***
56835799-T-A ***
56862122-T-A ***
28262-T-A ***
28272-G-T ***

In the table above, the meaning of the confidence field depends on whether the data comes from an FTDNA kit or an FGC kit. For FTDNA kits, + implies a "PASS" result with just one possible variant, * indicates a "PASS" but with multiple variants, ** indicates "REJECTED" with just a single variant, and *** indicates "REJECTED" with multiple possible variants. 'A*' are heterozygous variants not called by FTDNA, but still pulled from the VCF file. For FGC kits, + indicates over 99% likely genuine (95% for INDELs); * over 95% likely genuine (90% for INDELs); ** about 40% likely genuine; *** about 10% likely genuine. Manual entries read directly from a BAM file will be either + indicating positive, or * indicating that the data show a mixture of possible variants.

For the FTDNA kits, the BED data is encoded in the background color of the cells. Those cells with a white background have coverage, those with a grey background indicate no coverage in the BED file, and those with a pink background indicate the mutation is on the edge of a coverage region. These pink regions often indicate that the individual may be positive for a SNP even if there is no corresponding entry in the vcf file.

The combBED column indicates whether or not the mutation is a SNP and falls in the combBED region defined in Defining a New Rate Constant for Y-Chromosome SNPs based on Full Sequencing Data by Dmitry Adamov, Vladimir Guryanov, Sergey Karzhavin, Vladimir Tagankin, Vadim Urasin.

The McDonald BED column indicates whether or not the mutation is a SNP and falls in the BED region used by Dr. Iain McDonald in the age analysis he does for R-U106 men.