Tree Position

R-P312/S116 > Z290 > L21/S145 > S552 > DF13 > Z39589 > DF49/S474 > Z2980 > Z2976 > DF23 > Z2961 > Z2956 > M222 > Z2959 > Z46375 > DF106 > DF104 > DF105 > A18726 > A259 > Y19870 > BY11725 > A10525 > BY18145 > FGC65253 > FT15936

Unique Mutations

The mutations unique to this man are summarized in the table below. Those with a '+' or '*' confidence level are considered by FamilyTreeDNA or FullGenomesCorp to be high quality SNPs/INDELs. For completeness, all other mutations of lesser confidence are included as well. These additional mutations may be useful for distinguishing between very closely related men.

Occasionally, some of the mutations listed here will be thought to be shared with other men in which case they might appear in upstream blocks on the tree. When this happens, the 'Blocks' field will indicate what block they appear in. Such a situation might arise with BigY men if the BED data suggests another man may be positive for a SNP, even though it doesn't appear in his VCF data. It might also happen if Chromo2 testing or Sanger sequencing of other men not on the tree show the SNP to be shared.

POS-REF-ALT (hg19) POS-REF-ALT (hg38) Blocks Names Region McDonald BED combBED STRYSEQ
12568
23803104-G-C 21641218-G-C Y+
22197731-C-T 20035845-C-T Y+
2789178-T-C 2921137-T-C Y+
21615319-G-T 19453433-G-T YY+
22229666-C-CCTTTAAGTGCTGTAACACTCACCACTGAATTCTGCAGCTTCACTCTTGAAGTGAGCAATACCATGAGCCTGCCAGATGGAGGAAACTCTGGACACATCTG 20067780-C-CCTTTAAGTGCTGTAACACTCACCACTGAATTCTGCAGCTTCACTCTTGAAGTGAGCAATACCATGAGCCTGCCAGATGGAGGAAACTCTGGACACATCTG DYZ19 +
7003198-G-C 7135157-G-C Y+
22353451-TAG-T 20191565-TAG-T DYZ19 +
22353454-T-TAC 20191568-T-TAC DYZ19 +
23108365-C-A 20946479-C-A Y+
13474427-A-G 11318751-A-G *
10783268-C-T *
10652358-T-TCCA *
10652356-C-CCA *
10625244-A-T *
10625241-T-C *
56881416-C-CG,G *
10625275-A-C *
10625230-A-C *
10069862-C-T 10232253-C-T *
10872561-T-C *
10069855-C-CCA 10232246-C-CCA *
10069852-ATT-A 10232243-ATT-A *
10069851-G-A 10232242-G-A *
10069830-G-A 10232221-G-A *
10069819-T-A 10232210-T-A *
10069856-T-A,TCCAA 10232247-T-A,TCCAA *
10069799-G-T 10232190-G-T *
10783266-C-T *
22228960-C-CGT 20067074-C-CGT DYZ19 *
13489131-C-A,T 11333455-C-A,T *
13460906-G-C 11305230-G-C *
10069829-T-G 10232220-T-G *
13461269-A-G,T 11305593-A-G,T *
6402335-T-C 6534294-T-C *
13450267-A-ACCATTCCATTCCATTTCATTCCATTCCATTCCATTCCATTCCATTCCATTCCATTCCATTCCATTCCATTCCATTCCATTGCATTCCATT 11294591-A-ACCATTCCATTCCATTTCATTCCATTCCATTCCATTCCATTCCATTCCATTCCATTCCATTCCATTCCATTCCATTCCATTGCATTCCATT *
13669086-G-T 11513410-G-T *
13489060-G-A 11333384-G-A *
22228961-ACT-A 20067075-ACT-A DYZ19 *
13468293-G-T 11312617-G-T *
15558431-GAGAT-G,G 13446551-GAGAT-G,G 17×AGAT*
23505495-C-CAA,CAAA 21343609-C-CAA,CAAA 23×A*
10686664-T-A *
10799493-C-A *
56832153-CGTTCT-C *
10686708-T-TTCCGC *
10785304-A-G *
13483855-G-T 11328179-G-T *
10662945-C-CACTCT,CATTCT *
10859991-C-A *
13669076-G-T 11513400-G-T *
13489280-C-CAA 11333604-C-CAA *
56829529-C-CCA *
22302281-G-A 20140395-G-A BY165732 DYZ19 *
56825930-GATTTCATTCCATTCA-G *
56826007-G-GCA,T *
13669047-C-A 11513371-C-A *
56826011-C-A,CATTCGATTGCA *
13705605-C-G 11549929-C-G *
56827914-C-CAATCCATTCCATTCCATTCCATTAAATTCG *
56829530-G-GTCCATTCCATTCA *
6402313-TCC-T 6534272-TCC-T *
6402278-C-A 6534237-C-A *
56832539-C-CTCCAATCCATTCCAT,T *
6402311-C-CGT 6534270-C-CGT *
6402086-A-ACTGGTGTCGTAAAATACTGACGTATATCTAACT 6534045-A-ACTGGTGTCGTAAAATACTGACGTATATCTAACT *
13450879-A-ACCACTCCACTCCTCTCCCCAACACT 11295203-A-ACCACTCCACTCCTCTCCCCAACACT *
22459160-C-G 20297274-C-G BY220260 DYZ19 *
56861285-C-CTTTTTT 18×T*
56874786-C-CTTTTTTTTTTTTTTT 11×T*
59006962-T-TAAA 56860815-T-TAAA 8×A*
6402343-A-ACATTCGTCGGTGTCG 6534302-A-ACATTCGTCGGTGTCG *
13489843-C-G 11334167-C-G *
13669081-C-T 11513405-C-T *
13504498-C-CAAA,CAAAA 11348822-C-CAAA,CAAAA 12×A*
22255189-T-A 20093303-T-A DYZ19 *
22302277-A-T 20140391-A-T BY216920 DYZ19 *
56826965-T-TCC,TCCATGGC *
13669102-G-A 11513426-G-A *
13669107-A-G 11513431-A-G *
13474613-C-G 11318937-C-G *
28816803-GAGTGAAGTGGAT-G 26670656-GAGTGAAGTGGAT-G *
28816820-GTGGAATGGAGCGCAATGGAC-G 26670673-GTGGAATGGAGCGCAATGGAC-G *
58995194-G-C 56849047-G-C *
58995193-T-C 56849046-T-C *
28816853-GAATGGATTGGAGTGGATTGGAGTGC-G 26670706-GAATGGATTGGAGTGGATTGGAGTGC-G *
13866569-G-A 11745863-G-A *
59012859-C-G 56866712-C-G *
7128621-CGTGTGT-C,CGTGT 7260580-CGTGTGT-C,CGTGT 23×GT*
10787762-T-TCC *
21608032-TAAAAAA-T 19446146-TAAAAAA-T 46×A**
8826678-C-CAAAAAAAAAAA 8958637-C-CAAAAAAAAAAA 29×A**
7451550-G-C 7583509-G-C IR1_L **
9066717-A-C 9229108-A-C **
2660607-A-G 2792566-A-G **
22366369-G-C 20204483-G-C DYZ19 **
21501086-A-AT 19339200-A-AT 37×T**
13688909-T-C 11533233-T-C ***
22478010-G-T 20316124-G-T DYZ19 ***
8407698-A-C 8539657-A-C ***
8452228-C-CAA 8584187-C-CAA 11×A***
8549032-GT-G,GTTT 8680991-GT-G,GTTT 23×T***
8784772-C-CTT 8916731-C-CTT 11×T***
22477999-G-A 20316113-G-A DYZ19 ***
22476566-T-C 20314680-T-C DYZ19 ***
8888375-CT-C,CTT 9020334-CT-C,CTT 25×T***
8901775-C-T 9033734-C-T ***
8996134-G-A 9158525-G-A ***
22084546-C-T 19922660-C-T ***
21536155-C-A 19374269-C-A ***
9429509-G-A 9591900-G-A ***
8194212-C-T 8326171-C-T ***
9844057-T-C 10006448-T-C ***
9977503-G-A 10139894-G-A ***
10007248-G-A 10169639-G-A ***
10055487-A-G 10217878-A-G ***
10065098-G-C 10227489-G-C ***
21414425-C-T 19252539-C-T ***
21176534-G-A 19014648-G-A ***
21137890-G-A 18976004-G-A ***
19320984-G-A 17209104-G-A ***
19299299-T-C 17187419-T-C ***
19091558-T-A 16979678-T-A ***
18947496-G-A 16835616-G-A ***
18717740-AAAAG-A 16605860-AAAAG-A ***
22478031-G-T 20316145-G-T DYZ19 ***
7980393-A-T 8112352-A-T ***
18196079-C-T 16084199-C-T ***
5583366-C-T 5715325-C-T ***
56834855-A-ATCTCACTGTCACAGAGGCTGAAGTGCAGTGGCACAATCTCAGTTCACAT ***
2820882-G-A 2952841-G-A ***
3005702-G-A 3137661-G-A FT51846 ***
3204488-G-T 3336447-G-T ***
3409906-C-T 3541865-C-T ***
3539310-G-A 3671269-G-A ***
56834420-T-TCCAC ***
56724633-C-G ***
3867393-G-A 3999352-G-A ***
5139708-G-A 5271667-G-A ***
5225813-C-T 5357772-C-T ***
5261910-A-T 5393869-A-T ***
5550280-G-GTT,GTTTT 5682239-G-GTT,GTTTT 39×T***
5628777-T-C 5760736-T-C ***
7969853-A-G 8101812-A-G ***
5770295-G-A 5902254-G-A ***
5963660-G-A 6095619-G-A ***
56685606-G-T ***
24422478-C-CAA,CAA 22276331-C-CAA,CAA 43×A***
6402346-A-AAATACCGACGTATATAGTATAGGTG 6534305-A-AAATACCGACGTATATAGTATAGGTG ***
6637698-A-T 6769657-A-T ***
23988306-C-T 21842159-C-T ***
23863261-T-A 21701375-T-A ***
23146617-C-T 20984731-C-T ***
22854820-G-A 20692934-G-A ***
22712858-G-A 20550972-G-A ***
22509214-T-A 20347328-T-A DYZ19 ***
22478036-T-C 20316150-T-C DYZ19 ***
7795411-GACA-G 7927370-GACA-G ***
18709216-G-A 16597336-G-A ***
18196075-A-T 16084195-A-T ***
13688866-C-T 11533190-C-T ***
13479109-G-T 11323433-G-T ***
14567574-A-G 12455774-A-G ***
13461264-C-A 11305588-C-A ***
14396430-AC-A 12275726-AC-A ***
13708107-GAA-G 11552431-GAA-G ***
13708106-G-GTT 11552430-G-GTT ***
13461278-C-G 11305602-C-G ***
13705494-TGGAATGGAATGGAATGGAATGGAATGGAA-T 11549818-TGGAATGGAATGGAATGGAATGGAATGGAA-T ***
13465971-T-A 11310295-T-A ***
13468258-A-G 11312582-A-G ***
13468266-C-T 11312590-C-T ***
13474349-A-T 11318673-A-T ***
13479096-C-A 11323420-C-A ***
13705491-GA-G 11549815-GA-G ***
13480652-A-T 11324976-A-T ***
15254573-C-T 13142659-C-T ***
13481830-T-A 11326154-T-A ***
13481861-C-G 11326185-C-G ***
13481919-G-C 11326243-G-C ***
13482009-TA-T 11326333-TA-T ***
13694921-C-CTG 11539245-C-CTG ***
13690059-G-T 11534383-G-T ***
13489635-A-ACACC 11333959-A-ACACC ***
13489767-C-CG 11334091-C-CG ***
13489938-T-A 11334262-T-A ***
13690034-G-T 11534358-G-T ***
13611405-CA-C,CAAAA 11455729-CA-C,CAAAA 16×A***
13688069-A-G 11532393-A-G ***
13688861-GA-G 11533185-GA-G ***
15025770-G-T 12913858-G-T ***
15529090-G-A 13417210-G-A FT76433 ***
18160044-C-A 16048164-C-A ***
10654444-T-C ***
17432377-C-T 15320497-C-T ***
17225891-G-A 15114011-G-A ***
17010350-C-G 14898470-C-G ***
10652393-A-ATTC ***
10652395-A-ATGCCATGCCATG ***
10652435-T-G ***
10652436-G-A ***
16956836-G-A 14844956-G-A ***
10652448-ATTT-A ***
10652452-CGTTCCATTCCATTTCAT-C ***
16901782-G-A 14789902-G-A ***
16416039-G-A 14304159-G-A ***
16353215-G-A 14241335-G-A ***
10654447-C-T ***
15653722-C-G 13541842-C-G ***
16292546-A-ATTTT,ATTTTT 14180666-A-ATTTT,ATTTTT 48×T***
10845557-G-A ***
10845571-C-A ***
10884757-CATT-C ***
10912577-G-T ***
10912685-G-A ***
15954465-A-G 13842585-A-G ***
10912697-C-G ***
10912716-G-C ***
10912726-C-G ***
10912746-C-T ***
10912756-G-C ***
10954319-T-A ***
13216319-C-T 11060643-C-T ***
13479100-G-C 11323424-G-C ***
22301910-A-G 20140024-A-G DYZ19 ***
2735740-T-G 2867699-T-G ***
10652429-T-C ***
13470700-A-C 11315024-A-C ***
13468274-C-T 11312598-C-T ***
10845567-C-G ***
10654417-C-A ***
28799792-G-A 26653645-G-A ***
10069824-G-T 10232215-G-T ***
10888269-G-T ***
10652424-T-C ***
15297284-A-AT 13185383-A-AT 27×T***
10912750-T-A ***
10912730-C-G ***
13482019-G-A 11326343-G-A ***
22509160-A-C 20347274-A-C DYZ19 ***
13479029-C-A 11323353-C-A ***
10686520-C-CCACTCCACTCCATTCCACTCCATTG ***
17616966-CA-C 15505086-CA-C 35×A***
10815693-T-C ***
13694672-G-T 11538996-G-T ***
19513578-AT-A,ATT 17401698-AT-A,ATT 20×T***
10888264-T-A ***
23471038-CA-C,CAA 21309152-CA-C,CAA 19×A***
9957004-C-T 10119395-C-T ***
28817996-G-T 26671849-G-T ***
28817993-A-T 26671846-A-T ***
13461199-T-C 11305523-T-C ***
13705347-A-T 11549671-A-T ***
10652413-A-G ***
13474343-C-T 11318667-C-T ***
10912753-G-T ***
10912678-C-T ***
13256046-T-G 11100370-T-G ***
10912677-C-T ***
10912672-A-G ***
10912671-A-T ***
10912742-T-G ***
10768612-C-T ***
14125248-G-GAA 12004542-G-GAA 14×A***
13481920-G-T 11326244-G-T ***
56847611-C-G ***
10654503-ATCCTG-A ***
9962189-C-A 10124580-C-A FT373592 ***
10964244-T-A ***
22509279-G-C 20347393-G-C FGC73124 DYZ19 ***
58993963-G-A 56847816-G-A ***
22476562-G-A 20314676-G-A DYZ19 ***
22255778-T-C 20093892-T-C DYZ19 ***
13482548-C-CT 11326872-C-CT ***
13454841-C-A 11299165-C-A ***
6401894-A-C 6533853-A-C ***
59016025-G-GA 56869878-G-GA 9×A***
58968239-T-TATATAG 56822092-T-TATATAG ***
6684205-C-CAAAA 6816164-C-CAAAA 31×A***
9909183-C-T 10071574-C-T ***
13468285-T-A 11312609-T-A ***
9909154-T-G 10071545-T-G ***
13500110-CA-C 11344434-CA-C 16×A***
5094042-C-CT 5226001-C-CT 27×T***
58905259-A-C 56685612-T-G ***
13688911-G-A 11533235-G-A ***
16833655-TACAC-T 14721775-TACAC-T 17×AC***
13640927-A-G 11485251-A-G ***
58999844-C-A 56853697-C-A ***
22476799-A-G 20314913-A-G BY25201 DYZ19 ***
10652408-C-A ***
28801378-G-C 26655231-G-C ***
56827953-T-A ***
10912760-T-C ***
10964229-T-C ***
10654454-G-T ***
13489309-G-C 11333633-G-C BY26218 ***
9909165-G-T 10071556-G-T ***
13545259-G-C 11389583-G-C ***
22476805-T-G 20314919-T-G BY223657 DYZ19 ***
22477994-T-C 20316108-T-C BY223940 DYZ19 ***
22459192-C-A 20297306-C-A BY46661 DYZ19 ***
13489166-C-T 11333490-C-T ***
9962175-T-G 10124566-T-G ***
9962169-T-G 10124560-T-G ***
9962207-A-G 10124598-A-G ***
13808939-TGAATGGAATG-T 11688233-TGAATGGAATG-T 5×GAATG***
13474391-T-A 11318715-T-A ***
7154797-C-CA 7286756-C-CA 18×A***
13470573-A-T 11314897-A-T F18175 ***
10964212-C-T ***
10964259-C-G ***
13489612-ACC-A 11333936-ACC-A ***
13866616-AATCG-A 11745910-AATCG-A ***
56862918-G-C ***
13694684-A-T 11539008-A-T ***
13479066-T-A 11323390-T-A ***
10654411-C-CACTT ***
10654410-T-TA ***
56828735-T-TGA ***
56828732-TCC-T ***
13866613-T-TA 11745907-T-TA ***
13489824-G-C 11334148-G-C ***
13463185-C-CGT 11307509-C-CGT ***
13470560-G-GTGCC 11314884-G-GTGCC ***
10661296-T-TCCACTC ***
9909151-T-C 10071542-T-C ***
9909117-T-A 10071508-T-A ***
9909109-C-T 10071500-C-T ***
9909091-G-T 10071482-G-T ***
56834817-C-CTCCACTCCACTCCAT ***
56834082-C-CACTCT ***
9962143-G-A 10124534-G-A ***
56830664-G-C ***
22255707-G-T 20093821-G-T DYZ19 ***
13465996-G-A 11310320-G-A ***
10902208-A-AT ***
6402084-A-ATATT 6534043-A-ATATT ***
56832504-C-CTAAAT ***
22255741-G-T 20093855-G-T DYZ19 ***
22255738-G-C 20093852-G-C DYZ19 ***
22255734-TAA-T 20093848-TAA-T DYZ19 ***
22255722-T-C 20093836-T-C DYZ19 ***
22255688-A-G 20093802-A-G DYZ19 ***
13640926-C-T 11485250-C-T ***
22255685-T-A 20093799-T-A DYZ19 ***
13489736-C-G 11334060-C-G ***
13481883-C-G 11326207-C-G ***
13481876-G-A 11326200-G-A ***
13470675-AC-A 11314999-AC-A ***
10787772-TTG-T ***
10787768-TCG-T ***
10787766-T-A ***
56830670-C-CACT ***
56828925-ATTCCATTCCATTCCATTCCATTCCATGTCATTCCATTCCATTCCATTCCCTTCGAATCCATTCCATTCCATTCCGTTTCC-A ***
10843745-C-A ***
13489200-G-T 11333524-G-T ***
10888273-A-C ***
10836857-C-G ***
10836850-C-T ***
28785193-T-C 26639046-T-C ***
13482530-A-G 11326854-A-G ***
13474348-T-C 11318672-T-C ***
10997323-A-T ***
28805615-G-T 26659468-G-T ***
10761507-C-G ***
10902216-C-G ***
13688406-A-G 11532730-A-G ***
10081966-C-T 10244357-C-T ***
13479081-G-A 11323405-G-A ***
13719299-C-T 11563623-C-T ***
10964250-T-C ***
13705526-G-A 11549850-G-A ***
56876124-CAAAAAAAAAAAAAAAAAAAAA-C 50×A***
10888258-C-T ***
13479034-C-T 11323358-C-T ***
13868563-A-T 11747857-A-T ***
56826966-A-ATTT ***
13481869-C-T 11326193-C-T ***
28582605-T-A 26436458-T-A ***
56829342-T-TTC ***
13489829-G-A 11334153-G-A ***
11029601-T-A ***
3077778-CA-C 3209737-CA-C 10×A***
10912593-G-T ***
22478021-C-T 20316135-C-T Z17260 DYZ19 ***
8389569-CTTT-C,CTTTT 8521528-CTTT-C,CTTTT 25×T***
9909098-C-T 10071489-C-T ***
13489744-C-T 11334068-C-T ***
22950193-CT-C,CTT 20788307-CT-C,CTT 21×T***
10912711-C-T ***
13460935-C-T 11305259-C-T ***
10803523-C-T ***
13482567-A-T 11326891-A-T ***
13482558-G-A 11326882-G-A ***
13482538-C-G 11326862-C-G ***
13263343-C-T 11107667-C-T ***
9962151-T-TGC 10124542-T-TGC ***

In the table above, the meaning of the confidence field depends on whether the data comes from an FTDNA kit or an FGC kit. For FTDNA kits, + implies a "PASS" result with just one possible variant, * indicates a "PASS" but with multiple variants, ** indicates "REJECTED" with just a single variant, and *** indicates "REJECTED" with multiple possible variants. 'A*' are heterozygous variants not called by FTDNA, but still pulled from the VCF file. For FGC kits, + indicates over 99% likely genuine (95% for INDELs); * over 95% likely genuine (90% for INDELs); ** about 40% likely genuine; *** about 10% likely genuine. Manual entries read directly from a BAM file will be either + indicating positive, or * indicating that the data show a mixture of possible variants.

For the FTDNA kits, the BED data is encoded in the background color of the cells. Those cells with a white background have coverage, those with a grey background indicate no coverage in the BED file, and those with a pink background indicate the mutation is on the edge of a coverage region. These pink regions often indicate that the individual may be positive for a SNP even if there is no corresponding entry in the vcf file.

The combBED column indicates whether or not the mutation is a SNP and falls in the combBED region defined in Defining a New Rate Constant for Y-Chromosome SNPs based on Full Sequencing Data by Dmitry Adamov, Vladimir Guryanov, Sergey Karzhavin, Vladimir Tagankin, Vadim Urasin.

The McDonald BED column indicates whether or not the mutation is a SNP and falls in the BED region used by Dr. Iain McDonald in the age analysis he does for R-U106 men.

Age Analysis Information (work in progress)

AllMcDonaldYFull
Kit: 125681179074881625916569644
Used in age calculations1179074881625916569644
Counts of SNPs52
Variant counts last updated 2022-01-11 03:52:41.



Big Tree Main Page