Tree Position

R-P312/S116 > Z290 > L21/S145 > S552 > DF13 > FGC11134 > FGC12055 > A353 > Z3026 > Z16250 > A114 > CTS4466/S1136 > S1115 > Z3023 > FGC84010 > A541 > S1121 > Z16251 > A1134 > 23642701-T-TA > A804 > FGC29067 > FGC29071

Unique Mutations

The mutations unique to this man are summarized in the table below. Those with a '+' or '*' confidence level are considered by FamilyTreeDNA or FullGenomesCorp to be high quality SNPs/INDELs. For completeness, all other mutations of lesser confidence are included as well. These additional mutations may be useful for distinguishing between very closely related men.

Occasionally, some of the mutations listed here will be thought to be shared with other men in which case they might appear in upstream blocks on the tree. When this happens, the 'Blocks' field will indicate what block they appear in. Such a situation might arise with BigY men if the BED data suggests another man may be positive for a SNP, even though it doesn't appear in his VCF data. It might also happen if Chromo2 testing or Sanger sequencing of other men not on the tree show the SNP to be shared.

POS-REF-ALT (hg19) POS-REF-ALT (hg38) Blocks Names Region McDonald BED combBED STRBigY3
12283
Kane-BY3
12283
FTDNA
12283
17887553-A-AT 15775673-A-AT 10×TA**
6327855-T-C 6459814-T-C IR3_Dst A****
3090131-G-T 3222090-G-T A**
13478057-A-T 11322381-A-T A**
4632489-G-GA 4764448-G-GA 10×AA**
10809667-T-C +
28802526-ATGAGGTGGAGGGC-A 26656379-ATGAGGTGGAGGGC-A +
6893035-A-G 7024994-A-G BY62015 YY+++
13599582-A-G 11443906-A-G BY86623 +++
13340598-G-T 11184922-G-T **+
16627706-ATATATATATATATATATGTGTATATATATATATATATATATG-A 14515826-ATATATATATATATATATGTGTATATATATATATATATATATG-A +
5486189-T-C 5618148-T-C +
28802523-GC-G 26656376-GC-G +
28802546-ACGGAGTTGAAT-A 26656399-ACGGAGTTGAAT-A +
28802542-T-G 26656395-T-G +
24600553-T-C 22454406-T-C P3_t2 +
28802563-GGGGTGTAATT-G 26656416-GGGGTGTAATT-G +
10763153-T-TTCCATTCCACTCCACTCCAC +
23192873-T-C 21030987-T-C Y**+
22691360-G-A 20529474-G-A Y**+
17490024-G-A 15378144-G-A YY**+
22475729-A-G 20313843-A-G DYZ19 +
13621568-T-C 11465892-T-C **+
13538160-A-G 11382484-A-G **+
13302986-A-G 11147310-A-G **+
5347687-C-T 5479646-C-T **+
19113723-TAAAAAA-T 17001843-TAAAAAA-T 28×A***+
10991236-G-GTTCCA *+
14727319-A-AT 12615387-A-AT 23×T**+
10646051-ACCATT-A +
11643726-TTGGAA-T ***+
18384490-C-CAA 16272610-C-CAA P6_Gap 19×A+
9198278-A-G 9360669-A-G Y+
14824983-A-G 12713050-A-G YY*
9669787-A-G 9832178-A-G IR3_Prx *
9826435-G-A 9988826-G-A YY*
15002293-C-T 12890378-C-T YY*
9786224-G-A 9948615-G-A Y*
9766983-T-A 9929374-T-A Y*
9669861-A-G 9832252-A-G IR3_Prx *
9426605-C-T 9588996-C-T YY*
9464972-T-C 9627363-T-C Y*
9450984-T-C 9613375-T-C YY*
15021361-T-C 12909450-T-C YY*
9421125-G-A 9583516-G-A YY*
12910913-G-GTT 15×T*
9416597-T-C 9578988-T-C YY*
9379773-A-G 9542164-A-G Y*
9870703-A-T 10033094-A-T YY*
9882124-C-T 10044515-C-T YY*
9881909-G-A 10044300-G-A YY*
14941016-A-G 12829090-A-G YY*
10756727-TCCCTGCCATCCCCCCTCAATCGTACACCACGCCTCTCTACTCCATCCTCAC-T *
10686317-CATTCCGT- *
10677083-GGGTGTGCAGTGGCAGAATCTCAGCTCACAAAACA- *
10654386-CCA-C *
10057541-A-G 10219932-A-G *
10054205-G-A 10216596-G-A *
14932179-A-G 12820244-A-G YY*
14956307-G-A 12844382-G-A YY*
9882121-C-T 10044512-C-T YY*
14978775-C-T 12866851-C-T YY*
14978778-C-T 12866854-C-T YY*
10004281-T-TA 10166672-T-TA *
9971973-G-T 10134364-G-T Y*
9940120-A-G 10102511-A-G Y*
9882140-AT-A 10044531-AT-A *
9069031-G-A 9231422-G-A Y*
9375287-A-G 9537678-A-G Y*
15089961-A-G 12978050-A-G YY*
9062757-T-C 9225148-T-C Y*
8241973-CAAA-C 8373932-CAAA-C 11×A*
8376166-C-T 8508125-C-T YY*
8376162-C-T 8508121-C-T YY*
15208696-T-G 13096782-T-G YY*
8349626-G-A 8481585-G-A YY*
8295166-T-C 8427125-T-C YY*
8289598-A-G 8421557-A-G YY*
8117546-C-T 8249505-C-T YY*
8376170-C-T 8508129-C-T YY*
8102023-C-A 8233982-C-A YY*
8101983-T-A 8233942-T-A YY*
8068554-T-A 8200513-T-A YY*
8068235-C-T 8200194-C-T YY*
8068232-C-T 8200191-C-T YY*
8059054-A-G 8191013-A-G YY*
8013882-A-G 8145841-A-G YY*
8376169-C-T 8508128-C-T YY*
8376175-C-T 8508134-C-T YY*
9042316-T-A 9204707-T-A Y*
8705320-A-G 8837279-A-G YY*
10756810-C-CT *
8914254-G-A 9046213-G-A *
8878784-G-T 9010743-G-T Y*
8822007-T-C 8953966-T-C YY*
8817229-T-C 8949188-T-C YY*
8774058-T-C 8906017-T-C YY*
8742674-T-C 8874633-T-C YY*
8690644-A-G 8822603-A-G YY*
8376182-C-T 8508141-C-T YY*
15113285-T-C 13001372-T-C YY*
15123655-T-C 13011742-T-C YY*
8679303-A-G 8811262-A-G YY*
15205913-G-A 13093999-G-A YY*
8481599-AT-A 8613558-AT-A *
8376196-C-T 8508155-C-T YY*
8376194-C-T 8508153-C-T YY*
10756792-CCACACCCCACACCAT-C *
10756868-TCCA-T *
10756813-TCCACTCCGCTCATCTCCACTCCACTCCAC-T *
14158410-T-C 12037704-T-C YY*
14329447-C-T 12208741-C-T YY*
14280515-C-CTT 12159809-C-CTT 10×T*
14265257-T-A 12144551-T-A YY*
14219258-T-C 12098552-T-C Y*
14192200-C-T 12071494-C-T YY*
14186000-TTTTG-T 12065294-TTTTG-T *
14873205-T-C 12761275-T-C YY*
14379798-C-A 12259094-C-A YY*
14887134-T-C 12775200-T-C YY*
14153006-T-C 12032300-T-C YY*
14067620-T-TAC 11946914-T-TAC *
13997630-T-C 11876924-T-C YY*
13963617-C-T 11842911-C-T Y*
14903627-C-A 12791694-C-A YY*
13959506-T-C 11838800-T-C Y*
14330239-T-C 12209533-T-C YY*
14383111-G-A 12262407-G-A Y*
13913321-A-AG 11792615-A-AG *
14698213-G-A 12586279-G-A YY*
14821874-T-C 12709941-T-C YY*
14769294-T-C 12657363-T-C YY*
14754999-G-T 12643068-G-T YY*
14729689-TAAAA-T 12617757-TAAAA-T 12×A*
14729123-T-C 12617191-T-C YY*
14698231-G-A 12586297-G-A FT111342 YY*
14698226-A-C 12586292-A-C YY*
14695480-G-C 12583546-G-C Y*
12375567-G-A *
14827133-G-C 12715200-G-C YY*
14843064-T-C 12731130-T-C YY*
14864156-T-C 12752222-T-C FTB22757 YY*
14873178-C-A 12761248-C-A YY*
14681733-C-T 12569799-C-T Y*
14655644-T-C 12543709-T-C YY*
14566695-C-T 12454895-C-T YY*
13924089-T-C 11803383-T-C Y*
13908727-GT-G 11788021-GT-G *
10756844-GCATTCCATTCCATTCC-G *
13388422-T-C 11232746-T-C *
13470640-C-T 11314964-C-T *
13470622-G-C 11314946-G-C *
7983438-G-A 8115397-G-A YY*
11294507-A- *
13447553-C-CCATTCCATTCCATTT 11291877-C-CCATTCCATTCCATTT *
13444522-G-A 11288846-G-A *
13410109-T-C 11254433-T-C *
13326336-T-C 11170660-T-C *
13489242-G-T 11333566-G-T *
13272712-A-G 11117036-A-G *
13271173-C-A 11115497-C-A *
13236429-T-C 11080753-T-C *
13217198-A-G 11061522-A-G *
10965551-CTCCATTCCAT-C,CTCCAT *
10761020-C-CTCCATTCCACTCCATTCCATTCCATTCCACAACATTCCACTCCACTCCACTCCATTTTATTTCTTTCCACTCCATTCCACTCCACTCCACTCCAGTCCATTCTATTACACTCCATTCCATTCGATTCCACTCCATTCCATTCCATTTCAA,CTCCATTCCACTCCATTCCATTCCATTCCACAACATTCCACTCCACTCCACTCCATTTTATTTCTTTCCACTCCATTCCACTCCACTCCACTCCAGTCCATTC *
14824973-T-C 12713040-T-C YY*
13487746-C-CCA 11332070-C-CCA *
13489519-A-C 11333843-A-C *
13889811-C-A 11769105-C-A Y*
13494096-C-G 11338420-C-G *
13826092-G-A 11705386-G-A *
13633041-CTTCTTA-C 11477365-CTTCTTA-C *
13609669-G-A 11453993-G-A FT399524 *
13609666-G-A 11453990-G-A *
13609656-G-A 11453980-G-A *
13500847-A-G 11345171-A-G *
13494097-T-A 11338421-T-A *
13489809-G-A 11334133-G-A *
13489526-A-ATG 11333850-A-ATG *
13489787-G-C 11334111-G-C *
11334011-A- *
13489633-C-CAAT 11333957-C-CAAT *
13489628-A-G 11333952-A-G *
13489577-G-A 11333901-G-A *
14922541-TA-T 12810606-TA-T *
13489575-G-T 11333899-G-T *
13470605-C-A 11314929-C-A *
7761828-C-T 7893787-C-T YY*
7869630-A-G 8001589-A-G YY*
5057656-C-T 5189615-C-T *
5104351-C-T 5236310-C-T *
5090188-T-C 5222147-T-C *
5086487-C-T 5218446-C-T *
5083952-CTTT-C,CTTTT 5215911-CTTT-C,CTTTT 17×T*
5077634-C-T 5209593-C-T *
5059743-G-A 5191702-G-A *
5058557-A-G 5190516-A-G *
5049535-C-T 5181494-C-T *
5151137-C-T 5283096-C-T *
5039769-T-TA 5171728-T-TA *
5036418-T-C 5168377-T-C *
5029183-A-G 5161142-A-G *
5025680-T-C 5157639-T-C *
4998975-A-G 5130934-A-G *
4980329-T-G 5112288-T-G *
4975390-A-T 5107349-A-T *
4963181-T-C 5095140-T-C *
5125080-C-T 5257039-C-T *
5155096-A-T 5287055-A-T *
4928628-T-A 5060587-T-A *
5406560-A-AT 5538519-A-AT 8×T*
5537907-A-G 5669866-A-G *
5526281-G-A 5658240-G-A *
5519096-T-A 5651055-T-A *
5519040-A-G 5650999-A-G *
5488562-GA-G 5620521-GA-G *
5449286-A-G 5581245-A-G *
5447439-C-T 5579398-C-T *
5438766-A-G 5570725-A-G *
5399043-C-A 5531002-C-A *
5192128-T-C 5324087-T-C *
5382905-G-T 5514864-G-T *
5288486-C-T 5420445-C-T *
5275687-G-T 5407646-G-T *
5264020-T-G 5395979-T-G *
5248609-C-A 5380568-C-A *
5223767-A-G 5355726-A-G *
5205635-A-T 5337594-A-T 14×T*
5201076-T-TA 5333035-T-TA 9×A*
4945311-C-T 5077270-C-T *
4928139-T-TA 5060098-T-TA *
5571795-A-G 5703754-A-G *
4535306-G-A 4667265-G-A *
4653525-C-A 4785484-C-A *
4653519-C-A 4785478-C-A *
4653507-A-G 4785466-A-G *
4653506-A-G 4785465-A-G *
4599790-G-A 4731749-G-A *
4585071-A-G 4717030-A-G *
4577093-CAA-C,CA 4709052-CAA-C,CA 13×A*
4573763-T-C 4705722-T-C *
4535126-C-T 4667085-C-T *
4653529-A-G 4785488-A-G *
4533287-A-G 4665246-A-G *
4530271-A-G 4662230-A-G FT197799 *
4528669-T-C 4660628-T-C *
4524133-C-T 4656092-C-T *
4516798-T-C 4648757-T-C *
4513547-C-T 4645506-C-T *
4496312-A-G 4628271-A-G *
4465974-TA-T 4597933-TA-T *
4653528-T-C 4785487-T-C *
4653545-C-T 4785504-C-T *
4917918-A-G 5049877-A-G *
4715474-T-C 4847433-T-C *
4899303-G-T 5031262-G-T *
4877506-G-A 5009465-G-A *
4863735-T-A 4995694-T-A *
4804111-C-A 4936070-C-A *
4784257-A-G 4916216-A-G *
4773143-T-C 4905102-T-C *
4761325-G-T 4893284-G-T *
4749853-C-T 4881812-C-T *
4715391-A-G 4847350-A-G *
4658579-AT-A 4790538-AT-A 8×T*
4706454-T-C 4838413-T-C *
4702971-A-G 4834930-A-G *
4702918-GT-G 4834877-GT-G *
4702916-GT-G 4834875-GT-G *
4693353-A-C 4825312-A-C *
4693350-T-A 4825309-T-A *
4674823-G-C 4806782-G-C *
4666027-A-G 4797986-A-G *
5552373-G-A 5684332-G-A *
5573770-G-A 5705729-G-A *
7854421-T-C 7986380-T-C YY*
7083704-T-C 7215663-T-C YY*
7238859-A-G 7370818-A-G YY*
7136139-C-CTACTGCTGCAGGA 7268098-C-CTACTGCTGCAGGA *
7136137-A-T 7268096-A-T YY*
7132389-G-A 7264348-G-A YY*
7128664-GT-G 7260623-GT-G *
7104191-G-T 7236150-G-T YY*
7102105-GA-G 7234064-GA-G *
7002456-T-C 7134415-T-C Y*
7282435-A-G 7414394-A-G YY*
6947984-G-T 7079943-G-T YY*
6919060-C-T 7051019-C-T YY*
6918920-C-A 7050879-C-A YY*
6775596-G-A 6907555-G-A YY*
6740493-A-G 6872452-A-G YY*
6673922-A-G 6805881-A-G YY*
6649945-T-C 6781904-T-C YY*
6619909-TC-T 6751868-TC-T *
7275186-C-A 7407145-C-A YY*
7324671-A-G 7456630-A-G YY*
6516396-C-T 6648355-C-T *
7637700-G-A 7769659-G-A YY*
7853934-A-G 7985893-A-G YY*
7851551-T-G 7983510-T-G YY*
7780396-C-T 7912355-C-T YY*
7766782-C-T 7898741-C-T YY*
7766749-A-G 7898708-A-G YY*
15235938-C-A 13124024-C-A Y*
7658606-GC-G 7790565-GC-G *
7653062-G-T 7785021-G-T YY*
7534643-CA-C,CAA 7666602-CA-C,CAA 17×A*
7338260-A-G 7470219-A-G Y*
7520067-A-G 7652026-A-G YY*
7516427-C-T 7648386-C-T Y*
7515130-C-T 7647089-C-T Y*
7514209-T-A 7646168-T-A Y*
7431877-A-G 7563836-A-G Y*
7398503-C-T 7530462-C-T YY*
7398484-C-T 7530443-C-T YY*
7363631-C-T 7495590-C-T Y*
6531932-TC-T 6663891-TC-T *
6468227-A-G 6600186-A-G *
5574203-A-G 5706162-A-G *
5687498-T-C 5819457-T-C *
5898679-A-G 6030638-A-G *
5875304-T-C 6007263-T-C *
5828490-A-G 5960449-A-G *
5828484-G-A 5960443-G-A *
5776254-A-C 5908213-A-C *
5734276-AT-A 5866235-AT-A 8×T*
5722661-C-A 5854620-C-A *
5700960-A-G 5832919-A-G *
5679043-C-A 5811002-C-A *
5957739-T-C 6089698-T-C *
5670104-C-CTT 5802063-C-CTT 11×T*
5653172-A-G 5785131-A-G *
5641665-GAA-G 5773624-GAA-G 11×A*
5638114-A-G 5770073-A-G *
5622729-T-C 5754688-T-C *
5604516-C-G 5736475-C-G *
5592457-C-A 5724416-C-A *
5582058-T-C 5714017-T-C *
5943968-G-A 6075927-G-A *
5965386-T-C 6097345-T-C *
6467369-A-G 6599328-A-G *
6101098-A-G 6233057-A-G *
6448462-T-C 6580421-T-C *
6429230-C-T 6561189-C-T *
6413346-T-C 6545305-T-C *
6411334-T-C 6543293-T-C *
6395131-A-G 6527090-A-G *
6362392-C-T 6494351-C-T *
6358580-AAAAATGGACCAATCAGCAGGATGTAAAACGGACCAATCAGCACTCTGC-A 6490539-AAAAATGGACCAATCAGCAGGATGTAAAACGGACCAATCAGCACTCTGC-A *
6101420-G-A 6233379-G-A *
6090507-T-C 6222466-T-C *
5984623-A-G 6116582-A-G *
6087273-G-A 6219232-G-A *
6087267-G-A 6219226-G-A *
6078330-TA-T 6210289-TA-T 9×A*
6070323-G-C 6202282-G-C *
6055959-C-T 6187918-C-T *
6046307-T-TAA 6178266-T-TAA 10×A*
6044837-T-C 6176796-T-C *
5984880-A-G 6116839-A-G *
15222689-T-C 13110775-T-C Y*
4240527-CA-C 4372486-CA-C *
56877581-T-G,G *
22040543-G-A 19878657-G-A YY*
22201114-C-A 20039228-C-A YY*
22145608-C-A 19983722-C-A YY*
22143893-T-C 19982007-T-C YY*
22135699-G-A 19973813-G-A YY*
22059318-T-C 19897432-T-C Y*
22045488-AT-A 19883602-AT-A *
22043450-A-G 19881564-A-G YY*
22029698-A-C 19867812-A-C YY*
22209500-G-A 20047614-G-A FTB30347 Y*
22028395-A-T 19866509-A-T YY*
22025192-G-A 19863306-G-A YY*
22022834-T-C 19860948-T-C YY*
21969642-A-G 19807756-A-G YY*
21939186-G-A 19777300-G-A YY*
21919875-AT-A 19757989-AT-A 9×T*
21910346-AT-A 19748460-AT-A *
21907795-T-C 19745909-T-C YY*
22209493-A-C 20047607-A-C Y*
22233273-A-G 20071387-A-G DYZ19 *
21889053-A-C 19727167-A-C YY*
22581006-A-G 20419120-A-G YY*
22845012-T-TAA 20683126-T-TAA 10×A*
22840127-G-A 20678241-G-A Y*
22827550-G-A 20665664-G-A YY*
22747260-C-T 20585374-C-T YY*
22701604-T-C 20539718-T-C YY*
22660301-C-T 20498415-C-T YY*
22652127-T-C 20490241-T-C YY*
22598912-C-A 20437026-C-A YY*
22571679-A-G 20409793-A-G YY*
22466312-A-G 20304426-A-G DYZ19 *
22571672-C-T 20409786-C-T FTB67450 YY*
22571666-C-T 20409780-C-T YY*
22570000-G-T 20408114-G-T YY*
22559227-T-G 20397341-T-G YY*
22550268-C-CTT 20388382-C-CTT 8×T*
22522550-G-A 20360664-G-A Y*
22514495-G-T 20352609-G-T Y*
22473081-G-T 20311195-G-T DYZ19 *
21896721-T-C 19734835-T-C YY*
21856749-T-C 19694863-T-C YY*
22866479-A-G 20704593-A-G YY*
21154822-C-T 18992936-C-T Y*
21294550-CT-C 19132664-CT-C 8×T*
21259878-G-A 19097992-G-A BY131520 YY*
21233587-A-T 19071701-A-T YY*
21229884-T-C 19067998-T-C YY*
21218904-C-T 19057018-C-T YY*
21193309-C-G 19031423-C-G YY*
21183785-T-C 19021899-T-C YY*
21175877-T-C 19013991-T-C YY*
21150500-T-C 18988614-T-C Y*
21367451-A-G 19205565-A-G YY*
21134653-A-G 18972767-A-G YY*
21111345-C-T 18949459-C-T YY*
21066922-A-T 18905036-A-T YY*
20888466-C-T 18726580-C-T P4_Dst *
20888465-C-T 18726579-C-T P4_Dst *
20712293-C-CAT 18550407-C-CAT P4_Prx *
19829694-T-A 17717814-T-A P5_Prx *
19565457-C-T 17453577-C-T Y*
21298628-A-T 19136742-A-T YY*
21373935-C-A 19212049-C-A YY*
21833045-CA-C 19671159-CA-C *
21735349-A-AAG 19573463-A-AAG *
21827407-C-T 19665521-C-T YY*
21799368-T-C 19637482-T-C YY*
21792632-TG-T 19630746-TG-T *
21792568-C-T 19630682-C-T Y*
21788428-G-T 19626542-G-T Y*
21756742-C-A 19594856-C-A YY*
21753408-T-C 19591522-T-C YY*
21753400-G-A 19591514-G-A YY*
21686539-T-A 19524653-T-A YY*
21387338-T-C 19225452-T-C YY*
21671355-T-C 19509469-T-C Y*
21581425-C-G 19419539-C-G Y*
21525529-T-C 19363643-T-C Y*
21499440-T-C 19337554-T-C YY*
21444290-G-A 19282404-G-A YY*
21444120-CA-C 19282234-CA-C *
21437195-AT-A 19275309-AT-A *
21429841-G-A 19267955-G-A YY*
22855670-A-G 20693784-A-G Y*
22867817-T-C 20705931-T-C YY*
19513943-G-A 17402063-G-A YY*
26068036-A-G 23921889-A-G P1_Y1 *
28476468-C-T 26330321-C-T *
28464817-T-C 26318670-T-C *
28085797-GT-G 25939650-GT-G P1_Y2 *
27714905-C-T 25568758-C-T P1_Y2 *
27435850-CAAAA-C 25289703-CAAAA-C P1_Y2 15×A*
26427111-C-T 24280964-C-T P1_Y1 *
26122113-T-C 23975966-T-C P1_Y1 *
25901504-T-C 23755357-T-C BY41115 P1_Y1 *
28531567-C-T 26385420-C-T Y*
24873020-C-A 22726873-C-A IR1_R *
24483983-A-G 22337836-A-G *
24474943-CT-C 22328796-CT-C *
24474913-T-C 22328766-T-C Y*
24474910-C-CATT 22328763-C-CATT *
24467172-C-A 22321025-C-A Y*
24415509-CT-C 22269362-CT-C *
23961697-C-A 21815550-C-A Y*
28529265-A-G 26383118-A-G *
28563346-T-C 26417199-T-C *
21753662-G-T *
28768577-T-C 26622430-T-C Y*
56857603-TAA-T,TAAAA 11×A*
56845070-GTGGCATTGTGACATATCTCTGCACTGATCACCCATGTGATATAACTCTTGTCTGGGCTCTGCCTAC-G *
56834618-CA- *
56834570-T- *
56833847-CTCCACTCCACTCCACTCCAATCCATTCCACTCCATTCCACTCCACGCCATTCCAGTCCACTCCACTCCTTTCCATTCCATCCCATTCCATTCCACTCCTT- *
56833258-TTCCACTCCAC- *
56832865-ATTCCACTCTATTCCACTCCACTCAACTCAATTCCACTCCCCTCCACTCCACTCCATTCCACTCCATTCCACTCCCCTCCCCTCCATTGCATTCCCT- *
56829137-TCCATTCCAGG-T *
28755298-TG-T 26609151-TG-T *
28563870-G-C 26417723-G-C *
28735667-TG-T 26589520-TG-T *
28725391-A-C 26579244-A-C *
28706036-C-G 26559889-C-G *
28677796-A-G 26531649-A-G *
28669450-G-A 26523303-G-A *
28597390-G-A 26451243-G-A *
28576346-G-T 26430199-G-T *
28571155-A-G 26425008-A-G *
23958383-G-T 21812236-G-T Y*
23869637-G-A 21707751-G-A Y*
22885224-A-G 20723338-A-G YY*
23127199-C-T 20965313-C-T YY*
23392638-T-C 21230752-T-C YY*
23377624-A-G 21215738-A-G YY*
23346794-T-C 21184908-T-C YY*
23330687-A-G 21168801-A-G YY*
23270630-TAA-T,TAAA 21108744-TAA-T,TAAA 16×A*
23265165-G-A 21103279-G-A YY*
23263857-C-G 21101971-C-G YY*
23195368-TTGTG-T,TTG 21033482-TTGTG-T,TTG 14×TG*
23097322-G-T 20935436-G-T YY*
23395751-T-C 21233865-T-C YY*
23045305-A-G 20883419-A-G YY*
23025058-C-T 20863172-C-T YY*
23024432-A-G 20862546-A-G YY*
22998098-A-G 20836212-A-G YY*
22998089-TA-T 20836203-TA-T *
22997474-C-G 20835588-C-G Y*
22962859-AT-A 20800973-AT-A *
22936093-C-A 20774207-C-A YY*
23392890-T-C 21231004-T-C YY*
23416895-T-C 21255009-T-C YY*
23830146-G-A 21668260-G-A Y*
23558243-A-G 21396357-A-G YY*
23830145-G-A 21668259-G-A Y*
23830138-G-A 21668252-G-A Y*
23830137-G-A 21668251-G-A Y*
23830014-C-T 21668128-C-T Y*
23827758-G-A 21665872-G-A Y*
23819121-A-G 21657235-A-G Y*
23804610-T-C 21642724-T-C Y*
23770365-T-C 21608479-T-C Y*
23528008-A-C 21366122-A-C YY*
23418638-CAA-C 21256752-CAA-C 10×A*
23507481-A-G 21345595-A-G YY*
23502658-G-A 21340772-G-A YY*
23488318-C-T 21326432-C-T YY*
23480982-C-T 21319096-C-T YY*
23455664-CA-C 21293778-CA-C *
23441166-G-A 21279280-G-A Y*
23431727-GA-G 21269841-GA-G *
23431526-A-C 21269640-A-C YY*
19537208-G-A 17425328-G-A YY*
19501355-C-A 17389475-C-A YY*
15325217-T-C 13213335-T-C YY*
16753192-C-T 14641312-C-T YY9×A*
16991079-T-TTC 14879199-T-TTC *
16981741-T-C 14869861-T-C YY*
16947460-A-G 14835580-A-G YY*
16945620-T-C 14833740-T-C YY*
16945028-G-A 14833148-G-A Y*
16871850-G-T 14759970-G-T YY*
16767321-C-T 14655441-C-T YY*
16725247-CA-C 14613367-CA-C 8×A*
17002074-C-G 14890194-C-G Y*
16642224-A-G 14530344-A-G YY*
16628474-C-T 14516594-C-T YY*
16540274-C-G 14428394-C-G Y*
16518593-T-TAAA 14406713-T-TAAA 14×A*
16495362-C-A 14383482-C-A YY*
16477932-G-A 14366052-G-A YY*
16466184-G-T 14354304-G-T Y*
16427980-T-A 14316100-T-A Y*
16992831-T-G 14880951-T-G YY*
17046046-A-G 14934166-A-G YY*
16287376-T-C 14175496-T-C YY*
17309026-T-TAA 15197146-T-TAA 11×A*
17462247-G-T 15350367-G-T YY*
17448522-T-C 15336642-T-C YY*
17431152-GTT-G 15319272-GTT-G 10×T*
17405240-A-G 15293360-A-G YY*
17353441-CA-C 15241561-CA-C *
17353172-A-T 15241292-A-T YY*
17329159-T-A 15217279-T-A YY*
17328599-AT-A 15216719-AT-A *
17297882-A-G 15186002-A-G YY*
17072850-G-T 14960970-G-T YY*
17293898-CG-C 15182018-CG-C *
17245027-A-G 15133147-A-G Y*
17233862-G-A 15121982-G-A YY*
17221371-T-C 15109491-T-C Y*
17196353-T-C 15084473-T-C YY*
17190559-A-G 15078679-A-G YY*
17147350-A-G 15035470-A-G YY*
17140509-CCT-C 15028629-CCT-C *
16287995-T-G 14176115-T-G YY*
16286581-G-A 14174701-G-A FT398501 YY*
17491326-CA-C 15379446-CA-C 9×A*
15428763-C-A 13316883-C-A YY*
15554997-A-G 13443117-A-G YY*
15515289-T-C 13403409-T-C YY*
15506380-T-C 13394500-T-C YY*
15504081-A-T 13392201-A-T YY*
15489022-A-G 13377142-A-G YY*
15486912-T-C 13375032-T-C YY*
15468819-A-G 13356939-A-G YY*
15449334-GA-G 13337454-GA-G *
15418974-G-A 13307094-G-A YY*
15596895-C-T 13485015-C-T Y*
15418605-G-A 13306725-G-A YY*
15418599-G-A 13306719-G-A YY*
15402104-T-C 13290224-T-C YY*
4437054-G-GA 4569013-G-GA *
15361744-A-T 13249864-A-T YY*
15359257-A-G 13247377-A-G YY*
15342058-A-C 13230177-A-C YY*
15332454-G-A 13220572-G-A YY*
15566878-A-G 13454998-A-G YY*
15612682-A-T 13500802-A-T YY*
16283970-C-T 14172090-C-T YY*
15940668-T-C 13828788-T-C YY*
16268839-A-T 14156959-A-T YY*
16231340-C-G 14119460-C-G YY*
16224942-T-G 14113062-T-G YY*
16203195-A-G 14091315-A-G YY*
16070476-A-G 13958596-A-G Y*
16012567-G-T 13900687-G-T Y*
15969563-G-T 13857683-G-T YY*
15951900-TTGTGTGTGTG-T 13840020-TTGTGTGTGTG-T 13×TG*
15914309-G-A 13802429-G-A YY*
15632921-C-A 13521041-C-A YY*
15869069-T-C 13757189-T-C YY*
15810962-GGTGTGT-G,GGT 13699082-GGTGTGT-G,GGT 19×GT*
15785840-G-A 13673960-G-A YY*
15701938-AT-A 13590058-AT-A *
15670139-T-C 13558259-T-C Y*
15661730-A-G 13549850-A-G YY*
15647571-A-G 13535691-A-G Y*
15644097-T-C 13532217-T-C Y*
17491321-A-G 15379441-A-G YY*
17538379-T-C 15426499-T-C Y*
19439519-C-T 17327639-C-T YY*
18867994-A-C 16756114-A-C YY*
18986336-A-G 16874456-A-G YY*
18958038-G-GAGAT,GAGAT 16846158-G-GAGAT,GAGAT 11×AGAT*
18955902-C-T 16844022-C-T FT272078 YY*
18953374-A-G 16841494-A-G YY*
18925898-T-A 16814018-T-A YY*
18923531-A-G 16811651-A-G YY*
18910080-G-T 16798200-G-T YY*
18907974-T-C 16796094-T-C YY*
18826576-A-G 16714696-A-G YY*
19034568-G-GAAA 16922688-G-GAAA 9×A*
18795868-G-A 16683988-G-A Y*
18786692-A-G 16674812-A-G YY*
18769681-T-C 16657801-T-C YY*
18761666-C-A 16649786-C-A YY*
18760710-A-G 16648830-A-G YY*
18744729-C-A 16632849-C-A YY*
16616858-CAG- 10×AG*
18712988-A-G 16601108-A-G YY*
18992369-A-G 16880489-A-G YY*
19043196-T-G 16931316-T-G FT350377 Y*
18697038-T-C 16585158-T-C YY*
19275254-A-G 17163374-A-G YY*
19437388-AAGGGAGGGAGGGAGGAGGGAGAGAATAGAGGGAGAGGGAGGGAGGGAGGC-A 17325508-AAGGGAGGGAGGGAGGAGGGAGAGAATAGAGGGAGAGGGAGGGAGGGAGGC-A *
19421424-G-T 17309544-G-T YY*
19410815-T-C 17298935-T-C YY*
19410751-T-C 17298871-T-C YY*
19397731-T-C 17285851-T-C FT108196 YY*
19381103-A-G 17269223-A-G YY*
19352673-T-C 17240793-T-C Y*
19340964-T-A 17229084-T-A YY*
19261747-T-C 17149867-T-C YY*
19053357-T-C 16941477-T-C YY*
19238544-T-C 17126664-T-C YY*
19225847-T-C 17113967-T-C YY*
19199472-T-C 17087592-T-C YY*
19155404-G-A 17043524-G-A Y*
19138015-T-C 17026135-T-C Y*
19127861-A-C 17015981-A-C YY*
19127856-CTCA-C 17015976-CTCA-C *
19079522-C-A 16967642-C-A YY*
18712292-A-G 16600412-A-G YY*
18672592-G-A 16560712-G-A YY*
17565977-T-A 15454097-T-A YY*
17852935-G-C 15741055-G-C YY*
17972687-C-T 15860807-C-T YY*
17972686-C-T 15860806-C-T YY*
17963685-A-ATT 15851805-A-ATT 14×T*
17932940-G-A 15821060-G-A Y*
17932931-G-A 15821051-G-A Y*
17926654-C-T 15814774-C-T YY*
17926650-C-T 15814770-C-T YY*
17905084-CT-C 15793204-CT-C *
17787225-C-T 15675345-C-T Y*
17972703-C-T 15860823-C-T YY*
17787016-T-C 15675136-T-C Y*
17777477-G-T 15665597-G-T Y*
17777028-T-C 15665148-T-C Y*
17750199-C-CTT 15638319-C-CTT 11×T*
17693760-T-C 15581880-T-C YY*
17692304-T-G 15580424-T-G YY*
17638002-C-A 15526122-C-A YY*
17587806-T-C 15475926-T-C YY*
17972694-C-T 15860814-C-T YY*
17972705-C-T 15860825-C-T YY*
18672589-G-A 16560709-G-A YY*
18390356-G-T 16278476-G-T P6_Gap *
18651450-A-G 16539570-A-G Y*
18636625-T-C 16524745-T-C YY*
18616602-T-C 16504722-T-C YY*
18613813-T-A 16501933-T-A YY*
18570603-C-CTT 16458723-C-CTT 14×T*
18566261-G-A 16454381-G-A YY*
18424886-A-G 16313006-A-G P6_Gap *
18407919-A-G 16296039-A-G P6_Gap *
18226418-T-C 16114538-T-C Y*
17972706-C-T 15860826-C-T FT76854 YY*
18174617-T-C 16062737-T-C YY*
18173870-A-G 16061990-A-G YY*
18161806-A-G 16049926-A-G YY*
18086767-T-C 15974887-T-C YY*
18080643-GA-G 15968763-GA-G *
18054028-A-G 15942148-A-G Y*
18036938-G-A 15925058-G-A FT301804 YY*
17972707-C-T 15860827-C-T YY*
4448999-G-T 4580958-G-T *
15235944-C-A 13124030-C-A Y*
4436189-A-G 4568148-A-G *
24636349-CTT-C 22490202-CTT-C P3_t2 17×T*
13470844-G-A 11315168-G-A *
6765621-CTTT-C 6897580-CTTT-C 13×T*
9100107-CTT-C,CT 9262498-CTT-C,CT 18×T*
3148439-G-T 3280398-G-T *
7130197-TA-T 7262156-TA-T 10×A*
14938608-G-T 12826683-G-T YY*
16608673-GGTGT-G 14496793-GGTGT-G 16×GT*
24884030-A-AT 22737883-A-AT g1 13×T*
15115774-G-GT 13003861-G-GT 9×T*
56837419-G-T *
6607435-T-C 6739394-T-C *
56833253-TTCCATTCCACTCCAC-T *
14622256-TA-T 12510454-TA-T 9×A*
18717876-TA-T,TAA 16605996-TA-T,TAA 16×A*
13487739-TCC-T 11332063-TCC-T *
18037000-GA-G 15925120-GA-G 10×A*
10654389-TTCC-T *
13487732-C-A 11332056-C-A *
13468315-C-T 11312639-C-T *
10860924-G-T *
9127055-G-GA 9289446-G-GA 10×A*
10672141-C-T *
13489806-C-A 11334130-C-A *
23298091-CT-C 21136205-CT-C 10×T*
2809540-ATT-A,AT 2941499-ATT-A,AT 18×T****
3296888-A-ACT 3428847-A-ACT 12×CT*
17348297-CA-C,CAA 15236417-CA-C,CAA 17×A*
56830680-CATTCCACTCT-C *
13487779-G-C 11332103-G-C *
18728740-G-C 16616860-G-C YY*
3612669-C-CAA 3744628-C-CAA 13×A*
3435302-CTT-C 3567261-CTT-C 11×T*
4298308-T-C 4430267-T-C *
4329128-TTTG-T 4461087-TTTG-T 5×TTG*
7628568-A-AT 7760527-A-AT 10×T****
10860920-G-C *
13487780-C-A 11332104-C-A *
14926230-G-A 12814295-G-A YY*
18718886-ATATCTATC-A,ATATC 16607006-ATATCTATC-A,ATATC 13×TATC*
8282556-C-A 8414515-C-A YY*
15385860-CAAA-C 13273980-CAAA-C 14×A****
18841112-T-TAA 16729232-T-TAA 16×A*
3367169-AT-A 3499128-AT-A 10×T*
13487762-C-A 11332086-C-A *
7195227-CAAA-C,CAA 7327186-CAAA-C,CAA 17×A****
19246022-CCCTTT-C 17134142-CCCTTT-C *
16295100-G-GT 14183220-G-GT 9×T*
17596832-TTC-T 15484952-TTC-T *
13487715-C-A 11332039-C-A *
14802098-CAA-C 12690169-CAA-C 13×A*
8124667-T-C 8256626-T-C YY*
10889291-T-G *
10884978-AC-A *
15392566-AT-A 13280686-AT-A 8×T****
21414989-G-GA 19253103-G-GA 10×A*
19439525-T-C 17327645-T-C YY*
13514894-A-AG 11359218-A-AG 11×G*
2844461-C-CT 2976420-C-CT 9×T*
13488926-G-T 11333250-G-T *
16602638-C-CTT 14490758-C-CTT 15×T****
17406354-A-AT 15294474-A-AT 9×T*
13489525-C-T 11333849-C-T *
8449678-C-CA 8581637-C-CA 10×A*
15538026-G-GA 13426146-G-GA 9×A*
17315494-A-G 15203614-A-G YY*
13487807-G-T 11332131-G-T *
5309500-TA-T 5441459-TA-T 11×A*
56831638-C-G *
28547088-TAAA-T 26400941-TAAA-T 14×A*
28813237-C-G 26667090-C-G *
21786060-A-G 19624174-A-G YY*
6457773-TAAA-T 6589732-TAAA-T 15×A*
13487766-C-T 11332090-C-T *
5924713-G-GAA 6056672-G-GAA 10×A*
3595334-GA-G 3727293-GA-G 12×A*
13489632-C-G 11333956-C-G *
21905283-CAAAA-C 19743397-CAAAA-C 16×A***
15846644-AT-A 13734764-AT-A 10×T*
9060231-G-GT 9222622-G-GT 9×T*
15559250-C-CA 13447370-C-CA 9×A*
13489821-G-T 11334145-G-T *
13450161-C-T 11294485-C-T *
3444262-A-G 3576221-A-G *
21430333-T-TA 19268447-T-TA 10×A*
13489512-G-T 11333836-G-T *
6445014-T-C 6576973-T-C *
6080268-CA-C 6212227-CA-C 10×A*
21924146-A-T 19762260-A-T FT210642 YY*
17574408-A-AT 15462528-A-AT 9×T*
7161513-G-GTT 7293472-G-GTT 14×T*
5666756-T-TA 5798715-T-TA 10×A*
14515608-G-T 12403809-G-T YY*
22069329-AT-A 19907443-AT-A 8×T*
17614036-ATT-A 15502156-ATT-A 12×T*
4560576-G-GA 4692535-G-GA 8×A*
15621283-TA-T 13509403-TA-T 10×A*
13214292-T-C 11058616-T-C *
6038133-A-G 6170092-A-G *
22916889-G-A 20755003-G-A YY*
17528347-G-A 15416467-G-A BY33253 Y71849 YY*
13489672-G-T 11333996-G-T *
15359833-TA-T 13247953-TA-T 8×A*
14125248-G-GAA 12004542-G-GAA 14×A*
15392810-T-TAA 13280930-T-TAA 13×A*
13855522-GATGGAATGGA-G,GATGGA 11734816-GATGGAATGGA-G,GATGGA 11×ATGGA*
14232642-CT-C 12111936-CT-C *
4434743-A-G 4566702-A-G *
15035213-GA-G 12923301-GA-G 10×A*
23046036-T-C 20884150-T-C YY*
23046030-G-T 20884144-G-T YY*
13447728-C-T 11292052-C-T *
56826133-G-A *
16466226-G-GTT 14354346-G-GTT 11×T*
13272696-A-G 11117020-A-G *
56849510-T-C *
9730344-CAT-C 9892735-CAT-C IR3_Prx *
9951062-C-CA 10113453-C-CA 9×A*
4712855-C-CA 4844814-C-CA 10×A*
13487793-C-T 11332117-C-T *
4566368-C-A 4698327-C-A ***
18672568-G-A 16560688-G-A YY*
3179738-GT-G 3311697-GT-G 11×T*
8715929-G-GA 8847888-G-GA 9×A*
3342287-A-AT 3474246-A-AT 10×T*
13448307-C-G 11292631-C-G *
22200355-CA-C,CAAA 20038469-CA-C,CAAA 13×A*
18735955-C-T 16624075-C-T FT355903 Y*
10921963-TAA-T *
13489541-G-T 11333865-G-T *
56878253-GCA-G 9×CA*
27862604-A-C 25716457-A-C P1_Y2 *
13448315-C-A 11292639-C-A *
7581513-AT-A 7713472-AT-A 10×T*
23789324-G-GTT 21627438-G-GTT 13×T*
15411137-TA-T 13299257-TA-T 8×A*
13692849-C-A 11537173-C-A *
5252939-C-CA 5384898-C-CA 10×A*
17648009-CA-C,CAA 15536129-CA-C,CAA 17×A*
3952340-TGAGAGAGA-T 4084299-TGAGAGAGA-T 20×GA*
2817890-CA-C 2949849-CA-C 9×A*
59003835-C-T 56857688-C-T *
25866495-C-CA 23720348-C-CA P1_Y1 10×A*
18672567-G-A 16560687-G-A YY*
17580795-G-T 15468915-G-T YY*
9124294-C-G 9286685-C-G Y*
13283132-G-T 11127456-G-T *
9124293-C-G 9286684-C-G Y*
3833256-G-GA 3965215-G-GA 10×A*
2945859-T-C 3077818-T-C *
28805690-G-A 26659543-G-A *
28805688-G-C 26659541-G-C *
16528431-TA-T 14416551-TA-T 9×A*
13964228-T-C 11843522-T-C Y*
13450102-C-A 11294426-C-A *
23961295-G-GAA 21815148-G-GAA 12×A*
13450842-T-TCCCCATCCCA,TCTCCATGCCA 11295166-T-TCCCCATCCCA,TCTCCATGCCA *
5368222-G-A 5500181-G-A *
5915290-T-TA 6047249-T-TA 9×A*
4679748-AT-A 4811707-AT-A 9×T*
21894633-CAAA-C 19732747-CAAA-C 15×A*
16328493-AT-A 14216613-AT-A 10×T*
9495851-A-AT 9658242-A-AT 10×T*
21873566-CAAA-C 19711680-CAAA-C 14×A*
14474100-G-GA 12353369-G-GA 10×A****
8422324-CTGTG-C 8554283-CTGTG-C 15×TG*
17654010-C-CT 15542130-C-CT 8×T*
4812825-T-C 4944784-T-C F14741 *
5630211-A-C 5762170-A-C *
5630188-T-C 5762147-T-C *
5586317-G-C 5718276-G-C PF3611 *
5344873-C-A 5476832-C-A *
5172202-T-TA 5304161-T-TA 10×A*
5035428-G-C 5167387-G-C *
4870602-CTG-C 5002561-CTG-C 8×TG*
4500084-C-T 4632043-C-T *
5637628-C-G 5769587-C-G *
4433972-C-A 4565931-C-A *
4358682-CCA-C 4490641-CCA-C *
3637683-C-T 3769642-C-T *
3577098-T-TGACAG 3709057-T-TGACAG *
3388039-G-A 3519998-G-A *
3301258-T-TAC 3433217-T-TAC 15×AC*
3301243-TTA-T 3433202-TTA-T 8×TA*
3045212-T-G 3177171-T-G *
5636246-A-G 5768205-A-G *
5679938-T-C 5811897-T-C *
2942686-ATG-A 3074645-ATG-A 11×TG*
16960667-AAC-A 14848787-AAC-A *
28697477-TAC-T 26551330-TAC-T *
28594590-TTG-T 26448443-TTG-T 10×TG*
27467214-T-G 25321067-T-G FGC7648 P1_Y2 5×TTAG****
24355605-CAT-C 22209458-CAT-C *
23974384-TTG-T 21828237-TTG-T *
22185678-CA-C 20023792-CA-C 9×A*
17488779-GCA-G 15376899-GCA-G 8×CA*
14198038-GCA-G 12077332-GCA-G 8×CA*
5786159-AAC-A 5918118-AAC-A 8×AC*
13451191-T-TC 11295515-T-TC *
8883602-AAC-A 9015561-AAC-A 8×AC*
7333253-GTC-G 7465212-GTC-G 8×TC*
7154826-C-A 7286785-C-A Y*
6614513-GGT-G 6746472-GGT-G 9×GT*
6019335-A-T 6151294-A-T *
6019333-A-G 6151292-A-G *
5906857-GCA-G 6038816-GCA-G *
3037897-G-A 3169856-G-A *
2921781-C-A 3053740-C-A *
58976357-C-CTCCACTCCACTCCAT 56830210-C-CTCCACTCCACTCCAT *
58980228-G-GCACTCCACTC 56834081-G-GCACTCCACTC *
13295372-A-ATT 11139696-A-ATT 13×T*
16813075-G-GCA 14701195-G-GCA 15×CA*
5633674-G-A 5765633-G-A FGC11311 *
13470254-C-T 11314578-C-T *
14358235-A-G 12237530-A-G CTS2546 M1342 YY*
7921967-G-GA 8053926-G-GA 10×A*
14168426-AT-A 12047720-AT-A A848BY11750 9×T*
25997597-C-CA 23851450-C-CA P1_Y1 10×A*
4998922-C-CA 5130881-C-CA 12×A*
58975664-T-TTCCATTCCATTCCCG 56829517-T-TTCCATTCCATTCCCG *
58972530-G-C 56826383-G-C *
23139032-T-TA 20977146-T-TA A7537 9×A*
9831597-ATCTC-A 9993988-ATCTC-A 11×TC*
13451536-G-C 11295860-G-C *
22864065-GAC-G 20702179-GAC-G 12×AC*
5957089-T-TAC 6089048-T-TAC Z2956 12×AC*
9640889-TTGTG-T 9803280-TTGTG-T IR3_Prx 22×TG*
13470244-GT-G 11314568-GT-G *
18640859-TA-T 16528979-TA-T 10×A*
5632865-T-A 5764824-T-A *
13489675-G-C 11333999-G-C *
5632856-G-T 5764815-G-T 8×A*
21440711-T-TA 19278825-T-TA 8×A*
18512434-CTGTG-C 16400554-CTGTG-C P6_Dst 17×TG*
23144515-TA-T 20982629-TA-T 9×A*
15842844-A-G 13730964-A-G V3169 YY*
2945865-C-A 3077824-C-A *
22093166-T-TTG 19931280-T-TTG 22×TG*
13468303-G-A 11312627-G-A *
17145728-GA-G 15033848-GA-G 11×A*
9013409-A-AT 9175800-A-AT 10×T*
13471842-T-A 11316166-T-A *
18560153-G-GT 16448273-G-GT 38:26092490T>TA 8×T*
17278117-C-T 15166237-C-T BY187606 YY*
4136641-TACAC-T 4268600-TACAC-T 20×AC*
22793814-CT-C 20631928-CT-C 10×T*
2902839-C-T 3034798-C-T Z43714 YY*
4776622-A-AAC 4908581-A-AAC 20×AC*
28716640-C-T 26570493-C-T CTS12830 PF1935 *
58980527-T-TTCCGTTCCATTCCAC 56834380-T-TTCCGTTCCATTCCAC *
8540124-T-TTG 8672083-T-TTG 10×TG*
22701592-G-GT 20539706-G-GT 9×T*
18162466-CGGAT-C 16050586-CGGAT-C 9×GGAT*
16308643-G-T 14196763-G-T FGC46919 YY*
13942606-TAC-T 11821900-TAC-T 9×AC*
13478262-G-A 11322586-G-A *
7803353-G-GA 7935312-G-GA 10×A*
13471853-G-A 11316177-G-A *
14642670-CT-C 12530739-CT-C 10×T*
18628940-TACAC-T 16517060-TACAC-T 12×AC*
15028397-C-CT 12916485-C-CT 11×T*
14897845-G-GT 12785911-G-GT 10×T*
17919692-A-AG 15807812-A-AG FGC22503 8×G*
58975667-C-CATTCCAGTCT 56829520-C-CATTCCAGTCT *
22562563-CAAATAAAT-C 20400677-CAAATAAAT-C BY3569 9×AAAT***
58970175-A-T 56824028-A-T *
13718874-C-A 11563198-C-A *
13470897-G-A 11315221-G-A *
5587108-A-C 5719067-A-C A13692 *
16638316-C-CTG 14526436-C-CTG 12×TG*
8151410-AT-A 8283369-AT-A 10×T*
4064345-T-TA 4196304-T-TA 11×A*
14430898-T-TTC 12310171-T-TTC 9×TC*
15586127-G-GA 13474247-G-GA 9×A*
18940147-G-GA 16828267-G-GA 11×A*
8793189-CT-C 8925148-CT-C 10×T*
14465787-G-GT 12345060-G-GT 10×T*
3249466-TTGTG-T 3381425-TTGTG-T 17×TG*
8597500-CTT-C 8729459-CTT-C 12×T*
8300622-G-GA 8432581-G-GA 10×A*
23158148-G-GA 20996262-G-GA 10×A*
13449372-C-CTCCACTCCACTCCATTCCAG 11293696-C-CTCCACTCCACTCCATTCCAG *
23619781-TA-T 21457895-TA-T 10×A*
58990998-A-G 56844851-A-G *
58978425-ACCATT-A 56832278-ACCATT-A *
4767593-AT-A 4899552-AT-A 12×T*
3899454-ATT-A 4031413-ATT-A 16×T*
3013453-A-T 3145412-A-T *
22516641-CA-C 20354755-CA-C 10×A*
8034114-A-AT 8166073-A-AT 10×T*
2781125-AT-A 2913084-AT-A 10×T*
17589287-AT-A 15477407-AT-A 10×T*
22468611-T-G 20306725-T-G FGC81856 DYZ19 *
6600604-G-T 6732563-G-T *
14992933-TCA-T 12881018-TCA-T 11×CA*
14868989-GGT-G 12757059-GGT-G *
14352669-G-A 12231964-G-A CTS2536 PF3707 YY*
14004508-GCA-G 11883802-GCA-G 9×CA*
13451531-C-CTGAAG 11295855-C-CTGAAG *
13448281-A-ATTCTG 11292605-A-ATTCTG *
10048895-A-G 10211286-A-G FGC33595 *
6508907-G-GT 6640866-G-GT 9×T*
18596093-C-T 16484213-C-T A4950 YY*
5592218-G-A 5724177-G-A FTB16631 *
5546681-TAC-T 5678640-TAC-T 10×AC*
4267560-TTC-T 4399519-TTC-T *
3514581-T-C 3646540-T-C ****
23823644-CT-C 21661758-CT-C 9×T****
21720034-CA-C 19558148-CA-C 10×A*
9485887-T-TCA 9648278-T-TCA 12×CA*
3418744-AACAC-A 3550703-AACAC-A 16×AC*
16608708-CAG-C 14496828-CAG-C *
18698807-GCA-G 16586927-GCA-G *
13468331-G-C 11312655-G-C *
19057876-CAAA-C 16945996-CAAA-C 13×A*
13489734-C-A 11334058-C-A *
14196783-CCTCT-C 12076077-CCTCT-C 10×CT*
9845461-C-CA 10007852-C-CA 12×A*
23996211-C-CT 21850064-C-CT 10×T*
23535788-C-A 21373902-C-A BY146030 YY8×A*
3404731-G-GA 3536690-G-GA 11×A*
23181453-CA-C 21019567-CA-C 34×A*
13470630-C-T 11314954-C-T *
21767448-AAAC-A 19605562-AAAC-A 5×AAC*
59024972-A-G 56878825-A-G *
59016426-G-A 56870279-G-A *
59010148-G-A 56864001-G-A *
58976505-C-T 56830358-C-T *
58976477-C-CTCCAT 56830330-C-CTCCAT *
28817147-TGTGGA-T 26671000-TGTGGA-T *
24377735-AAG-A 22231588-AAG-A *
21773695-AAAT-A 19611809-AAAT-A 5×AAT****
28813241-G-A 26667094-G-A *
22752519-CA-C,CAA 20590633-CA-C,CAA 16×A*
22940686-GT-G 20778800-GT-G 10×T*
2828718-A-G 2960677-A-G YY*
2901662-T-C 3033621-T-C YY*
2868517-C-A 3000476-C-A YY*
2863838-T-C 2995797-T-C YY*
2862941-C-T 2994900-C-T YY*
2861853-A-T 2993812-A-T YY*
2861848-G-A 2993807-G-A YY*
2831544-A-T 2963503-A-T YY*
2823849-G-T 2955808-G-T YY*
2922212-A-G 3054171-A-G *
2819928-C-G 2951887-C-G YY*
2815836-T-C 2947795-T-C YY*
2808765-T-C 2940724-T-C YY*
2759176-G-A 2891135-G-A YY*
2740287-A-T 2872246-A-T YY*
2729553-T-C 2861512-T-C YY*
2706584-C-T 2838543-C-T YY*
2706564-G-A 2838523-G-A YY*
2920994-T-C 3052953-T-C *
2926219-T-C 3058178-T-C *
2654094-T-A 2786053-T-A Y*
3042609-A-T 3174568-A-T *
3134227-G-T 3266186-G-T *
3134217-C-A 3266176-C-A *
3090949-C-A 3222908-C-A *
3088876-T-C 3220835-T-C *
3081521-T-C 3213480-T-C *
3070364-T-C 3202323-T-C *
3064037-A-G 3195996-A-G *
3036327-CTTTT-C 3168286-CTTTT-C 12×T*
2935917-C-A 3067876-C-A *
3034517-A-T 3166476-A-T *
3033271-G-T 3165230-G-T *
3013076-T-C 3145035-T-C *
2970099-C-G 3102058-C-G *
2964955-A-T 3096914-A-T *
2961265-CA-C 3093224-CA-C 9×A*
2942126-A-G 3074085-A-G *
2940382-A-G 3072341-A-G *
2680658-A-G 2812617-A-G Y*
13865969-C-CGAATG,CGAATGGAATG 11745263-C-CGAATG,CGAATGGAATG 12×GAATG*
3134242-G-T 3266201-G-T *
3589478-T-C 3721437-T-C *
13940752-C-T 11820046-C-T Y****
8069959-ATTTT-A,ATT 8201918-ATTTT-A,ATT 19×T****
6580296-C-G 6712255-C-G ***
6453276-G-A 6585235-G-A ****
4553954-A-G 4685913-A-G ****
2842149-T-TA 2974108-T-TA ****
23040157-T-TAA 20878271-T-TAA 17×A*
13489686-CAT-C 11334010-CAT-C *
15041669-A-G 12929759-A-G YY****
4494380-A-T 4626339-A-T *
23000440-A-AT 20838554-A-AT 9×T*
17959790-CA-C 15847910-CA-C 8×A*
11334025-C- *
8564949-CA-C 8696908-CA-C 8×A*
56837309-CATCTCTGAACTGATCAACCAAGTGATGTAACCCTTGTCTAGGCTCTGCCTACAGGAGCTTTGTGACA- *
56845065-CTA-C *
13450172-CACTCCATT-C 11294496-CACTCCATT-C *
14795026-C-A 12683097-C-A Y****
15076421-T-C 12964511-T-C YY***
5259849-C-T 5391808-C-T *
22804546-A-G 20642660-A-G YY****
10673071-G- *
28662851-A-T 26516704-A-T ****
28563186-TA-T 26417039-TA-T ***
26730254-A-G 24584107-A-G P1_g2 ****
24416977-G-A 22270830-G-A Y****
23196849-C-T 21034963-C-T Y****
23196842-C-T 21034956-C-T Y****
21989512-T-C 19827626-T-C YY***
15435387-A-T 13323507-A-T YY****
21915104-A-G 19753218-A-G Y***
19183631-C-T 17071751-C-T Y****
18395389-A-G 16283509-A-G P6_Gap ****
18144591-G-A 16032711-G-A YY****
16872157-T-C 14760277-T-C YY***
15882429-GT-G,GTT 13770549-GT-G,GTT 13×T****
15604815-T-C 13492935-T-C YY****
15437416-TA-T 13325536-TA-T ****
3134233-G-T 3266192-G-T *
3138334-TG-T 3270293-TG-T *
10860928-T-TTACACTCCAC *
4159806-T-A 4291765-T-A *
4198951-C-A 4330910-C-A *
4198944-A-T 4330903-A-T *
4198943-T-C 4330902-T-C *
4198933-A-T 4330892-A-T *
4189013-T-C 4320972-T-C *
4185526-G-A 4317485-G-A *
4169647-C-T 4301606-C-T *
4140178-A-AG 4272137-A-AG *
4198959-A-G 4330918-A-G *
4131789-G-T 4263748-G-T *
4124136-G-C 4256095-G-C *
4110132-T-G 4242091-T-G *
4101257-T-TA 4233216-T-TA *
4082148-G-A 4214107-G-A *
4014331-A-T 4146290-A-T *
4008588-CAA-C 4140547-CAA-C 10×A*
3973983-T-TA 4105942-T-TA *
4198958-C-T 4330917-C-T *
4205520-C-T 4337479-C-T *
3935506-A-C 4067465-A-C *
4340384-T-C 4472343-T-C *
4415711-G-T 4547670-G-T *
4415658-C-T 4547617-C-T *
4409089-T-C 4541048-T-C *
4397887-A-G 4529846-A-G *
4390006-GA-G,GAA 4521965-GA-G,GAA 10×A*
4353938-C-G 4485897-C-G *
4342634-A-G 4474593-A-G *
4307673-T-C 4439632-T-C *
4216277-A-T 4348236-A-T *
4279334-T-C 4411293-T-C *
4273440-A-G 4405399-A-G *
4273192-G-A 4405151-G-A *
4262131-T-C 4394090-T-C *
13451188-C-A 11295512-C-A *
4231536-C-A 4363495-C-A *
4223027-TA-T 4354986-TA-T *
4216792-G-A 4348751-G-A *
3949428-G-T 4081387-G-T *
3930212-C-G 4062171-C-G *
3164864-G-A 3296823-G-A *
3270806-T-C 3402765-T-C *
3444423-G-A 3576382-G-A FT317268 *
3423925-C-T 3555884-C-T *
3416805-TA-T 3548764-TA-T 8×A*
3360292-G-A 3492251-G-A *
3337890-T-C 3469849-T-C *
3292396-T-C 3424355-T-C *
3288573-C-T 3420532-C-T *
3248592-T-C 3380551-T-C *
3542139-C-T 3674098-C-T *
3232296-T-C 3364255-T-C *
3229535-TTGTG-T,TTG 3361494-TTGTG-T,TTG 15×TG*
3215358-C-G 3347317-C-G *
3209599-G-A 3341558-G-A *
3199934-G-C 3331893-G-C *
3193360-G-A 3325319-G-A *
3188085-A-G 3320044-A-G *
3179250-G-GTC 3311209-G-GTC *
3479045-G-T 3611004-G-T *
3595805-T-C 3727764-T-C *
3919644-G-A 4051603-G-A *
3759778-A-G 3891737-A-G *
3919599-G-A 4051558-G-A *
3916476-A-G 4048435-A-G *
3914932-C-T 4046891-C-T FT254108 *
3892598-G-A 4024557-G-A *
3837813-G-A 3969772-G-A *
3785963-T-C 3917922-T-C *
3766363-C-T 3898322-C-T *
3742524-C-T 3874483-C-T *
3596861-C-G 3728820-C-G *
3738138-A-C 3870097-A-C *
3658671-T-C 3790630-T-C *
3635441-G-A 3767400-G-A *
3629481-G-A 3761440-G-A *
3626943-A-C 3758902-A-C *
3618813-A-G 3750772-A-G *
3610430-A-G 3742389-A-G *
3603373-C-T 3735332-C-T *
11334023-G- *
56837307-CA- *
3617523-A-T 3749482-A-T *
15938096-TAC-T 13826216-TAC-T *
9785773-C-CA 9948164-C-CA 8×A*
17351381-CT-C 15239501-CT-C 10×T*
23345788-G-A 21183902-G-A YY*
6022074-A-G 6154033-A-G *
13478017-C-T 11322341-C-T ****
13478041-T-G 11322365-T-G *
23790741-AT-A 21628855-AT-A 9×T*
7587994-GA-G 7719953-GA-G 10×A*
17787106-CAAA-C,CAA 15675226-CAAA-C,CAA 19×A*
3008588-C-G 3140547-C-G *
17283356-A-G 15171476-A-G YY***
28817647-AGGAATGGAAT-A,AGGAAT 26671500-AGGAATGGAAT-A,AGGAAT 9×GGAAT*
2990866-CA-C 3122825-CA-C 8×A*
2925421-T-TA 3057380-T-TA 10×A*
5035398-GA-G 5167357-GA-G 10×A*
6575535-A-T 6707494-A-T FT75603 *
6457074-GT-G 6589033-GT-G 9×T*
4797787-A-C 4929746-A-C *
21940981-CA-C 19779095-CA-C 9×A*
10921961-T-TCC *
56831650-C-G *
56830331-T-TCCACG *
5421472-ATCCC-A 5553431-ATCCC-A 4×TCCC*
56830300-C-CCATGCCAT *
56830299-A-ATT *
56826916-C-CCATTCCATTA *
21753670-A-AT *
10884980-TTCACTGCAC-T *
10852787-T-G *
10884838-TTTCCATTCC-T *
10884836-GC-G *
10678045-TC-T *
10678040-TCCAC-T *
10676896-C-A *
10672974-GAA-G *
10672973-G-GTT *
8439884-A-AT 8571843-A-AT 10×T*
21717473-TA-T 19555587-TA-T 10×A*
8513858-G-GA 8645817-G-GA 8×A*
56831657-AGTC-A *
10663429-TCACTCCAC-T *
16406924-A-G 14295044-A-G YY*
28474965-CA-C,CAA 26328818-CA-C,CAA 18×A*
2853889-AT-A 2985848-AT-A 9×T*
15698321-G-GA 13586441-G-GA 8×A*
18728737-AC-A 16616857-AC-A *
5728904-C-CAG 5860863-C-CAG 12×AG*
13489818-G-A 11334142-G-A *
15603128-G-A 13491248-G-A FGC63038 YY*
5343099-G-GT 5475058-G-GT 10×T****
14768822-T-A 12656891-T-A BY169981 YY*
10673916-TCCATTCCATTCCATTCCATTCCATTGCACC-T *
56831661-G-A *
13489546-C-A 11333870-C-A *
18563077-G-GA 16451197-G-GA 9×A*
7104310-A-AT 7236269-A-AT 9×T*
17878118-CCTT-C 15766238-CCTT-C *
8604181-CTT-C 8736140-CTT-C 11×T*
18672584-G-A 16560704-G-A YY*
15566817-GAAAAAAAA-G 13454937-GAAAAAAAA-G 22×A****
4158086-A-AT 4290045-A-AT 10×T*
22863415-T-A 20701529-T-A YY*
8715306-G-GAA 8847265-G-GAA 14×A*
3637403-T-C 3769362-T-C *
4106178-C-T 4238137-C-T *
3850999-AT-A 3982958-AT-A 8×T*
3211011-G-GA 3342970-G-GA *
16773429-T-G 14661549-T-G YY*
28813240-C-G 26667093-C-G *
22863414-C-G 20701528-C-G YY*
59006822-A-AC 56860675-A-AC *
22863413-T-A 20701527-T-A YY*
3451063-C-G 3583022-C-G *
3036385-G-GA 3168344-G-GA 9×A*
10045598-G-A 10207989-G-A BY209689 *
23476464-CA-C 21314578-CA-C 10×A*
3897905-G-GT 4029864-G-GT 10×T*
6046517-GA-G 6178476-GA-G 9×A*
14753642-GA-G 12641711-GA-G 10×A*
56831654-TCC-T *
56830325-C-CTCCATTCCAT *
56831671-CACTAAACTCG-C *
56833368-T-TCCATTCCATTCCAC *
56860676-A-AC *
56835847-C-CCACTCCATTCCACT *
13873864-T-C 11753158-T-C Y*
56825930-GATTTCATTCCATTCA-G *
13687698-A-ACC 11532022-A-ACC *
10693754-C-CGA *
22184517-G-A 20022631-G-A YY*
56833367-A-AC *
26480505-CA-C 24334358-CA-C P1_Y1 9×A*
10673070-TGA-T *
10673069-A-ACTCCTTCCACTCCATT *
6402086-A-ACTGGTGTCGTAAAATACTGACGTATATCTAACT 6534045-A-ACTGGTGTCGTAAAATACTGACGTATATCTAACT *
56834078-A-ACTG *
56832357-C-CCACTCCTTTCCATTCCACTCCTTTCCACTCCACTCCCCTCCAA *
10677518-T-TTCCATTCCATTCCTTTCCATTCCATTCCATTCCATTCCGC *
10673052-A-ACAATC *
5320593-T-A 5452552-T-A *
56826965-T-TCC *
56835940-A-ACTCCACTCAATTCCACTCCACGCAATTCCACTCCACTCAATTCCACTCCACTCTG *
56827687-T-C,TGCCATCCGATTC *
10860923-T-C *
4103175-CT-C,C 4235134-CT-C,C 13×T*
56835187-TCCACTTCACTCCACTCCACTCCTCTGCAGTCCAC- *
56835185-AC- *
13451897-T-TTC 11296221-T-TTC *
56834790-C-CATTCCACTCCACTCCATTCA,CATTCCATTCCACTCCACTCA *
56834779-G-GCGTTC 4×CATTC*
11296304-CACCACTCCACTGCTCTCCAA- *
56837186-AT-A *
11295257-TTCTAC- *
4792510-A-AG 4924469-A-AG *
3480844-C-CTG 3612803-C-CTG *
13470680-G-A 11315004-G-A *
10632823-ATTCCATTCCTTTTCTTCGACAGGATCTCGCTCTGTCACTCAGGCTGGAGTGCAGTGGCACAATCTCAGCTCACATTTCATTTCACCATTCC-A,A *
2933053-GTGTTTTCTTTTGTTTTGTTC-G 3065012-GTGTTTTCTTTTGTTTTGTTC-G *
56837188-CACCCAAGTGATGTAACACTTGACTATGCTCTGCCTATTGGGGCATAGTGACATATCACTGCATTGATCACTCAGATGTTGTAGCTCTTGCCTAGGCTCTGCCTACATGGGCATTGTGACACATCTCTGAACTGATCAACCAAGTGATGTAACCCTTGTCTAGGCTCTGCCTACAGGAGCTTTGTGACATATCTCTGCACTGAT-C *
13478010-G-A 11322334-G-A ****
6402084-A-ATATT 6534043-A-ATATT *
56826850-TCC-T *
56825979-GCATTCCATTCGAGTTCATTCCATTCGAGTTCCTTCCATTCGAGTTCATTCCATTCGAGTT-G *
10678018-ATTG-A *
56832860-ATTCCATTCCACTCTATTCCACTCCACTCAACTCAATTCCACTCCCCTCCACTCCACTCCATTCCACTCCATTCCACTCCCCTCCCCTCCATTGCATTCCC-A *
13449362-T-TCCACTCCACTCCAC 11293686-T-TCCACTCCACTCCAC *
10662169-C-CTCCACTGCACTCCATTCCATTCCATTCCAT *
13448063-T-TC 11292387-T-TC *
8708375-ATGTG-A 8840334-ATGTG-A 15×TG*
56826912-C-CATTTG *
13451172-G-GCAATC 11295496-G-GCAATC *
13452707-TCTCC-T 11297031-TCTCC-T *
13489764-G-T 11334088-G-T *
13448643-CCATTCCATTCCATTCCATTCCATT-C 11292967-CCATTCCATTCCATTCCATTCCATT-C *
13448640-ATT-A 11292964-ATT-A *
56886095-C-CAA 11×A*
56833893-G-GTCCACT,T *
56833892-C-CTCCATTCCA *
22420031-ATCACTTCAAGAATGAAGCTGCAGACCTTTACGGTGGGTGTTACAGCACTTAAAGGTGTTATGTCCAGAGTTTGTTCATTCGGATGTGTCCAGAATTTCTTCCTTCTGGCAGGTTCATGGTCTTGC-A 20258145-ATCACTTCAAGAATGAAGCTGCAGACCTTTACGGTGGGTGTTACAGCACTTAAAGGTGTTATGTCCAGAGTTTGTTCATTCGGATGTGTCCAGAATTTCTTCCTTCTGGCAGGTTCATGGTCTTGC-A DYZ19 *
56826853-ATTCCATTCAATTC-A *
13452064-G-GCCCCA 11296388-G-GCCCCA *
56851299-A-AAGACATATCTCTGCACTGATCACCCCAGGGAGAGAATTCTTGTTTAGGCTCTGCCTACAGGGGGCTTTG *
13450608-CCA-C 11294932-CCA-C *
19180464-TA-T 17068584-TA-T 9×A*
7967103-T-C 8099062-T-C FTA2298 Y*
22746246-AT-A 20584360-AT-A 10×T*
56834514-TCTCCATTCCATTCCACTCCACTCCATTCCATACCATTCCATTCCA-T *
56850094-G-GATCACTCAGGTGATGGGTCTATTTTCTATACTCTGCCTAGAGGTGGATTCGTGACATAATCTCTGTACTA *
13450611-TTCC-T 11294935-TTCC-T *
13452712-ACTACTC-A 11297036-ACTACTC-A *
56831613-TTCCATTCCTCTCTATTTCAC-T *
56835860-A-ATTCC *
56844225-TTCTTGTCTAGGCTCTGCGAACAGGGGCATTTTAACTTATCACTGCACTGATCATCGAGGTGATGCAAC-T *
56844846-T-A *
10889255-TGCCATG-T *
10889250-TGCCA-T *
56877861-A-C *
28570015-T-G 26423868-T-G CTS12300 **
28030732-C-T 25884585-C-T P1_Y2 **
4277231-T-C 4409190-T-C **
13340566-T-C 11184890-T-C **
13457976-C-A 11302300-C-A ***
13457987-G-C 11302311-G-C ***
13457948-T-A,TACTGCAC 11302272-T-A,TACTGCAC 5×TCCAC***
14771126-CTTT-C,CTTTT 12659195-CTTT-C,CTTTT 16×T***
13223489-AGAGGGAGAGAAGGG-A 11067813-AGAGGGAGAGAAGGG-A ***
13705479-T-A 11549803-T-A ***
17633833-A-G 15521953-A-G ***
22287213-C-G 20125327-C-G BY51574 DYZ19 ***
22290157-T-A 20128271-T-A DYZ19 ***
24753218-G-A 22607071-G-A P3_b2 ***
5405300-G-T 5537259-G-T 17×T***
13483261-T-C 11327585-T-C ***
4275281-C-CA 4407240-C-CA ***
13332106-G-A 11176430-G-A ***

In the table above, the meaning of the confidence field depends on whether the data comes from an FTDNA kit or an FGC kit. For FTDNA kits, + implies a "PASS" result with just one possible variant, * indicates a "PASS" but with multiple variants, ** indicates "REJECTED" with just a single variant, and *** indicates "REJECTED" with multiple possible variants. 'A*' are heterozygous variants not called by FTDNA, but still pulled from the VCF file. For FGC kits, + indicates over 99% likely genuine (95% for INDELs); * over 95% likely genuine (90% for INDELs); ** about 40% likely genuine; *** about 10% likely genuine. Manual entries read directly from a BAM file will be either + indicating positive, or * indicating that the data show a mixture of possible variants.

For the FTDNA kits, the BED data is encoded in the background color of the cells. Those cells with a white background have coverage, those with a grey background indicate no coverage in the BED file, and those with a pink background indicate the mutation is on the edge of a coverage region. These pink regions often indicate that the individual may be positive for a SNP even if there is no corresponding entry in the vcf file.

The combBED column indicates whether or not the mutation is a SNP and falls in the combBED region defined in Defining a New Rate Constant for Y-Chromosome SNPs based on Full Sequencing Data by Dmitry Adamov, Vladimir Guryanov, Sergey Karzhavin, Vladimir Tagankin, Vadim Urasin.

The McDonald BED column indicates whether or not the mutation is a SNP and falls in the BED region used by Dr. Iain McDonald in the age analysis he does for R-U106 men.

Age Analysis Information (work in progress)

AllMcDonaldYFull
Kit: 122831060349376546257720689
Kit: 122831444755291018018120209
Kit: 122831389679887571567879384
Used in age calculations1444755291018018120209
Counts of SNPs447386
Variant counts last updated 2022-11-23 03:22:39.



Big Tree Main Page