Tree Position

R-P312/S116 > Z290 > L21/S145 > S552 > DF13 > ZZ10 > MC14 > Y16773 > BY31281 > FT27339 > A7298 > A7299 > A6138 > ~6424555-T-C > 12880506-C-T

Unique Mutations

The mutations unique to this man are summarized in the table below. Those with a '+' or '*' confidence level are considered by FamilyTreeDNA or FullGenomesCorp to be high quality SNPs/INDELs. For completeness, all other mutations of lesser confidence are included as well. These additional mutations may be useful for distinguishing between very closely related men.

Occasionally, some of the mutations listed here will be thought to be shared with other men in which case they might appear in upstream blocks on the tree. When this happens, the 'Blocks' field will indicate what block they appear in. Such a situation might arise with BigY men if the BED data suggests another man may be positive for a SNP, even though it doesn't appear in his VCF data. It might also happen if Chromo2 testing or Sanger sequencing of other men not on the tree show the SNP to be shared.

POS-REF-ALT (hg19) POS-REF-ALT (hg38) Blocks Names Region McDonald BED combBED STRYSEQ
34066
24422478-C-CAA 22276331-C-CAA 43×A+
22238398-CTGAACACATCTGAAGGAACAAACTCTGGACATAACA-C 20076512-CTGAACACATCTGAAGGAACAAACTCTGGACATAACA-C DYZ19 +
22462297-CAGGTTCATGGTCTTGCTCACTTCAAGAATGAAACTGCGGACCCTTACGGTGAGTGTTACAGAACTTAAAAGTGTTATGTCTAGATTTTGTTCCTTCAGATGTGTCCAGTTTCTTCCGTCTGGA-C 20300411-CAGGTTCATGGTCTTGCTCACTTCAAGAATGAAACTGCGGACCCTTACGGTGAGTGTTACAGAACTTAAAAGTGTTATGTCTAGATTTTGTTCCTTCAGATGTGTCCAGTTTCTTCCGTCTGGA-C DYZ19 +
9832612-C-T 9995003-C-T YY+
22360979-A-ACAGCACTTAAAGGTGTTATGTCCAGAGTTTGTTCCTTCAGATGTGTCCAGTGTTTCTTCCTTCTGGCAGGTTCATGGTGTTGCTCACTTCAAGAATGAAGCTGCAGACCTTACTGGTGAGTGTTACAGCACACAAAGGTGTTATGTGCAGAGTTTGTTCCTTCAGATGTGTCCAGAGTTTCTTCCTTCTTGCAGGTTGGTGGTCTTGCTCACTTCCTTAATGGAGCTGCAGACCTTACTGGTGAATGTTG 20199093-A-ACAGCACTTAAAGGTGTTATGTCCAGAGTTTGTTCCTTCAGATGTGTCCAGTGTTTCTTCCTTCTGGCAGGTTCATGGTGTTGCTCACTTCAAGAATGAAGCTGCAGACCTTACTGGTGAGTGTTACAGCACACAAAGGTGTTATGTGCAGAGTTTGTTCCTTCAGATGTGTCCAGAGTTTCTTCCTTCTTGCAGGTTGGTGGTCTTGCTCACTTCCTTAATGGAGCTGCAGACCTTACTGGTGAATGTTG DYZ19 +
5630204-A-G 5762163-A-G +
5887949-T-A 6019908-T-A +
5996599-CT-C 6128558-CT-C 41×T+
6092948-CT-C 6224907-CT-C 39×T+
22642522-G-A 20480636-G-A Y+
22238436-CTTTAAGTGCTATGACACTCACCGTAAAGTTCTGCAGCTTCATTCTTGAAGTGTGCAAGACCATGAACCTG-C 20076550-CTTTAAGTGCTATGACACTCACCGTAAAGTTCTGCAGCTTCATTCTTGAAGTGTGCAAGACCATGAACCTG-C DYZ19 +
22489849-T-C 20327963-T-C DYZ19 +
21787726-C-T 19625840-C-T Y+
10080211-C-T 10242602-C-T +
9032564-G-A 9194955-G-A +
13472472-CA-C,TA 11316796-CA-C,TA *
13470382-T-G 11314706-T-G *
13479053-G-A 11323377-G-A *
13470390-G-T 11314714-G-T *
13470391-G-A 11314715-G-A *
13479051-C-T 11323375-C-T *
13478463-C-A 11322787-C-A *
13478401-G-T 11322725-G-T *
13478313-G-T 11322637-G-T *
13476749-G-A 11321073-G-A *
13476677-G-A 11321001-G-A *
13476609-TCC-T 11320933-TCC-T *
13470432-G-GGAGC 11314756-G-GGAGC *
13472479-GC-CC,G 11316803-GC-CC,G *
13470519-C-T 11314843-C-T *
13476607-A-ATG 11320931-A-ATG *
13476565-C-A 11320889-C-A *
13476500-A-T 11320824-A-T *
13470624-A-C 11314948-A-C *
13470675-AC-A 11314999-AC-A *
13474404-C-T 11318728-C-T *
13474325-A-G 11318649-A-G *
13474165-T-A 11318489-T-A *
13474119-A-T 11318443-A-T *
13474482-G-C 11318806-G-C *
13480565-G-C 11324889-G-C *
13479097-T-C 11323421-T-C *
13484004-ACAC-A 11328328-ACAC-A *
13489678-C-G 11334002-C-G *
13489630-C-CAA,CCCT 11333954-C-CAA,CCCT *
13489627-CA-C,CCAA 11333951-CA-C,CCAA *
13489356-TGC-GGC,T 11333680-TGC-GGC,T *
13489033-C-CAT 11333357-C-CAT *
13488490-G-C 11332814-G-C *
13488422-A-G 11332746-A-G *
13487759-C-CACAG 11332083-C-CACAG *
13487755-AAC-A 11332079-AAC-A *
13487739-T-TCC 11332063-T-TCC *
13484144-A-C 11328468-A-C *
13484091-G-T 11328415-G-T *
13484069-T-G 11328393-T-G *
13484067-C-A 11328391-C-A *
13484001-T-TATG 11328325-T-TATG *
13480536-G-A 11324860-G-A *
13481880-AG-A 11326204-AG-A *
13480561-C-CA 11324885-C-CA *
13469997-G-T 11314321-G-T *
13481791-ACAATGTCCCCTGTAGGCAGAACATAGAGAAGAGTTGCATCACCTGGGTGATCAGTGCAGAGATAGGTCT-A 11326115-ACAATGTCCCCTGTAGGCAGAACATAGAGAAGAGTTGCATCACCTGGGTGATCAGTGCAGAGATAGGTCT-A *
13481804-TAGGCAGAACA-T 11326128-TAGGCAGAACA-T *
13481815-TAGAGAAGAGTTGCATCACCTGGGTGATCAGTGCAGAGATAGGTCTCAATGTCCCCTGTA-T 11326139-TAGAGAAGAGTTGCATCACCTGGGTGATCAGTGCAGAGATAGGTCTCAATGTCCCCTGTA-T *
13481876-G-A 11326200-G-A *
13481883-C-G 11326207-C-G *
13483991-C-T 11328315-C-T *
13482074-T-C 11326398-T-C *
13482088-A-G 11326412-A-G *
13482109-A-T 11326433-A-T *
13482123-A-G 11326447-A-G *
13483356-T-G 11327680-T-G *
13483413-G-C 11327737-G-C *
13470033-T-C 11314357-T-C *
13867562-C-G 11746856-C-G *
13469985-G-T 11314309-G-T *
10686658-CTCCTT-C,TTCCTT *
13269591-A-AAC 11113915-A-AAC *
13241380-A-G 11085704-A-G *
10859967-A-ATTCAGTGCCATTCTATTCCTTTCAATACCATTCAATTCCATTCCACTCCT *
10800325-C-T,T *
10800324-G-C,C *
10787772-TTG-T *
10787768-TCG-T *
10787766-T-A *
10787762-T-TCC *
10787744-C-G *
10693720-A-G,T *
10693238-CCA-C *
10693237-T-TTA *
10678044-C-CAAT *
13447478-A-C,T 11291802-A-C,T *
10671559-C-CCAT *
10671403-T-TC *
10671346-G-GTCCCA *
10626265-T-G *
10626259-A-C *
10626256-TA-T 8×A*
10626255-T-G *
10625985-C-T *
10625681-A-T FT427976 *
10625656-T-A *
10625650-G-A *
10625639-C-T *
10625630-A-G *
13446804-GCCATTCCATTCCATTCCATTCCATTCCATTCCATTCCATT-G,GCCATTCCATTCCATTCCATTCCATTCCATTCCATTCCATTCCATT 11291128-GCCATTCCATTCCATTCCATTCCATTCCATTCCATTCCATT-G,GCCATTCCATTCCATTCCATTCCATTCCATTCCATTCCATTCCATT 12×CCATT*
13447482-T-A 11291806-T-A *
13469981-T-G 11314305-T-G *
13461987-C-T 11306311-C-T *
13467075-T-G 11311399-T-G *
13467047-T-C 11311371-T-C *
13467036-C-A 11311360-C-A *
13466832-A-T 11311156-A-T *
13466709-TGGGTGATCAGAGCAGAGATATGTCACAATGCCCCCGGTAAGCAGATCCC-T 11311033-TGGGTGATCAGAGCAGAGATATGTCACAATGCCCCCGGTAAGCAGATCCC-T *
13489802-C-T 11334126-C-T *
13466686-GCGTAGACAAGAGTTACATCA-G 11311010-GCGTAGACAAGAGTTACATCA-G *
13463325-G-A 11307649-G-A *
13462763-G-C 11307087-G-C *
13462411-A-G 11306735-A-G *
13462410-C-T 11306734-C-T *
13462403-C-G 11306727-C-G *
13462369-C-T 11306693-C-T *
13461970-C-T 11306294-C-T *
13447897-G-A,GTGCATTCCA 11292221-G-A,GTGCATTCCA *
13461959-C-A 11306283-C-A *
13461952-G-T 11306276-G-T *
13461883-C-G 11306207-C-G *
13461772-C-T 11306096-C-T *
13461311-G-C 11305635-G-C *
13451230-G-GACT 11295554-G-GACT *
13451228-CT-C 11295552-CT-C *
13451214-C-A 11295538-C-A *
13449369-C-CCAATCCACTCCACTCCACTG 11293693-C-CCAATCCACTCCACTCCACTG *
13449362-T-TCCACTCCAC 11293686-T-TCCACTCCAC *
13448297-T-C,TCCATTTCACTCCACTCCAC 11292621-T-C,TCCATTTCACTCCACTCCAC *
13447916-A-ATTCC 11292240-A-ATTCC *
13447914-T-TCCA 11292238-T-TCCA *
13489729-C-CGG 11334053-C-CGG *
13535268-T-A 11379592-T-A *
13489819-G-C 11334143-G-C *
22255734-TAA-T 20093848-TAA-T DYZ19 *
22591128-G-A 20429242-G-A Y*
22591109-T-A 20429223-T-A Y*
22558428-T-A 20396542-T-A YY*
22509770-TCACTTCAAGAATGAAGCTGCAGACATTACTGGTGAGTGTTACAGCACTTAAATGTGTTATGTCCAGAGTTTGTTCCC-T 20347884-TCACTTCAAGAATGAAGCTGCAGACATTACTGGTGAGTGTTACAGCACTTAAATGTGTTATGTCCAGAGTTTGTTCCC-T DYZ19 *
22508903-C-G 20347017-C-G DYZ19 *
22508893-C-T 20347007-C-T DYZ19 *
22438307-T-A 20276421-T-A DYZ19 *
22302281-G-A 20140395-G-A BY165732 DYZ19 *
22299329-T-TAC 20137443-T-TAC DYZ19 *
22299326-TGC-T 20137440-TGC-T DYZ19 *
22255744-T-TA 20093858-T-TA DYZ19 *
22255741-G-T 20093855-G-T DYZ19 *
22255738-G-C 20093852-G-C DYZ19 *
22255722-T-C 20093836-T-C DYZ19 *
22651234-T-C 20489348-T-C YY*
22255707-G-T 20093821-G-T DYZ19 *
22255688-A-G 20093802-A-G DYZ19 *
22255685-T-A 20093799-T-A DYZ19 *
22237582-A-T,T 20075696-A-T,T DYZ19 *
22237574-G-T,T 20075688-G-T,T DYZ19 *
22237562-T-A,A 20075676-T-A,A DYZ19 *
22237555-G-A,A 20075669-G-A,A DYZ19 *
22228944-G-T 20067058-G-T DYZ19 *
22214450-A-G 20052564-A-G Y*
22154293-A-T 19992407-A-T Y*
21977727-G-C 19815841-G-C FT255060 YY*
21755491-T-A 19593605-T-A YY*
21575665-G-A 19413779-G-A Y*
22591166-C-T 20429280-C-T Y*
22651239-T-G 20489353-T-G YY*
21575663-C-A 19413777-C-A Y*
56825964-G-GCATTCTATTCGATTT *
56844653-A-G *
56844639-A-C *
56844638-C-T *
56839788-G-A *
56837015-C-CCACTA,CCATTA *
56834817-C-CTCCACTCCAT *
56834810-T-TTCCATTCCATTCCATTCCATTCCATTCCATTCCATTCCATTCCACGCC *
56833351-C-CACTGCACTGTACTCCATTCCATTCCATTCT *
56833273-T-TTCCACTCCACTCCTTTCCATTCCACTCCACTCCACTCCATTCCACTCCCCTCCATTCCACTCCACTCCATTCCACTCTACTCCTCTCCACTCCACTCCATTCCAGTCCACTCCATTCCACTCCTCTCCATTCCACTCTACTCCTC *
56832800-T-C *
56831997-C-CAACTA,G *
56830536-ATTCTGCTGAATTCCATTGCATTCCATTGC-A *
56830295-CTCCACTCCATTCCATGCCAT-C *
56757077-TG-T *
22651240-C-T 20489354-C-T YY*
56757059-A-C *
56757045-C-A *
56757007-A-T *
56706887-T-A *
56676394-C-T *
28585584-A-ATG 26439437-A-ATG *
28507101-G-A 26360954-G-A Y*
26928182-A-T,T 24782035-A-T,T P1_r3 *
24447654-T-A 22301507-T-A Y*
23256069-A-G 21094183-A-G YY*
23128538-T-A 20966652-T-A YY*
22862708-C-T 20700822-C-T YY*
22858866-A-T 20696980-A-T YY*
22651243-A-G 20489357-A-G YY*
21575664-T-C 19413778-T-C Y*
21575658-T-G 19413772-T-G Y*
13489865-G-C 11334189-G-C *
13707394-C-CGT,T 11551718-C-CGT,T *
14256205-C-G 12135499-C-G Y*
14244522-A-T 12123816-A-T YY*
13868763-GTGGAACAGAATTGAATGGAATAGAATCGAATGGATTGGAATTGATTGGAATAGACAGGAATGCAATGGACTTGAATGGAATTTACTGGAACAAAATGGAATCAAACGGATTGGAACTGAACGAAACAGAATGGAATGTAATGGAATGGCCTCGAATGGAATGGAGTTGAATGGAAGGGAATCGA-G 11748057-GTGGAACAGAATTGAATGGAATAGAATCGAATGGATTGGAATTGATTGGAATAGACAGGAATGCAATGGACTTGAATGGAATTTACTGGAACAAAATGGAATCAAACGGATTGGAACTGAACGAAACAGAATGGAATGTAATGGAATGGCCTCGAATGGAATGGAGTTGAATGGAAGGGAATCGA-G *
13867606-C-T 11746900-C-T BY91693 *
13866622-G-GGAC 11745916-G-GGAC *
13857775-G-C 11737069-G-C *
13857767-TATG-T 11737061-TATG-T *
13857763-A-ACAG 11737057-A-ACAG *
13857743-T-TAA 11737037-T-TAA *
13857740-T-TCGAA 11737034-T-TCGAA *
13857737-A-AAGAT 11737031-A-AAGAT *
13719304-G-C 11563628-G-C *
13709852-C-T 11554176-C-T *
13705731-G-A 11550055-G-A *
14425742-C-T 12305017-C-T YY*
13705706-G-C 11550030-G-C *
13693568-G-A 11537892-G-A FT448781 *
13693549-G-T 11537873-G-T *
13688926-G-T 11533250-G-T *
13688925-G-T 11533249-G-T *
13688924-C-A,T 11533248-C-A,T *
13688452-A-C 11532776-A-C *
13688280-T-C 11532604-T-C *
13688110-T-A 11532434-T-A *
13546419-A-T 11390743-A-T *
13523528-C-G 11367852-C-G *
13489929-G-C 11334253-G-C *
13489873-C-A 11334197-C-A *
14352557-G-C 12231852-G-C Y*
14515691-T-A 12403892-T-A YY*
21575652-G-A 19413766-G-A Y*
17887384-T-A 15775504-T-A YY*
21575642-A-T 19413756-A-T Y*
21575635-G-A 19413749-G-A Y*
21575634-T-C 19413748-T-C Y*
21575598-TG-T 19413712-TG-T *
21440748-T-G 19278862-T-G YY*
21436531-T-A 19274645-T-A YY*
21249172-A-T 19087286-A-T YY*
21113769-T-G 18951883-T-G YY*
18892281-T-A,A 16780401-T-A,A *
18892280-A-T,T 16780400-A-T,T *
18781901-A-T 16670021-A-T YY*
18420234-T-A 16308354-T-A P6_Gap *
18212808-T-A 16100928-T-A YY*
17749610-A-C 15637730-A-C YY*
14572044-T-C 12460244-T-C YY*
17337330-G-A 15225450-G-A YY*
17105312-A-T 14993432-A-T YY*
17022376-A-T 14910496-A-T YY*
16034337-TA-T,TAAA 13922457-TA-T,TAAA 12×A*
15512781-G-T 13400901-G-T YY*
15465852-A-T 13353972-A-T YY*
15461674-A-C 13349794-A-C YY*
15382289-A-T 13270409-A-T YY*
15179725-G-C 13067811-G-C Y*
15035110-T-A 12923198-T-A YY*
14947490-G-C 12835564-G-C YY*
14927460-T-A 12815525-T-A YY*
14911577-C-T 12799644-C-T YY*
14781941-A-T 12670011-A-T YY*
10625625-T-A,C *
9956840-G-C 10119231-G-C Y*
10070649-T-C 10233040-T-C *
10818690-C-G *
28812773-G-A 26666626-G-A A4535 *
13489183-G-GC 11333507-G-GC *
13470700-A-C 11315024-A-C *
56844670-A-G *
4571254-CA-C 4703213-CA-C 29×A*
13461763-G-A 11306087-G-A *
10671561-C-CCA *
13719329-C-G 11563653-C-G *
13474494-T-C 11318818-T-C *
13489704-C-T 11334028-C-T *
14008778-GAA-G,GA 11888072-GAA-G,GA 25×A*
13478366-G-A 11322690-G-A *
10787780-T-A *
13710114-C-G 11554438-C-G *
21402181-C-CT 19240295-C-CT 34×T*
10888264-T-A *
56835580-A-T *
13489157-A-T 11333481-A-T *
13468280-C-A 11312604-C-A *
14352565-C-T 12231860-C-T Y*
9109031-A-G *
13857809-C-A 11737103-C-A *
56706988-G-T *
13480439-A-C 11324763-A-C *
13462282-C-A 11306606-C-A *
56847959-G-A *
13693566-A-C 11537890-A-C *
10765723-CCTCTTCACTCCACTCCACTT-C *
28794576-G-T 26648429-G-T *
10625998-T-C *
59012825-C-G 56866678-C-G *
13689902-A-G 11534226-A-G *
13827247-T-A 11706541-T-A *
13474171-T-A 11318495-T-A *
13474126-T-C 11318450-T-C *
10775629-A-C *
13474148-G-T 11318472-G-T *
13476595-C-T 11320919-C-T *
13476586-G-A 11320910-G-A *
5945467-CT-C,CTT 6077426-CT-C,CTT 25×T*
56859213-T-TA 8×A*
13689887-A-T 11534211-A-T *
13689886-G-T 11534210-G-T *
13500346-G-GTTTATTTATTTA 11344670-G-GTTTATTTATTTA 5×TTTA*
13688406-A-G 11532730-A-G *
28812758-G-A 26666611-G-A *
13462009-A-G 11306333-A-G *
28812748-G-T 26666601-G-T *
13489818-G-A 11334142-G-A *
56832048-C-T *
13470545-A-T 11314869-A-T *
13470060-G-C 11314384-G-C *
15163458-C-T 13051544-C-T YY*
13489318-C-T 11333642-C-T *
56757100-A-T *
13474391-T-A,C 11318715-T-A,C *
56830379-A-ACTTCG *
13474328-G-T 11318652-G-T *
13857794-T-A 11737088-T-A *
13857791-G-A 11737085-G-A *
13707493-G-C 11551817-G-C *
13480386-G-C 11324710-G-C *
5904031-C-CA 6035990-C-CA 27×A*
28815670-T-C 26669523-T-C *
13266544-G-A 11110868-G-A *
58990462-G-A 56844315-G-A *
28812730-T-A 26666583-T-A *
28809816-A-T 26663669-A-T *
22255778-T-C 20093892-T-C DYZ19 *
13857754-T-A 11737048-T-A FGC38046 *
13718984-G-C 11563308-G-C *
13718973-A-G 11563297-A-G *
13718632-AT-A 11562956-AT-A *
13718414-T-A 11562738-T-A *
13474122-A-G 11318446-A-G *
13467088-A-T 11311412-A-T *
13449945-C-CACT 11294269-C-CACT *
13447457-C-A 11291781-C-A *
13867604-A-T 11746898-A-T *
59011040-T-C 56864893-T-C *
22090615-T-C 19928729-T-C Y*
28812716-A-T 26666569-A-T *
13447458-T-G 11291782-T-G *
5400468-C-T 5532427-C-T 19×T*
58833862-C-A 56757009-G-T *
13688460-T-C 11532784-T-C *
13467057-T-G 11311381-T-G *
13467068-T-A 11311392-T-A *
13489273-T-A 11333597-T-A *
22508899-T-G 20347013-T-G DYZ19 *
13467034-T-G 11311358-T-G *
13867591-A-C 11746885-A-C *
13827294-A-G 11706588-A-G *
13827284-A-G 11706578-A-G *
59009818-G-A 56863671-G-A *
59013874-C-T 56867727-C-T *
58978207-C-T 56832060-C-T *
13467039-T-G 11311363-T-G *
22228797-A-T 20066911-A-T DYZ19 *
58985904-T-A 56839757-T-A *
13867583-A-G 11746877-A-G *
13867565-A-T 11746859-A-T *
13447486-T-C 11291810-T-C *
13474339-A-T 11318663-A-T *
13867561-T-C 11746855-T-C *
13449064-ACTGCAC-A 11293388-ACTGCAC-A *
58978908-T-TTCCTC 56832761-T-TTCCTC *
13827234-G-A 11706528-G-A *
13857745-T-G 11737039-T-G *
21575614-A-G 19413728-A-G Y*
21575601-G-T 19413715-G-T Y*
13867592-T-A 11746886-T-A *
59014004-C-T 56867857-C-T *
22302277-A-T 20140391-A-T BY216920 DYZ19 *
4964729-AT-A 5096688-AT-A 34×T*
13447491-T-C 11291815-T-C *
13447488-C-G 11291812-C-G *
13489746-C-T 11334070-C-T *
13489136-C-A 11333460-C-A *
13857799-T-A 11737093-T-A *
58980527-T-TTCCATTTCATTCCAC 56834380-T-TTCCATTTCATTCCAC *
14454753-C-CT 12334026-C-CT 14454753-C-CT 9×T*
59033494-G-T 56887347-G-T *
59028889-AATT-A 56882742-AATT-A *
59028174-G-A 56882027-G-A *
59026824-A-T 56880677-A-T *
59024259-G-A 56878112-G-A *
13827308-G-T 11706602-G-T *
59025339-A-G,T 56879192-A-G,T *
10061653-G-GTC 10224044-G-GTC *
10625201-A-G *
56756984-G-T *
13489824-G-C 11334148-G-C *
13489258-C-G 11333582-C-G *
13474668-G-A 11318992-G-A *
13469918-C-A 11314242-C-A *
10688045-C-CCGG *
10688044-C-CAA *
13483369-C-A 11327693-C-A *
28817000-C-A,A 26670853-C-A,A *
13725974-C-A,T 11570298-C-A,T *
13489353-A-ATG 11333677-A-ATG *
13489231-C-A 11333555-C-A *
13479066-T-A 11323390-T-A *
10625200-A-T *
2772512-CA-C,CAA 2904471-CA-C,CAA 25×A*
10625194-C-G *
56876123-GCAAAAAAAAAAAAAAAAAAAAAAAA-G *
56834615-C-CTCCACTCCACTCCTCTCCATTCCAT *
56827019-TTCCATTCCATTCAATTCCATTTCATTCGATTCCATTCCTTTCGAG-T *
56757010-A-T *
13489279-G-T 11333603-G-T *
13489252-C-G 11333576-C-G *
13489232-C-A 11333556-C-A *
13476599-A-T 11320923-A-T *
13476594-T-C 11320918-T-C *
13205596-AT-A,A 11049920-AT-A,A *
13484107-A-G 11328431-A-G *
13484095-A-G 11328419-A-G *
13479102-T-A 11323426-T-A *
2708411-C-CGAGA,CGAGAGA 2840370-C-CGAGA,CGAGAGA 23×GA*
3012106-T-A 3144065-T-A *
13479073-CT-C 11323397-CT-C *
8173909-G-T 8305868-G-T YY*
10061651-C-T 10224042-C-T *
10061647-GTT-G 10224038-GTT-G *
13827275-T-A 11706569-T-A *
9851667-T-C 10014058-T-C YY*
9409881-A-T 9572272-A-T Y*
9143097-A-T 9305488-A-T Y*
9109054-C-G FT410222 *
9109053-T-C *
9109047-T-G *
9109041-A-T *
8821870-A-G 8953829-A-G YY*
8817404-A-T 8949363-A-T YY*
8601787-G-C 8733746-G-C YY*
8173905-A-T 8305864-A-T YY*
3017516-A-T 3149475-A-T *
8173897-G-T 8305856-G-T YY*
8173888-CT-C 8305847-CT-C *
8062003-T-C 8193962-T-C Y*
7708587-T-C 7840546-T-C YY*
7147348-A-T 7279307-A-T YY*
6994526-C-G 7126485-C-G YY*
6130287-A-G 6262246-A-G *
5564155-A-T 5696114-A-T *
5088269-A-T 5220228-A-T *
4946828-T-A 5078787-T-A *
4181131-G-A 4313090-G-A *
4136062-A-T 4268021-A-T *
3509344-A-T 3641303-A-T *
3436791-A-T 3568750-A-T *
13479083-C-A 11323407-C-A *
13479038-G-C 11323362-G-C *
56877978-T-A,C *
13688956-T-C 11533280-T-C *
13476574-T-A 11320898-T-A *
13476689-G-C 11321013-G-C *
22508927-G-T 20347041-G-T DYZ19 *
13470444-TCTGC-T 11314768-TCTGC-T *
13447466-C-A 11291790-C-A *
13827328-A-T 11706622-A-T *
13461935-C-T 11306259-C-T *
23505495-C-CA,CAA 21343609-C-CA,CAA 23×A*
13483331-C-A 11327655-C-A *
13480351-T-A 11324675-T-A *
13484209-G-A 11328533-G-A *
13693594-G-A 11537918-G-A *
13693590-A-G 11537914-A-G *
13489534-G-C 11333858-G-C *
13827263-T-A 11706557-T-A *
13481902-C-T 11326226-C-T *
28812778-G-A 26666631-G-A *
28812777-G-T 26666630-G-T *
13489286-T-A 11333610-T-A *
9980460-C-G 10142851-C-G Y*
13569835-TA-T 11414159-TA-T 11×A*
13448203-T-TCCATC,TCCATTCCATTCCATC 11292527-T-TCCATC,TCCATTCCATTCCATC *
13474496-G-A 11318820-G-A *
13484145-G-T 11328469-G-T *
13484079-T-C 11328403-T-C *
28809705-G-T 26663558-G-T *
13484121-C-T 11328445-C-T *
13484029-C-T 11328353-C-T *
10888273-A-C *
6402025-G-A 6533984-G-A *
10061699-C-T 10224090-C-T *
13479037-G-T 11323361-G-T *
13489251-C-T 11333575-C-T *
13479013-C-A 11323337-C-A *
13479001-C-A 11323325-C-A *
10661325-T-TCCATCCCATC *
6402358-GTAAAATACCGACGTATATGTTATATTCGTCGGGGTCA-G 6534317-GTAAAATACCGACGTATATGTTATATTCGTCGGGGTCA-G *
6402344-TAA-T 6534303-TAA-T *
6402305-TATATTCTTCCGTGTCGTAAAATACCGACGTATTTG-T 6534264-TATATTCTTCCGTGTCGTAAAATACCGACGTATTTG-T *
6402245-TCGTAAAATACCAATGTATATGTTATATTCGTACGTGC-T 6534204-TCGTAAAATACCAATGTATATGTTATATTCGTACGTGC-T *
56828925-ATTCCATTCCATTCCATTCCATTCCATGTCATTCCATTCCATTCCATTCCCTTCGAATCCATTCCATTCCATTCCGTTTCC-A *
13476509-G-A 11320833-G-A *
13462196-G-T 11306520-G-T *
10745361-A-T *
56829344-TGA-T *
56829342-T-TTC *
13474617-CTGT-C 11318941-CTGT-C *
2993615-AT-A 3125574-AT-A 9×T*
13474612-G-GCC 11318936-G-GCC *
13474591-C-A 11318915-C-A *
13448030-CCACTCCA-C 11292354-CCACTCCA-C *
13448026-CAT-C 11292350-CAT-C *
6402352-G-A 6534311-G-A *
13827282-T-A 11706576-T-A *
13476606-C-G 11320930-C-G *
13827322-C-G 11706616-C-G *
13827320-G-A 11706614-G-A *
13827319-G-A 11706613-G-A *
13827301-A-C 11706595-A-C *
13827297-T-A 11706591-T-A *
13688970-G-A 11533294-G-A *
14774253-CTT-C,CT 12662322-CTT-C,CT 28×T*
56876149-A-G *

In the table above, the meaning of the confidence field depends on whether the data comes from an FTDNA kit or an FGC kit. For FTDNA kits, + implies a "PASS" result with just one possible variant, * indicates a "PASS" but with multiple variants, ** indicates "REJECTED" with just a single variant, and *** indicates "REJECTED" with multiple possible variants. 'A*' are heterozygous variants not called by FTDNA, but still pulled from the VCF file. For FGC kits, + indicates over 99% likely genuine (95% for INDELs); * over 95% likely genuine (90% for INDELs); ** about 40% likely genuine; *** about 10% likely genuine. Manual entries read directly from a BAM file will be either + indicating positive, or * indicating that the data show a mixture of possible variants.

For the FTDNA kits, the BED data is encoded in the background color of the cells. Those cells with a white background have coverage, those with a grey background indicate no coverage in the BED file, and those with a pink background indicate the mutation is on the edge of a coverage region. These pink regions often indicate that the individual may be positive for a SNP even if there is no corresponding entry in the vcf file.

The combBED column indicates whether or not the mutation is a SNP and falls in the combBED region defined in Defining a New Rate Constant for Y-Chromosome SNPs based on Full Sequencing Data by Dmitry Adamov, Vladimir Guryanov, Sergey Karzhavin, Vladimir Tagankin, Vadim Urasin.

The McDonald BED column indicates whether or not the mutation is a SNP and falls in the BED region used by Dr. Iain McDonald in the age analysis he does for R-U106 men.

Age Analysis Information (work in progress)

AllMcDonaldYFull
Kit: 34066459918033837712758320
Used in age calculations459918033837712758320
Counts of SNPs7350
Variant counts last updated 2022-05-14 04:32:39.



Big Tree Main Page