Tree Position

R-P312/S116 > Z290 > L21/S145 > S552 > DF13 > Z39589 > DF49/S474 > Z2980 > Z2976 > DF23 > ZP112 > ~14004796-C-G > Y29872 > BY60168 > BY71036

Unique Mutations

The mutations unique to this man are summarized in the table below. Those with a '+' or '*' confidence level are considered by FamilyTreeDNA or FullGenomesCorp to be high quality SNPs/INDELs. For completeness, all other mutations of lesser confidence are included as well. These additional mutations may be useful for distinguishing between very closely related men.

Occasionally, some of the mutations listed here will be thought to be shared with other men in which case they might appear in upstream blocks on the tree. When this happens, the 'Blocks' field will indicate what block they appear in. Such a situation might arise with BigY men if the BED data suggests another man may be positive for a SNP, even though it doesn't appear in his VCF data. It might also happen if Chromo2 testing or Sanger sequencing of other men not on the tree show the SNP to be shared.

POS-REF-ALT (hg19) POS-REF-ALT (hg38) Blocks Names Region McDonald BED combBED STRKane-BY3
942448
BigY3
942448
28800246-G-T 26654099-G-T A*
19962246-G-A 17850366-G-A P5_Prx A*
24302177-C-T 22156030-C-T P3_t1 A*
10961434-TCCACA-T +
5911040-A-T 6042999-A-T 9×T++
5748304-A-C 5880263-A-C FT49372 ++
5370917-C-T 5502876-C-T FT49268 ++
17074637-G-GTTTTTTT 14962757-G-GTTTTTTT 34×T+
22260997-C-T 20099111-C-T DYZ19 +
15271047-G-GAAA 13159136-G-GAAA 19×A+
17278306-GAAAGAA-G 15166426-GAAAGAA-G +
4583034-T-C 4714993-T-C +**
13376-T-A +
3359916-C-A 3491875-C-A FTA21824 ++
19696433-TA-T 17584553-TA-T P5_Prx 14×A+
22458078-CTTCAAGAATGAAGCTGCAGACCTTAGTGGTGAACGTTACAGCACTTAAGTTTTTAT-C 20296192-CTTCAAGAATGAAGCTGCAGACCTTAGTGGTGAACGTTACAGCACTTAAGTTTTTAT-C DYZ19 +
22458033-TGTGTCCAGAGTTTCCTCCTTCTGGCAGGTTCATGGTCGTGCTC-T 20296147-TGTGTCCAGAGTTTCCTCCTTCTGGCAGGTTCATGGTCGTGCTC-T DYZ19 +
59013629-T-A 56867482-T-A +
22229381-GA-G 20067495-GA-G DYZ19 +
22229384-CCTCCCAGAAGGAAGAAACTCTAGACACATTTGATGGAACAAACTCTGGACATAAAACCTTTAAGTGCTGTAACGCTCACCACTAAGGTCTGCGGCTTCATTCTTGAAGAGAACAAGACCATGAA-C 20067498-CCTCCCAGAAGGAAGAAACTCTAGACACATTTGATGGAACAAACTCTGGACATAAAACCTTTAAGTGCTGTAACGCTCACCACTAAGGTCTGCGGCTTCATTCTTGAAGAGAACAAGACCATGAA-C DYZ19 +
20104256-GGAGAGA-G 17992376-GGAGAGA-G P5_Dst 22×GA+
17200065-G-T 15088185-G-T YY+
11014432-A-AATTCC +
13733857-A-C 11578181-A-C +
6441199-G-C 6573158-G-C FTA22027 ++
22261017-TTTACGGTGAGTGTTACAGCACTTAAAAGTGTTATGTCCAGAGCTTTTTTCCTTCAGATGTGTCCAGAGTTTCTTCCTTCTGGCAGGTTCATGGTCTTGCTCACTTCAAAAATGAAACTGCAGACGA-T 20099131-TTTACGGTGAGTGTTACAGCACTTAAAAGTGTTATGTCCAGAGCTTTTTTCCTTCAGATGTGTCCAGAGTTTCTTCCTTCTGGCAGGTTCATGGTCTTGCTCACTTCAAAAATGAAACTGCAGACGA-T DYZ19 +
58872705-A-T 56718166-T-A +
22435760-A-T 20273874-A-T DYZ19 +
19472566-C-T 17360686-C-T YY*+
17927434-A-G 15815554-A-G FT50868 YY++
11028340-T-TTCACCATTCCATTGCATTCCATTCCATCCAATTCTATTCCACTCTATTTCA +
15107254-T-C 12995341-T-C FT138690 YY++
14357411-G-A 12236706-G-A FT50175 YY++
21623812-G-GTTT 19461926-G-GTTT 25×T+
26658507-C-G 24512360-C-G P1_g2 +
15081016-G-T 12969106-G-T Y+**
58872680-C-G 56718191-G-C +
10803569-T-C FT431904 ++
7704030-G-A 7835989-G-A FT49720 YY++
8016393-T-G 8148352-T-G FT49759 YY++
13633415-G-A 11477739-G-A +
10752434-C-T FT429659 +**
21829225-T-C 19667339-T-C Y+
24185420-C-G 22039273-C-G P3_b1 +
23695834-T-TGCCCCCCC 21533948-T-TGCCCCCCC +
13469376-T-A 11313700-T-A *
13478463-C-G 11322787-C-G *
13692963-T-TGGAAA 11537287-T-TGGAAA *
13478490-G-C 11322814-G-C *
13478491-G-C 11322815-G-C *
13692974-G-GAACTC 11537298-G-GAACTC *
13489854-C-G 11334178-C-G *
13489860-G-A 11334184-G-A *
13489855-C-A 11334179-C-A *
13638914-A-G 11483238-A-G *
56866866-C-CAA *
56833327-A-ATT *
13565519-A-G 11409843-A-G *
13464975-C-G 11309299-C-G *
9296364-T-C 9458755-T-C Y*
13465140-GGT-G 11309464-GGT-G *
56829520-C-CATTCCATTCCTGTCT *
13489765-TAC-T 11334089-TAC-T *
13475403-G-A 11319727-G-A *
13475390-G-C 11319714-G-C *
13470037-T-A 11314361-T-A *
13469929-G-T 11314253-G-T *
10909696-G-C *
22475586-A-T 20313700-A-T DYZ19 *
3278326-C-T 3410285-C-T *
13508327-ACT-A 11352651-ACT-A 8×CT*
13233319-GA-G,GAA 11077643-GA-G,GAA 17×A*
22475729-A-G 20313843-A-G DYZ19 *
13693697-TGAAATGGAATGGAATGGAATGGAAC-T 11538021-TGAAATGGAATGGAATGGAATGGAAC-T *
13489384-G-T 11333708-G-T *
13478455-G-C 11322779-G-C *
13469153-A-G 11313477-A-G *
28797015-G-T 26650868-G-T *
13489768-C-CGT 11334092-C-CGT *
22463953-C-T 20302067-C-T DYZ19 *
9980216-A-T 10142607-A-T Y*
13449960-T-TTCCATACCATTCCATTCCATTGCATTCCACTCCATTCCACTCCACTCCAATCAACTCCGCTCCACTCCACTCCACTTCACTCCAATCCACTCCAC,TTCCATTCCATACCATTCCATTCCATTGCATTCCACTCCATTCCACTCCACTCCAATCAACTCCACTCCACTCCACTTCACTCCAATCCACTCCAC 11294284-T-TTCCATACCATTCCATTCCATTGCATTCCACTCCATTCCACTCCACTCCAATCAACTCCGCTCCACTCCACTCCACTTCACTCCAATCCACTCCAC,TTCCATTCCATACCATTCCATTCCATTGCATTCCACTCCATTCCACTCCACTCCAATCAACTCCACTCCACTCCACTTCACTCCAATCCACTCCAC *
9980213-AG-A 10142604-AG-A *
13488844-G-GCT 11333168-G-GCT *
13505913-C-T 11350237-C-T *
13505911-T-C 11350235-T-C *
13489363-C-CATATA 11333687-C-CATATA *
13468103-C-G 11312427-C-G *
13461232-G-T 11305556-G-T *
56884030-G-A *
13472027-C-T 11316351-C-T *
13479020-C-T 11323344-C-T *
13478447-C-T 11322771-C-T *
13475771-A-T 11320095-A-T *
13469145-T-G 11313469-T-G *
28802744-GATTCAAATTGCATAGAATGGAATCAAATGGAATGCGGTGA-G 26656597-GATTCAAATTGCATAGAATGGAATCAAATGGAATGCGGTGA-G *
25862980-G-GA 23716833-G-GA P1_Y1 10×A*
13489104-C-A 11333428-C-A *
13487946-G-C 11332270-G-C *
13479063-C-G 11323387-C-G *
11334024-C- *
13504721-T-TG 11349045-T-TG *
11334055-G- *
11747893-A- *
22272855-TGG-T 20110969-TGG-T DYZ19 *
22272860-A-C 20110974-A-C DYZ19 *
56856117-A-AG,G *
18931744-T-C 16819864-T-C YY*
18931748-G-C 16819868-G-C YY*
18931749-G-C 16819869-G-C YY*
18931750-G-C 16819870-G-C YY*
18931754-G-A 16819874-G-A YY*
56834395-C-CTCCACTCCACTCCATTCCACTCCTATCCACTCCAT *
56876124-CAAAAAAAAAAAAAAAAAAAAAA-C 50×A*
13484920-G-A 11329244-G-A *
13489727-CT-C 11334051-CT-C *
13489735-G-GGTGA 11334059-G-GGTGA *
13254418-T-A 11098742-T-A FT63776 *
11550413-G- *
13707268-G-T 11551592-G-T *
22509554-G-T 20347668-G-T DYZ19 *
56856795-T-TATATTAA *
13466401-C-T 11310725-C-T *
13466419-C-T 11310743-C-T *
13469110-C-A 11313434-C-A *
13476679-C-CCG 11321003-C-CCG *
13476695-G-C 11321019-G-C *
13476708-C-A 11321032-C-A *
13476720-G-A 11321044-G-A *
22475020-C-T 20313134-C-T DYZ19 *
22475052-G-A 20313166-G-A BY48004 DYZ19 *
13474393-G-T 11318717-G-T *
13694834-A-G 11539158-A-G *
7534382-GTTTTTTTTTGTTTT-G 7666341-GTTTTTTTTTGTTTT-G 9×T*
11565275-ACG- *
13470268-C-A 11314592-C-A *
11565278-AATTTAAT- *
11565287-CAATGGA- *
5507713-ATT-A,AT 5639672-ATT-A,AT 24×T*
9469799-G- *
13465101-C-T 11309425-C-T *
13489286-T-G 11333610-T-G *
22509684-T-C 20347798-T-C DYZ19 *
56706982-T-C *
13470597-A-T 11314921-A-T *
13721564-T-G 11565888-T-G *
13721566-G-C 11565890-G-C *
56834415-T-TTCCTCTCCAC *
13470262-CT-C 11314586-CT-C *
22364685-C-G 20202799-C-G DYZ19 *
56685597-A-G *
22486358-GT-G 20324472-GT-G DYZ19 *
22479532-T-A 20317646-T-A BY25217 DYZ19 *
11292967-CCATTCCATTCCATTCCATTCCATT- *
13489270-C-T 11333594-C-T *
11550410-ATGGCGTGGAATGGAAT- *
11578457-AACGGAATTGAATGTCATGGAATGGAATGGC- *
13478662-C-G 11322986-C-G *
13474782-A-G 11319106-A-G *
13475720-A-C 11320044-A-C *
13475723-C-T 11320047-C-T *
13475739-T-C 11320063-T-C *
10846979-A-T *
13464979-G-T 11309303-G-T *
13464985-A-G 11309309-A-G *
22512604-G-A 20350718-G-A DYZ19 *
13478987-C-T 11323311-C-T *
9975270-C-T 10137661-C-T Y*
10985441-T-C *
13465136-C-G 11309460-C-G *
13469903-C-T 11314227-C-T *
13479085-C-T 11323409-C-T *
13489355-GTGCGT-G 11333679-GTGCGT-G *
56832495-C-T,T *
13465444-CAAG-C 11309768-CAAG-C *
13482204-T-G 11326528-T-G *
13492032-G-T 11336356-G-T *
56850025-A-G *
56850026-TCA-T *
56850031-C-CCT *
9931593-TG-T 10093984-TG-T *
10625055-G-T *
13485763-G-A 11330087-G-A *
9983925-G-T 10146316-G-T Y*
13699374-T-C 11543698-T-C *
13699376-G-T 11543700-G-T *
56835866-TG-T *
9931419-A-G 10093810-A-G Y*
9931420-G-A 10093811-G-A Y*
13263602-G-A 11107926-G-A *
13263606-G-T 11107930-G-T *
13502682-T-C 11347006-T-C *
26488166-TAA-T 24342019-TAA-T P1_Y1 15×A*
56880822-T-A,TTA *
5704514-A-G 5836473-A-G ***
6778819-T-C 6910778-T-C YY****
7142213-A-G 7274172-A-G FT18991 Y***
13258507-G-A 11102831-G-A *
9983924-T-G 10146315-T-G Y*
14291707-T-C 12171001-T-C Y****
13705477-AAT-A 11549801-AAT-A *
56871639-T-A *
56874786-CT-C 11×T*
10055491-T-C 10217882-T-C *
10055492-G-A 10217883-G-A *
10625073-A-T *
10625079-G-C *
13443296-C-A 11287620-C-A *
13466488-C-T 11310812-C-T *
13470050-C-CT 11314374-C-CT *
13474527-C-A 11318851-C-A *
13482270-A-T 11326594-A-T *
13487835-A-C 11332159-A-C *
13489600-C-T 11333924-C-T *
56884636-C-CA *
9962394-A-G 10124785-A-G Y*
9958285-G-GA 10120676-G-GA *
11018936-G-GCA *
11018938-T-TCCA *
13302962-CAAAAAAAAA-C,CAAAAAAAA 11147286-CAAAAAAAAA-C,CAAAAAAAA 17×A*
13462056-C-A 11306380-C-A *
13474341-GC-G 11318665-GC-G *
13480932-G-T 11325256-G-T *
13482137-G-A 11326461-G-A *
13482226-G-T 11326550-G-T *
13484095-A-G 11328419-A-G *
13489216-GC-G 11333540-GC-G *
13489673-GA-G 11333997-GA-G *
13705480-GGAATGGAATGGAA-G 11549804-GGAATGGAATGGAA-G *
22484076-T-C 20322190-T-C DYZ19 *
7343621-C-A 7475580-C-A Y***
15149687-G-A 13037774-G-A Y***
9975265-C-T 10137656-C-T Y*
13478368-C-A 11322692-C-A *
56834810-T-TTCC *
10908299-CCT-C *
13263664-G-T 11107988-G-T *
13263694-G-C 11108018-G-C *
13263702-C-A 11108026-C-A *
13263758-T-G 11108082-T-G *
13263766-C-A 11108090-C-A *
13263770-T-C 11108094-T-C *
13263773-A-T 11108097-A-T *
13263787-C-T 11108111-C-T *
13466486-G-T 11310810-G-T *
13470550-C-T 11314874-C-T *
13478976-G-A 11323300-G-A *
13478996-C-A 11323320-C-A *
22436387-TTTACAGCAATTAAAGGTGTTATGTCCAGAGTTTGTTCCTTCAGATGTGTCCAGAGTTTCTTCCTTCTGGCAGGTTCATGGGCTTGCTCACTTCAAGAATGAAGCTGCAGACCTTTACGGTGAGTG-T 20274501-TTTACAGCAATTAAAGGTGTTATGTCCAGAGTTTGTTCCTTCAGATGTGTCCAGAGTTTCTTCCTTCTGGCAGGTTCATGGGCTTGCTCACTTCAAGAATGAAGCTGCAGACCTTTACGGTGAGTG-T DYZ19 *
13479031-C-G 11323355-C-G *
13479044-C-A 11323368-C-A *
13479118-CTAT-C 11323442-CTAT-C *
13479123-G-GACA 11323447-G-GACA *
13484263-C-A 11328587-C-A *
13698922-G-C 11543246-G-C *
22238356-T-C 20076470-T-C DYZ19 *
22238371-C-G 20076485-C-G DYZ19 *
22238373-A-G 20076487-A-G DYZ19 *
22297944-A-G 20136058-A-G DYZ19 *
22448751-T-A 20286865-T-A DYZ19 *
22448756-G-A 20286870-G-A DYZ19 *
28586715-T-C 26440568-T-C *
56834782-T-TTCCACTCCAC *
28810285-G-T 26664138-G-T *
13545394-AGAAAGAAG-A 11389718-AGAAAGAAG-A *
15301983-T-C 13190082-T-C Y****
28807330-G-A 26661183-G-A BY151886 *
18261800-T-A 16149920-T-A ****
18860096-T-C 16748216-T-C Y****
22299001-C-G 20137115-C-G DYZ19 **
22778375-A-G 20616489-A-G Y****
9937955-A-G 10100346-A-G Y*
13463618-C-T 11307942-C-T *
13469111-A-G 11313435-A-G *
13476685-G-C 11321009-G-C *
13480773-C-A 11325097-C-A *
13482771-A-C 11327095-A-C *
13482778-C-T 11327102-C-T *
13636944-ATGAT-A 11481268-ATGAT-A *
13636951-T-A 11481275-T-A *
13469971-G-A 11314295-G-A *
13545350-A-G 11389674-A-G *
13484067-C-A 11328391-C-A *
13484069-T-G 11328393-T-G *
13484091-G-T 11328415-G-T *
22238310-C-G 20076424-C-G DYZ19 *
5786606-C-A 5918565-C-A *
13476601-G-T 11320925-G-T *
6440991-TA-T,TAA 6572950-TA-T,TAA 19×A*
13473920-A-G 11318244-A-G *
13474753-C-G 11319077-C-G *
13474765-G-C 11319089-G-C *
13480969-C-G 11325293-C-G *
13545305-GAGAGAA-G 11389629-GAGAGAA-G *
13545321-GA-G 11389645-GA-G *
13545324-GAAAGAAAGAAGGAAGGAA-G 11389648-GAAAGAAAGAAGGAAGGAA-G *
11321185-GC- *
13484911-G-A 11329235-G-A *
13478381-A-ATCCG 11322705-A-ATCCG *
14255706-C-T 12135000-C-T Y*
13489551-TG-T 11333875-TG-T *
13489613-C-CCA 11333937-C-CCA *
13501979-C-G 11346303-C-G *
13504454-G-C 11348778-G-C *
13514781-G-A 11359105-G-A *
13537682-A-C 11382006-A-C *
13616427-T-TAAA 11460751-T-TAAA 28×A*
13638776-G-T 11483100-G-T *
13702157-T-G 11546481-T-G *
13718123-T-A 11562447-T-A *
13728479-A-AGAATGGAATGGAATGGAATGGAATG 11572803-A-AGAATGGAATGGAATGGAATGGAATG 9×GAATG*
13745151-A-C 11589475-A-C *
14153382-C-G 12032676-C-G Y*
14153383-T-A 12032677-T-A Y*
14468822-G-C 12348091-G-C YY14×A*
13487272-C-T 11331596-C-T *
15643595-A-G 13531715-A-G Y*
15807280-T-C 13695400-T-C Y*
15796171-A-T 13684291-A-T Y*
15796164-A-G 13684284-A-G Y*
15753178-CTTTTTT-C,CTTTT 13641298-CTTTTTT-C,CTTTT 20×T*
15643622-T-TC 13531742-T-TC *
15643601-C-T 13531721-C-T Y*
15490256-TAA-T 13378376-TAA-T 10×A*
14986179-A-AGCCTCCCAAAGTGCTGGGATTACAGGTGTGAGCCACTG 12874247-A-AGCCTCCCAAAGTGCTGGGATTACAGGTGTGAGCCACTG *
15352706-G-A 13240825-G-A YY*
15321328-GT-G,GTTT 13209446-GT-G,GTTT 25×T*
15197744-CTT-C 13085830-CTT-C 10×T*
15045182-G-T 12933272-G-T Y*
15045176-G-T 12933266-G-T Y*
15045172-C-T 12933262-C-T Y*
13488806-G-A,T 11333130-G-A,T *
13484986-T-G 11329310-T-G *
15932073-T-C 13820193-T-C Y*
13473926-A-C 11318250-A-C *
13466918-G-A 11311242-G-A *
13467269-T-A 11311593-T-A *
13467295-G-C 11311619-G-C *
13467310-A-G 11311634-A-G *
13467379-C-G 11311703-C-G FT444007 *
13469130-C-CCTTTAGGCAGAGCTTAGAGCAGAGTTACATCACCTGTGTGATCAGTGCAGAGATATCTCACAATGCCT 11313454-C-CCTTTAGGCAGAGCTTAGAGCAGAGTTACATCACCTGTGTGATCAGTGCAGAGATATCTCACAATGCCT *
13469172-TCA-T 11313496-TCA-T *
13469175-GTGCAGAGATATGTCACAATGCCTCCATAGGCAAATCCAAGTTGAGATTCTGTCACCTGTGTGATC-G 11313499-GTGCAGAGATATGTCACAATGCCTCCATAGGCAAATCCAAGTTGAGATTCTGTCACCTGTGTGATC-G *
13469294-C-T 11313618-C-T *
13469298-A-T 11313622-A-T *
13470275-C-T 11314599-C-T *
13470280-A-T 11314604-A-T *
13470281-C-T 11314605-C-T *
13473766-G-A 11318090-G-A *
11319664-T- *
13484941-C-A 11329265-C-A *
11323445-T- *
13484919-T-C 11329243-T-C *
13484171-CAG-C 11328495-CAG-C *
13481502-G-C 11325826-G-C *
13481457-A-AGAGCCAAGACAAGAGTTACATCAC 11325781-A-AGAGCCAAGACAAGAGTTACATCAC *
13479163-C-CTGGTAAATTCCGGCTGAAGCTCTCCCAA 11323487-C-CTGGTAAATTCCGGCTGAAGCTCTCCCAA *
13479153-C-T 11323477-C-T *
11323444-A- *
13475901-G-T 11320225-G-T *
13478655-T-A 11322979-T-A *
13478651-C-T 11322975-C-T BY86007 *
13478613-A-C 11322937-A-C *
13476691-G-C 11321015-G-C *
11321008-T- *
13475933-A-T 11320257-A-T *
15931970-T-C 13820090-T-C Y*
15956832-G-A 13844952-G-A YY*
13465984-C-CCCA 11310308-C-CCCA *
23210311-A-G 21048425-A-G Y*
22479545-A-G 20317659-A-G DYZ19 *
22486538-GCCGCCGACCTTAGTGGTGAGTGTTACACCATTTAAAGGTGTTATGTCCAGACTTTGTTCCTTCAGATATGTCCGGAGATTCTTCCTTCTGGCAGGTTCTTTGTCTTGCTCATTGCAAGAATGAAA-G 20324652-GCCGCCGACCTTAGTGGTGAGTGTTACACCATTTAAAGGTGTTATGTCCAGACTTTGTTCCTTCAGATATGTCCGGAGATTCTTCCTTCTGGCAGGTTCTTTGTCTTGCTCATTGCAAGAATGAAA-G DYZ19 *
22508734-C-T 20346848-C-T DYZ19 *
22510562-C-A 20348676-C-A DYZ19 *
22510611-G-C 20348725-G-C BY225664 DYZ19 *
22510612-G-T 20348726-G-T BY35418 DYZ19 *
22510615-T-C 20348729-T-C DYZ19 *
22590654-A-G 20428768-A-G YY*
22610030-CTT-C 20448144-CTT-C 10×T*
22790924-C-G 20629038-C-G YY*
22829665-G-T 20667779-G-T YY*
23003578-T-C 20841692-T-C YY*
23017462-C-CT 20855576-C-CT *
23019600-A-G 20857714-A-G Y*
23452126-A-G 21290240-A-G YY*
22479446-G-A 20317560-G-A DYZ19 *
56756868-GGAATGGAATGGA-G *
56850414-G-C *
56839465-G-A *
56828547-T-A *
56763426-T-G *
56763406-A-T *
56757026-A-T *
56715493-A-G *
24423271-A-G 22277124-A-G Y*
56706781-A-C *
28747718-T-C 26601571-T-C Y*
28117295-C-A,A 25971148-C-A,A P1_b4 *
27038161-T-A 24892014-T-A P1_r4 *
25335133-G-GT 23188986-G-GT P2_r1 11×T*
25106373-G-C 22960226-G-C g1 *
22479465-T-C 20317579-T-C DYZ19 *
22479419-T-C 20317533-T-C DYZ19 *
16357341-T-C 14245461-T-C YY*
21498234-T-C 19336348-T-C Y*
16605609-A-G 14493729-A-G YY*
16882059-C-T 14770179-C-T Y*
17050121-G-T 14938241-G-T YY*
17050514-T-TA 14938634-T-TA 8×A*
17322366-A-T 15210486-A-T YY*
17728934-C-T 15617054-C-T YY*
17947121-T-C 15835241-T-C YY*
17951299-ATTTTTTTT-A,ATTTTTTT 15839419-ATTTTTTTT-A,ATTTTTTT 25×T*
18019515-CGT-C 15907635-CGT-C *
19048005-C-A 16936125-C-A YY*
19174327-C-A 17062447-C-A Y*
19290546-A-T 17178666-A-T YY*
19382416-G-A 17270536-G-A Y*
20557567-A-G 18395681-A-G P5_Dst *
21538981-A-G 19377095-A-G Y*
22473514-A-G 20311628-A-G DYZ19 *
22364663-T-C 20202777-T-C DYZ19 *
22473485-G-C 20311599-G-C DYZ19 *
22458143-TTTGTTCCTTCAGATAAGTCCAGAGA-T 20296257-TTTGTTCCTTCAGATAAGTCCAGAGA-T DYZ19 *
22446148-TTTTA-T 20284262-TTTTA-T DYZ19 *
20274510-ATTAAAGGTGTTATGTCCAGAGTTTGTTCCTTCAGATGTGTCCAGAGTTTCTTCCTTCTGGCAGGTTCATGGGCTTGCTCACTTCAAGAATGAAGCTGCAGACCTTTACGGTGAGTGTTACAGCAC- DYZ19 *
22367974-GAGTGTTGCAGTACTTAAAGCTGTTATGTCCAGAGTTTGATCCTTCAGATGTTTCCAGAGTTTCTTCCTTCTGGCAGGTTCGTGGTCTTGCTCACTTCTTTAATGAAGCTGCAGACCATACTGGT-G 20206088-GAGTGTTGCAGTACTTAAAGCTGTTATGTCCAGAGTTTGATCCTTCAGATGTTTCCAGAGTTTCTTCCTTCTGGCAGGTTCGTGGTCTTGCTCACTTCTTTAATGAAGCTGCAGACCATACTGGT-G DYZ19 *
22367972-GT-G 20206086-GT-G DYZ19 *
22364656-G-T 20202770-G-T DYZ19 *
21660280-A-G 19498394-A-G YY*
22353535-A-T 20191649-A-T DYZ19 *
22321849-C-G 20159963-C-G DYZ19 *
22283632-C-G 20121746-C-G DYZ19 *
22279786-C-T 20117900-C-T DYZ19 *
22093188-G-A 19931302-G-A YY*
21807043-C-T 19645157-C-T YY*
13465986-C-T 11310310-C-T *
13465976-A-T 11310300-A-T *
13478384-AGGAG-A 11322708-AGGAG-A *
13485950-G-A 11330274-G-A *
13481470-C-A 11325794-C-A *
10908294-C-CTA *
13484070-A-G 11328394-A-G *
13484114-A-C 11328438-A-C *
56706804-T-A *
13470581-G-T 11314905-G-T *
13396622-AT-A 11240946-AT-A *
13396625-CTCCT-C 11240949-CTCCT-C *
13396634-CTCATCTGAG-C 11240958-CTCATCTGAG-C *
13396654-T-C 11240978-T-C *
13396655-ATC-A 11240979-ATC-A *
13476944-G-T 11321268-G-T *
13476952-A-T 11321276-A-T *
13485940-G-A 11330264-G-A *
13734123-AATGGAATGGAACGGAATTGAATGTC-A 11578447-AATGGAATGGAACGGAATTGAATGTC-A *
14612239-G-GGATAGATA,GGATAGATA 12500445-G-GGATAGATA,GGATAGATA 9×GATA*
13468126-T-A 11312450-T-A *
3134179-G-A 3266138-G-A *
2994613-G-GTTT 3126572-G-GTTT 14×T*
2946102-T-C 3078061-T-C *
2759942-C-A 2891901-C-A YY*
13266803-G-A 11111127-G-A *
13468150-T-A 11312474-T-A *
13482124-G-C 11326448-G-C *
56876123-GCAAAAAAAAAAAAAAAAAAAAAAA-G *
56685744-T-A *
13711495-A-C 11555819-A-C *
13519282-A-G 11363606-A-G *
13505902-A-G 11350226-A-G *
13505887-C-A 11350211-C-A *
13489402-T-A 11333726-T-A *
3788671-T-TAA 3920630-T-TAA 13×A*
26433572-C-CTT 24287425-C-CTT P1_Y1 19×T*
3539980-G-A 3671939-G-A *
13469369-G-A 11313693-G-A *
13479028-T-A 11323352-T-A *
11334025-C- *
13466922-T-C 11311246-T-C *
11578452-AATGGAACGGAATTGAATGTC- *
13489686-CAT-C 11334010-CAT-C *
13465053-A-G 11309377-A-G *
13469168-G-T 11313492-G-T *
22448635-T-G 20286749-T-G DYZ19 *
10895887-A-C *
10967547-CCATTCCATTA-C *
13465103-C-A 11309427-C-A *
13909599-CAAAA-C 11788893-CAAAA-C 14×A*
22238276-G-C 20076390-G-C DYZ19 *
11318185-GC- *
13481450-A-AAT 11325774-A-AAT *
13489963-A-G 11334287-A-G *
13484022-C-T 11328346-C-T *
11321007-C- *
22272852-G-GAT 20110966-G-GAT DYZ19 *
13470623-C-G 11314947-C-G *
13445362-CAAAA-C,CAAA 11289686-CAAAA-C,CAAA 15×A*
22287092-AAG-A 20125206-AAG-A DYZ19 *
13481475-A-G 11325799-A-G *
7788735-C-CA 7920694-C-CA 10×A*
13481460-G-GCGAGA 11325784-G-GCGAGA *
14612335-TGATA-T,T 12500541-TGATA-T,T 12×GATA*
7567753-C-CT,CTT 7699712-C-CT,CTT 25×T*
5502254-C-CAA 5634213-C-CAA 16×A*
13484181-T-A 11328505-T-A *
12631481-CT-C,C 13×T*
13451163-T-TCCTCTGCACTCC 11295487-T-TCCTCTGCACTCC *
3266103-T-C 3398062-T-C *
3700360-T-C 3832319-T-C *
13465148-G-GCAA 11309472-G-GCAA *
13348769-A-G 11193093-A-G *
9963459-G-GCACGGTCTCCTTC 10125850-G-GCACGGTCTCCTTC *
10032391-AT-A 10194782-AT-A *
10082054-C-T 10244445-C-T *
10693715-A- *
10749157-C-T *
10767676-C-CACTCCACTAT *
10773464-CG-C *
10870514-CTCCAT-C *
10922136-T-G *
10924980-CTCCACTCCATTCCATTCCATTCCAT-C *
10934821-A-T *
10955038-GTCCAGTCCACTCCGTTCCATTCCATTCCATTCCATTGCACTCCACTCCACTACACTACACTACGCTACACTACACTACTCTCCATTATAGTCCATTCCACTCCATTTCAGTCGACTCCAC-G *
10986925-T-TC *
13291238-C-T 11135562-C-T *
13388702-A-T 11233026-A-T *
9645653-CTT-C,CTTTT 9808044-CTT-C,CTTTT IR3_Prx 20×T*
13464967-C-G 11309291-C-G *
13465138-CA-C 11309462-CA-C *
13465137-C-T 11309461-C-T *
11309458-C- *
13465128-TTACATC-T 11309452-TTACATC-T *
13464981-C-G 11309305-C-G *
13464978-A-T 11309302-A-T *
13464962-AG-A 11309286-AG-A *
13405154-T-TA 11249478-T-TA *
13464957-C-G 11309281-C-G *
13462288-T-C 11306612-T-C *
13460521-T-A 11304845-T-A *
13448699-C-T 11293023-C-T *
13448670-A-T 11292994-A-T *
13447167-C-CG 11291491-C-CG *
9805139-A-G 9967530-A-G YY*
9453334-T-C 9615725-T-C YY*
3845906-C-T 3977865-C-T *
5142277-T-C 5274236-T-C *
6390077-A-G 6522036-A-G *
6020688-GT-G,GTTT 6152647-GT-G,GTTT 23×T*
5786607-TC-T 5918566-TC-T *
5523917-C-CTTT 5655876-C-CTTT 24×T*
5512903-A-G 5644862-A-G *
5155891-C-A 5287850-C-A *
5115855-A-C 5247814-A-C *
6688165-T-TAA 6820124-T-TAA 10×A*
5035558-TTG-T,T 5167517-TTG-T,T 22×TG*
4487836-C-A 4619795-C-A *
4430676-CACA-C 4562635-CACA-C 5×ACA*
4318815-AT-A 4450774-AT-A *
3951862-A-T 4083821-A-T *
3951859-A-ACTG 4083818-A-ACTG *
6489371-C-CA,CA 6621330-C-CA,CA 25×A*
6861417-A-G 6993376-A-G YY*
9364764-C-G 9527155-C-G Y*
8008138-T-C 8140097-T-C YY*
9007946-C-A 9170337-C-A BY12542 Y*
8563745-CTT-C,CT 8695704-CTT-C,CT 21×T*
8470549-C-CAAAAAA 8602508-C-CAAAAAA 22×A*
8407602-T-TG,TG 8539561-T-TG,TG *
8158241-A-G 8290200-A-G YY*
8112197-AC-A 8244156-AC-A *
7960965-AT-A 8092924-AT-A 10×T*
6981281-C-T 7113240-C-T YY*
7742916-TAA-T 7874875-TAA-T 11×A*
7470700-C-CAAAA 7602659-C-CAAAA IR1_L 25×A*
7392082-A-G 7524041-A-G Y*
7198817-C-CAA 7330776-C-CAA 10×A*
7186507-ATTT-A 7318466-ATTT-A 13×T*
7029435-T-TTC 7161394-T-TTC *
7320994-GAC-G 7452953-GAC-G 9×AC*
56871637-T-A *
22238379-CTG-C 20076493-CTG-C DYZ19 *
58883557-C-A 56707314-G-T *
22422590-A-G 20260704-A-G DYZ19 *
13474529-G-A 11318853-G-A *
9418243-TTGTGTG-T 9580634-TTGTGTG-T 17×TG*
24108403-GT-G 21962256-GT-G P3_b1 12×T*
13718399-T-G 11562723-T-G *
13529380-A-AG 11373704-A-AG *
5739062-GT-G 5871021-GT-G 10×T*
22508367-C-A 20346481-C-A DYZ19 *
58836846-C-G 56754025-G-C *
2702927-TA-T 2834886-TA-T 9×A*
13465389-C-G 11309713-C-G *
22233154-T-C 20071268-T-C DYZ19 *
25246320-CCTT-C 23100173-CCTT-C P2_r1 *
58827464-C-A 56763407-G-T *
13734061-C-G 11578385-C-G *
22508397-A-C 20346511-A-C DYZ19 *
13433281-C-CT 11277605-C-CT *
21464771-GTTCTTC-G,GTTC 19302885-GTTCTTC-G,GTTC 16×TTC*
10774516-A-G Y125021 *
13467266-C-A 11311590-C-A *
6250518-TCA-T 6382477-TCA-T IR3_Dst 8×CA*
56832512-C-A *
5155953-TAA-T 5287912-TAA-T 13×A****
14825721-T-. 12713788-G-T *
22800905-A-AT 20639019-A-AT 9×T*
14898435-C-CTTT 12786501-C-CTT 15×T*
14490989-C-T 12370258-C-T FT50209 YY*
14910798-AT-A,ATT 12798865-AT-A,ATT 21×T*
4292835-TAA-T 4424794-TAA-T 13×A*
11001448-A-G *
21414989-G-GA 19253103-G-GA 10×A*
8703659-AT-A,ATT 8835618-AT-A,ATT 18×T*
25624529-G-GT 23478382-G-GT P1_b3 12×T*
13714652-T-A 11558976-T-A *
21295234-CT-C,CTT 19133348-CT-C,CTT 17×T*
10037727-C-T 10200118-C-T *
58884082-C-T 56706789-G-A *
59007971-A-C 56861824-A-C *
22359469-G-C 20197583-G-C BY50560 DYZ19 *
22359436-C-T 20197550-C-T DYZ19 *
22359421-A-G 20197535-A-G DYZ19 *
22359391-C-T 20197505-C-T DYZ19 *
13453880-T-C 11298204-T-C *
13478473-G-T 11322797-G-T *
59016948-G-T 56870801-G-T *
3154138-T-G 3286097-T-G *
22510013-G-C 20348127-G-C DYZ19 *
3952340-TGAGAGA-T 4084299-TGAGAGA-T 20×GA*
21397822-TA-T 19235936-TA-T 9×A*
13942606-TAC-T 11821900-TAC-T 9×AC*
13487944-G-T 11332268-G-T *
13595434-T-C 11439758-T-C *
13487819-C-T 11332143-C-T *
13737096-T-G 11581420-T-G *
13553672-G-GA 11397996-G-GA 12×A*
13489634-C-T 11333958-C-T *
13489368-C-A 11333692-C-A *
13474492-C-A 11318816-C-A *
13478216-G-A 11322540-G-A A15570 *
13332172-T-C 11176496-T-C *
7003116-T-A 7135075-T-A Y*
13595444-C-T 11439768-C-T *
7003106-G-T 7135065-G-T Y*
13485761-A-T 11330085-A-T *
13296452-C-A 11140776-C-A *
13711545-A-G 11555869-A-G *
13346071-CA-C 11190395-CA-C 18×A*
13611525-A-G 11455849-A-G *
13462180-C-A 11306504-C-A *
18718886-ATATCTATC-A,ATATC 16607006-ATATCTATC-A,ATATC 13×TATC*
26834853-A-AAAGG,G 24688706-A-AAAGG,G P1_g2 11×AAGG*
13489640-C-T 11333964-C-T *
13502674-C-A 11346998-C-A *
13473793-C-G 11318117-C-G *
7474374-AAGAGAG-A,AAG 7606333-AAGAGAG-A,AAG IR1_L 21×AG*
17256854-C-CTT 15144974-C-CTT 14×T*
6521551-GTTT-G 6653510-GTTT-G 17×T*
5031253-GA-G 5163212-GA-G 10×A*
13489598-C-T 11333922-C-T *
13489813-T-A 11334137-T-A *
56855640-G-A *
56835935-A-C *
5728147-GA-G 5860106-GA-G 9×A*
13474736-G-C 11319060-G-C *
13461124-G-T 11305448-G-T *
8377909-TACACAC-T 8509868-TACACAC-T 16×AC*
13472106-C-G 11316430-C-G *
10889373-A-C *
8154151-G-T 8286110-G-T YY*
13473781-A-G 11318105-A-G *
13714941-G-A 11559265-G-A *
13708082-G-A 11552406-G-A *
13708069-A-T 11552393-A-T *
13708065-T-C 11552389-T-C *
6403274-C-T 6535233-C-T *
3908945-C-CA 4040904-C-CA 15×A*
3293062-T-A 3425021-T-A *
13475404-G-T 11319728-G-T *
10986878-A-T *
10082062-G-C 10244453-G-C *
10082045-T-A 10244436-T-A *
10082024-A-T 10244415-A-T *
13483363-AT-A 11327687-AT-A *
6517443-C-CT 6649402-C-CT 10×T*
14557626-G-A 12445827-G-A Y*
56834610-C-CTTTAA *
56850416-A-T *
4658822-G-GA 4790781-G-GA 9×A*
8154164-G-T 8286123-G-T YY*
6889300-CT-C 7021259-CT-C 9×T*
16739069-GAA-G 14627189-GAA-G 17×A*
17201762-C-CTT 15089882-C-CTT 16×T*
10895870-C-G *
13475387-C-A 11319711-C-A *
10908391-A-G *
13718744-T-A 11563068-T-A *
10908390-C-T *
10908375-G-A *
10908361-G-C *
11001546-T-C *
13489681-C-A 11334005-C-A *
10904081-A-T *
56842312-G-A *
13473822-C-A 11318146-C-A *
17117423-AT-A 15005543-AT-A 9×T*
15980721-TAAA-T 13868841-TAAA-T 17×A*
8498731-A-AT 8630690-A-AT 10×T*
13489821-G-T 11334145-G-T *
9127055-G-GA 9289446-G-GA 10×A*
13930635-CT-C 11809929-CT-C 9×T*
22555369-G-GT 20393483-G-GT 9×T*
13478364-G-A 11322688-G-A *
14557662-T-C 12445863-T-C FT99314 Y*
13462277-C-A 11306601-C-A *
3296888-A-ACT 3428847-A-ACT 12×CT*
10660086-C-T *
18934769-GT-G 16822889-GT-G 10×T*
10908322-C-A *
56842387-CTG-C *
11001432-C-A *
22509989-T-A 20348103-T-A BY225598 DYZ19 *
22238311-C-A 20076425-C-A DYZ19 *
13481362-C-A 11325686-C-A *
3377786-T-A 3509745-T-A *
8742765-AATG-A 8874724-AATG-A 8×ATG*
6503431-T-A 6635390-T-A *
5824050-GGA-G 5956009-GGA-G 10×GA*
5344897-A-G 5476856-A-G *
3487032-C-T 3618991-C-T *
3434288-CT-C 3566247-CT-C *
3266087-C-T 3398046-C-T *
10055473-T-A 10217864-T-A *
22509039-G-T 20347153-G-T BY3989BY196744 DYZ19 *
13475930-T-A 11320254-T-A *
13434927-A-C 11279251-A-C *
13434946-C-A 11279270-C-A *
13595418-T-G 11439742-T-G *
13465494-T-G 11309818-T-G *
9957060-A-G 10119451-A-G Y*
13194529-T-C 11038853-T-C *
18871951-AT-A 16760071-AT-A 8×T*
13307063-C-A 11151387-C-A *
13443341-A-G 11287665-A-G *
13438425-T-G 11282749-T-G *
13400069-C-T 11244393-C-T *
13390135-A-G 11234459-A-G *
13385219-A-G 11229543-A-G *
13346088-A-G 11190412-A-G 8×AG*
13306982-G-T 11151306-G-T *
13256166-C-T 11100490-C-T *
13306980-A-C 11151304-A-C *
13306702-C-T 11151026-C-T *
13306660-G-A 11150984-G-A *
13303074-A-G 11147398-A-G *
13294838-TTA-T 11139162-TTA-T *
13272409-AC-A 11116733-AC-A *
7428231-A-C 7560190-A-C YY*
24929439-TACAC-T 22783292-TACAC-T g1 14×AC*
13640909-G-T 11485233-G-T *
13718009-G-C 11562333-G-C *
22359444-C-A 20197558-C-A DYZ19 *
13464964-C-T 11309288-C-T *
22440108-A-G 20278222-A-G FGC66774 DYZ19 *
58981059-G-T 56834912-G-T *
9967520-T-C 10129911-T-C Y*
13700512-CTCCAATGGAATGGAG-C 11544836-CTCCAATGGAATGGAG-C *
13688181-A-AGAATGGAATGGAATGGAATG 11532505-A-AGAATGGAATGGAATGGAATG 8×GAATG*
13385207-T-C 11229531-T-C *
7508355-TTTCC-T 7640314-TTTCC-T L1403 13×TTCC*
28536045-TAC-T 26389898-TAC-T *
22475030-G-T 20313144-G-T BY223268 DYZ19 *
58883943-T-C 56706928-A-G *
13467219-AC-A 11311543-AC-A *
15667208-C-G 13555328-C-G YSC0000179 FGC1168 SK2006 Y*
22448697-TC-T 20286811-TC-T DYZ19 *
13474767-C-A 11319091-C-A *
22297974-C-A 20136088-C-A A4061 DYZ19 *
27087610-GCCTTCCTTCCTT-G 24941463-GCCTTCCTTCCTT-G P1_r4 15×CCTT*
13720226-T-A 11564550-T-A *
13309070-T-C 11153394-T-C *
28790623-ATGGAATGGAG-A 26644476-ATGGAATGGAG-A *
13728623-T-A 11572947-T-A *
13526424-C-T 11370748-C-T *
13526375-T-G 11370699-T-G *
3280099-A-G 3412058-A-G *
13475767-A-T 11320091-A-T *
13545353-AAAG-A 11389677-AAAG-A *
28717005-G-A 26570858-G-A CTS12832 *
28716998-C-A 26570851-C-A CTS12831 *
13745150-G-T 11589474-G-T *
26538252-C-CA 24392105-C-CA P1_g2 17×A*
24535250-T-C 22389103-T-C P3_t2 *
13454842-TATTCC-T 11299166-TATTCC-T 7×ATTCC*
13718274-C-G 11562598-C-G *
28803154-A-C 26657007-A-C *
59022252-A-G 56876105-A-G *
13489374-C-T 11333698-C-T *
28812970-T-C 26666823-T-C *
13263785-A-G 11108109-A-G *
28146580-AT-A 26000433-AT-A P1_b4 10×T*
7103038-TACAC-T 7234997-TACAC-T 17×AC*
59023580-T-C 56877433-T-C *
59020916-G-C 56874769-G-C *
13483974-G-A 11328298-G-A *
59018408-T-A 56872261-T-A *
59017911-A-C 56871764-A-C *
59015192-G-T 56869045-G-T *
59011897-C-A 56865750-C-A *
59011040-T-C 56864893-T-C *
59009727-C-T 56863580-C-T *
19103880-G-GTT 16992000-G-GTT Y19534 13×T*
22259538-A-T 20097652-A-T DYZ19 *
22475053-T-G 20313167-T-G Z23635 DYZ19 *
9963288-T-A 10125679-T-A Y*
22448689-G-T 20286803-G-T DYZ19 *
22448687-A-T 20286801-A-T DYZ19 *
13718005-G-A 11562329-G-A *
13717982-G-T 11562306-G-T *
8407743-G-GC 8539702-G-GC 9×C*
13489621-C-CCTT 11333945-C-CCTT *
13592861-T-C 11437185-T-C *
22422578-CT-C 20260692-CT-C DYZ19 *
22287097-G-T 20125211-G-T DYZ19 *
13489496-A-G 11333820-A-G *
13345990-A-G 11190314-A-G FGC50080 *
22474930-T-G 20313044-T-G FGC12059Z3484 DYZ19 *
13711284-G-A 11555608-G-A *
22448747-G-C 20286861-G-C DYZ19 *
22512135-A-T 20350249-A-T DYZ19 *
14004508-GCA-G 11883802-GCA-G 9×CA*
13718624-C-T 11562948-C-T *
3980895-G-GA 4112854-G-GA 9×A*
9341165-A-G 9503556-A-G Y*
7325111-TTA-T 7457070-TTA-T *
7282159-C-CTT 7414118-C-CTT 22×T*
6934730-G-T 7066689-G-T YY*
22475023-C-A 20313137-C-A DYZ19 *
22475014-T-G 20313128-T-G DYZ19 *
13530684-A-T 11375008-A-T *
10022163-G-A 10184554-G-A Y*
59017782-T-A 56871635-T-A *
22552145-T-TA 20390259-T-TA Y145554 9×A*
22050672-CT-C 19888786-CT-C 9×T*
19073940-TAC-T 16962060-TAC-T *
17332772-ATCG-A 15220892-ATCG-A *
17007110-GCA-G 14895230-GCA-G *
9957065-A-T 10119456-A-T Y*
13254537-A-T 11098861-A-T *
13722664-A-C 11566988-A-C *
13694209-A-G 11538533-A-G *
13718736-T-C 11563060-T-C *
13718471-G-C 11562795-G-C *
13718316-GAATGGAATGGAATGA-G 11562640-GAATGGAATGGAATGA-G *
13711891-A-G 11556215-A-G *
13711882-G-A 11556206-G-A *
13711849-G-A 11556173-G-A *
13410560-C-A 11254884-C-A *
13257389-G-A 11101713-G-A *
13404362-C-T 11248686-C-T *
13399159-G-A 11243483-G-A *
13306707-ACT-A 11151031-ACT-A *
13293529-T-A 11137853-T-A *
13293525-A-T 11137849-A-T *
13263674-G-A 11107998-G-A *
13261212-C-T 11105536-C-T *
22238377-A-ATC 20076491-A-ATC DYZ19 *
22505732-T-G 20343846-T-G DYZ19 *
13481366-G-T 11325690-G-T *
13476532-C-G 11320856-C-G *
7003134-A-G 7135093-A-G Y*
9994716-T-A 10157107-T-A Y*
10802080-C-G *
10802091-C-A *
13396438-G-A 11240762-G-A *
13524174-G-A 11368498-G-A *
13529366-T-G 11373690-T-G *
13590701-G-A 11435025-G-A *
13590702-C-T 11435026-C-T *
13590730-C-T 11435054-C-T *
13590731-A-G 11435055-A-G *
13488052-T-A 11332376-T-A *
6089764-GTT-G,GT 6221723-GTT-G,GT 31×T*
13476557-A-G 11320881-A-G *
13529361-A-T 11373685-A-T *
13476576-G-T 11320900-G-T *
13476600-G-T 11320924-G-T *
13476604-A-G 11320928-A-G *
13476617-G-T 11320941-G-T *
8448119-AT-A 8580078-AT-A 10×T*
13478479-C-T 11322803-C-T *
12489022-TACAC-T,TAC 16×AC*
13438462-A-C 11282786-A-C *
16447158-AACACACAC-A,AAC 14335278-AACACACAC-A,AAC 22×AC*
9942758-G-C 10105149-G-C Y*
13399514-A-AT 11243838-A-AT 10×T*
13603629-A-AT 11447953-A-AT 15×T*
13691712-A-T 11536036-A-T *
13481034-T-A 11325358-T-A *
13479099-C-T 11323423-C-T *
13565515-T-G 11409839-T-G *
7003166-G-A 7135125-G-A Y*
56856588-C-T *
13514284-G-T 11358608-G-T *
13514547-C-T 11358871-C-T *
13519254-G-T 11363578-G-T *
13528269-T-C 11372593-T-C *
13530702-G-T 11375026-G-T *
13586770-C-T 11431094-C-T *
13590560-G-A 11434884-G-A *
13598501-A-G 11442825-A-G *
13598511-C-G 11442835-C-G *
10976180-G-A *
13693629-G-C 11537953-G-C *
22458184-T-G 20296298-T-G DYZ19 ***
28584356-T-G 26438209-T-G *
28809769-G-T 26663622-G-T *
10889371-T-TCCTCC *
13523622-C-CAA 11367946-C-CAA *
56863749-G-A *
13490777-TAAAAG-T 11335101-TAAAAG-T *
13694839-C-A 11539163-C-A *
56859636-G-A *
28809753-T-C 26663606-T-C *
13531769-AAAAAAAAC-A 11376093-AAAAAAAAC-A *
13489289-G-T 11333613-G-T *
13549902-GTGTGTC-G 11394226-GTGTGTC-G *
56833363-C-CTCCATTCCATTCCATTCTACTCCATTCCAT *
3200263-CTGTGTG-C,CTGTG 3332222-CTGTGTG-C,CTGTG 15×TG*
4120195-AACACAC-A 4252154-AACACAC-A 21×AC*
5885123-TA-T,TAA 6017082-TA-T,TAA 17×A*
13420103-C-T 11264427-C-T *
13484204-G-T 11328528-G-T *
13296447-A-C 11140771-A-C *
13319654-G-A 11163978-G-A *
13495992-C-G 11340316-C-G *
13462612-T-C 11306936-T-C *
22510620-T-C 20348734-T-C DYZ19 *
9951180-C-G 10113571-C-G Y*
10013934-C-T 10176325-C-T Y*
10013949-A-T 10176340-A-T Y*
10908296-C-T *
13439940-G-T 11284264-G-T *
13485009-C-T 11329333-C-T *
13591575-T-G 11435899-T-G *
13591578-A-T 11435902-A-T *
28791903-G-A 26645756-G-A *
28791906-G-A 26645759-G-A *
13250598-G-T 11094922-G-T *
13250599-T-C 11094923-T-C *
13462607-C-T 11306931-C-T *
13469081-C-T 11313405-C-T *
21898354-C-CT 19736468-C-CT 9×T*
13469160-T-A 11313484-T-A *
13473823-C-G 11318147-C-G *
13473851-A-G 11318175-A-G *
13474257-A-T 11318581-A-T *
13479006-C-A 11323330-C-A *
13479009-G-C 11323333-G-C *
13489549-C-A 11333873-C-A *
13489625-ACCAC-A 11333949-ACCAC-A *
13489637-C-CCCCA 11333961-C-CCCCA *
13489751-C-T 11334075-C-T *
13489790-G-T 11334114-G-T *
13706121-A-ACG 11550445-A-ACG *
13734088-CATAGA-C 11578412-CATAGA-C *
13734169-A-T 11578493-A-T *
22510619-G-T 20348733-G-T DYZ19 *
13610809-A-G 11455133-A-G *
13502628-AC-A 11346952-AC-A *
13535167-T-C 11379491-T-C *
13539438-A-G 11383762-A-G *
9943642-G-T 10106033-G-T Y*
13528494-A-G 11372818-A-G *
13563578-A-T 11407902-A-T *
13638451-A-G 11482775-A-G *
13345961-T-TC 11190285-T-TC *
22479516-T-C 20317630-T-C DYZ19 *
22298381-G-C 20136495-G-C FT455407 DYZ19 *
21535757-A-T 19373871-A-T Y*
13590531-GT-G 11434855-GT-G *
13465463-C-A 11309787-C-A *
13569638-C-G 11413962-C-G *
13479062-C-A 11323386-C-A ****
13489383-CG-C 11333707-CG-C *
22438744-C-G 20276858-C-G DYZ19 *
13501657-A-T 11345981-A-T *
21689937-G-GT 19528051-G-GT 9×T*
13479210-A-C 11323534-A-C *
13479211-G-A 11323535-G-A *
13479222-G-C 11323546-G-C *
3501955-CAA-C,CA 3633914-CAA-C,CA 22×A*
6447774-GTT-G,GT 6579733-GTT-G,GT 16×T*
5899095-GT-G 6031054-GT-G 10×T*
6597340-TAAAAAAAAAA-T,TAAAAAAAAAAA 6729299-TAAAAAAAAAA-T,TAAAAAAAAAAA 28×A*
13475838-C-A 11320162-C-A *
13443597-G-A 11287921-G-A *
13577962-G-A 11422286-G-A *
13711861-A-C 11556185-A-C *
6457074-GT-G 6589033-GT-G 9×T*
13483139-A-C 11327463-A-C *
13502813-A-ATT 11347137-A-ATT 8×T*
13638540-C-T 11482864-C-T *
13475825-C-A 11320149-C-A *
13711486-A-G 11555810-A-G *
56850408-C-A *
10846955-C-T *
13472124-T-A 11316448-T-A *
5786590-C-A 5918549-C-A *
13478362-G-A 11322686-G-A *
13489678-C-A 11334002-C-A *
13711469-G-T 11555793-G-T *
6440192-CT-C 6572151-CT-C 8×T*
8571150-CA-C,CAA 8703109-CA-C,CAA 14×A*
4981838-G-GGT 5113797-G-GGT 14×GT*
11001437-T-TTGC *
17861949-CT-C 15750069-CT-C 10×T*
17170167-CT-C,CTT 15058287-CT-C,CTT 21×T*
58883730-T-A 56707141-A-T *
13489757-C-A 11334081-C-A *
13460483-T-A 11304807-T-A *
58883772-C-G 56707099-G-C *
13566453-C-A 11410777-C-A *
13489895-G-C 11334219-G-C *
6858592-CT-C,CTT 6990551-CT-C,CTT 25×T*
13375827-T-A 11220151-T-A *
13525718-G-A 11370042-G-A *
13504722-C-A 11349046-C-A *
13467262-T-A 11311586-T-A *
13566439-G-C 11410763-G-C *
13693639-C-T 11537963-C-T *
10013883-G-A 10176274-G-A Y*
13462256-C-G 11306580-C-G *
8428944-CAAA-C,CAA 8560903-CAAA-C,CAA 25×A*
13489303-G-C 11333627-G-C *
13470474-G-C 11314798-G-C *
13484951-G-T 11329275-G-T *
59012367-T-C 56866220-T-C *
4799565-A-C 4931524-A-C FGC47851 *
13314944-G-C 11159268-G-C *
28790600-G-A 26644453-G-A *
28813787-T-G 26667640-T-G BY152177 *
13689325-C-T 11533649-C-T *
28803182-G-T 26657035-G-T *
13458694-T-A 11303018-T-A *
3768648-G-GT 3900607-G-GT 10×T*
13474787-C-A 11319111-C-A *
22509555-A-T 20347669-A-T DYZ19 *
13214292-T-C 11058616-T-C *
13718409-T-G 11562733-T-G *
13718407-A-G 11562731-A-G *
13691696-A-C 11536020-A-C *
13691686-T-C 11536010-T-C FT448705 *
13484207-T-A 11328531-T-A *
15400167-CAAAA-C 13288287-CAAAA-C 14×A*
5728934-T-TAG 5860893-T-TAG *
13483391-C-T 11327715-C-T *
10899391-CTCCAT-C *
13484226-A-G 11328550-A-G *
10922135-C-T *
17925209-AT-A 15813329-AT-A 9×T*
14490984-G-A 12370253-G-A YY*
21189668-CA-C,CAA 19027782-CA-C,CAA 23×A*
13489729-CTGG-C 11334053-CTGG-C *
56828901-ATCCATTCCATTCCATTCCATGTCATTCCAT-A 4×TCCAT*
13464986-C-T 11309310-C-T *
13637178-T-C 11481502-T-C *
15677505-CA-C,CAA 13565625-CA-C,CAA 16×A*
13483150-G-A 11327474-G-A *
13489347-C-G 11333671-C-G *
13469970-G-C 11314294-G-C *
10884974-TTCCACTTCACTGCAC-T *
13541725-G-A 11386049-G-A FGC55052 *
13637182-G-T 11481506-G-T *
13293852-C-T 11138176-C-T *
13470527-G-C 11314851-G-C *
13342223-G-C 11186547-G-C *
13374406-C-T 11218730-C-T *
13467296-T-A 11311620-T-A *
13405218-G-A 11249542-G-A *
13405203-A-G 11249527-A-G *
13405196-C-A 11249520-C-A *
13405194-G-T 11249518-G-T *
13385226-C-T 11229550-C-T *
9975285-C-T 10137676-C-T Y*
13491845-T-G 11336169-T-G *
9975275-G-A 10137666-G-A Y*
13481445-G-C 11325769-G-C *
17109091-AACAC-A,AAC 14997211-AACAC-A,AAC 25×AC*
3755401-A-T 3887360-A-T FTB50023 14×T*
13482737-T-A 11327061-T-A *
13482735-T-C 11327059-T-C *
5643449-TAA-T 5775408-TAA-T 12×A*
13474343-C-G 11318667-C-G *
13491848-A-C 11336172-A-C *
13476539-A-T 11320863-A-T *
13539837-A-C 11384161-A-C *
10908302-G-A *
9936201-T-A 10098592-T-A Y*
13693628-G-A 11537952-G-A BY211054 *
13590554-C-T 11434878-C-T *
13563786-G-T 11408110-G-T *
13543634-A-C 11387958-A-C *
13541676-A-T 11386000-A-T *
13539707-T-C 11384031-T-C *
13498780-A-G 11343104-A-G *
13539690-G-C 11384014-G-C *
13539680-G-A 11384004-G-A *
13539196-G-T 11383520-G-T *
13529358-A-G 11373682-A-G *
13514540-G-C 11358864-G-C *
13498814-T-C 11343138-T-C *
13498786-C-G 11343110-C-G *
13489579-T-C 11333903-T-C *
7275188-TAA-T,TA 7407147-TAA-T,TA 20×A*
13483360-A-T 11327684-A-T *
28797893-C-CAAT 26651746-C-CAAT *
58883892-C-G 56706979-G-C *
13462016-C-G 11306340-C-G *
13465409-C-T 11309733-C-T *
56839431-G-A *
14670834-A-AT 12558900-A-AT 10×T*
13472034-C-T 11316358-C-T *
13722871-T-A 11567195-T-A *
13598951-A-AATG 11443275-A-AATG *
56876148-A-G *
58979501-TCCACTCCAC-T 56833354-TCCACTCCAC-T *
7282157-TTC-T 7414116-TTC-T **
19644357-C-A 17532477-C-A P5_Prx **
19764719-C-A 17652839-C-A P5_Prx **
13485365-G-C 11329689-G-C **
19868813-T-G 17756933-T-G P5_Prx **
22458168-A-T 20296282-A-T DYZ19 **
22458159-A-C 20296273-A-C DYZ19 **
26053247-T-A 23907100-T-A P1_Y1 **
9063124-A-G 9225515-A-G **
3208835-A-G 3340794-A-G **
5905890-CAAAA-C 6037849-CAAAA-C 27×A***
10962561-A-T ***
13478348-A-C,T 11322672-A-C,T ***
56868350-C-G ***
13919208-CAA-C,CAAA 11798502-CAA-C,CAAA 17×A***
22164376-CA-C,CAA 20002490-CA-C,CAA 22×A***
17278306-GAAAGAA-G,GAGAA 15166426-GAAAGAA-G,GAGAA ***
13287714-CGG-C 11132038-CGG-C 9×G***
13467551-T-A 11311875-T-A ***
16447158-AACACAC-A 14335278-AACACAC-A 22×AC***
19437205-G-A 17325325-G-A ***
13463365-G-C 11307689-G-C ***
14227-C-G ***
13463370-C-G 11307694-C-G ***
56828923-TCATTCCATTCCATTCCATTCCATTCCATGTCATTCCATTC-T,TCATTCCATTC 5×CATTC***
13479100-G-T 11323424-G-T ***
3332273-T-C 3464232-T-C ***
13585053-CAAAA-C 11429377-CAAAA-C 19×A***
22510299-C-G 20348413-C-G DYZ19 ***
6767604-TAA-T,TA 6899563-TAA-T,TA 13×A***
10962559-C-T ***
10767663-T-C ***
26499950-GT-G 24353803-GT-G P1_Y1 ***
21328805-CAA-C,CA 19166919-CAA-C,CA 30×A***

In the table above, the meaning of the confidence field depends on whether the data comes from an FTDNA kit or an FGC kit. For FTDNA kits, + implies a "PASS" result with just one possible variant, * indicates a "PASS" but with multiple variants, ** indicates "REJECTED" with just a single variant, and *** indicates "REJECTED" with multiple possible variants. 'A*' are heterozygous variants not called by FTDNA, but still pulled from the VCF file. For FGC kits, + indicates over 99% likely genuine (95% for INDELs); * over 95% likely genuine (90% for INDELs); ** about 40% likely genuine; *** about 10% likely genuine. Manual entries read directly from a BAM file will be either + indicating positive, or * indicating that the data show a mixture of possible variants.

For the FTDNA kits, the BED data is encoded in the background color of the cells. Those cells with a white background have coverage, those with a grey background indicate no coverage in the BED file, and those with a pink background indicate the mutation is on the edge of a coverage region. These pink regions often indicate that the individual may be positive for a SNP even if there is no corresponding entry in the vcf file.

The combBED column indicates whether or not the mutation is a SNP and falls in the combBED region defined in Defining a New Rate Constant for Y-Chromosome SNPs based on Full Sequencing Data by Dmitry Adamov, Vladimir Guryanov, Sergey Karzhavin, Vladimir Tagankin, Vadim Urasin.

The McDonald BED column indicates whether or not the mutation is a SNP and falls in the BED region used by Dr. Iain McDonald in the age analysis he does for R-U106 men.

Age Analysis Information (work in progress)

AllMcDonaldYFull
Kit: 9424481515165895164748324985
Kit: 9424481591256394855008285671
Used in age calculations1591256395164748324985
Counts of SNPs11048
Variant counts last updated 2022-11-28 04:07:32.



Big Tree Main Page