Tree Position

R-P312/S116 > Z290 > L21/S145 > DF13 > DF21/S192 > FGC3213 > ZZ1 > S3058 > S424 > S426 > S190 > FGC3215 > Z36747 > Y16487 > Y16486 > BY4583 > BY6580

Unique Mutations

The mutations unique to this man are summarized in the table below. Those with a '+' or '*' confidence level are considered by FamilyTreeDNA or FullGenomesCorp to be high quality SNPs/INDELs. For completeness, all other mutations of lesser confidence are included as well. These additional mutations may be useful for distinguishing between very closely related men.

Occasionally, some of the mutations listed here will be thought to be shared with other men in which case they might appear in upstream blocks on the tree. When this happens, the 'Blocks' field will indicate what block they appear in. Such a situation might arise with BigY men if the BED data suggests another man may be positive for a SNP, even though it doesn't appear in his VCF data. It might also happen if Chromo2 testing or Sanger sequencing of other men not on the tree show the SNP to be shared.

POS-REF-ALT (hg19) POS-REF-ALT (hg38) Blocks Names Region McDonald BED combBED STRFB38
791941-A
BigY3
791941
BigY2
791941
20111200-G-T 17999320-G-T P5_Dst A*
20866361-T-C 18704475-T-C P4_Dst A*
20423529-G-T 18261643-G-T P5_Dst A*
20501525-G-T 18339639-G-T P5_Dst A*
20640891-G-T 18479005-G-T P4_Prx A*
20655784-G-T 18493898-G-T P4_Prx A*
20703685-C-A 18541799-C-A P4_Prx A*
20727545-G-T 18565659-G-T P4_Prx A*
20851393-T-C 18689507-T-C P4_Dst A*
20946380-T-C 18784494-T-C P4_Dst A*
20330203-G-T 18168317-G-T P5_Dst A*
20952688-G-T 18790802-G-T P4_Dst A*
10847072-C-G A*
19685856-A-AT 17573976-A-AT P5_Prx 9×TA*
20970160-T-C 18808274-T-C P4_Dst A*
21005899-G-T 18844013-G-T P4_Dst YA*
21008524-G-T 18846638-G-T P4_Dst YA*
18275029-G-T 16163149-G-T P6_Prx A*
20359634-G-T 18197748-G-T P5_Dst A*
20330156-G-A 18168270-G-A P5_Dst A*
26150638-G-A 24004491-G-A P1_Y1 *A*A*
19817277-C-A 17705397-C-A P5_Prx A*
16101226-G-T 13989346-G-T P8_Prx A*
16156506-G-T 14044626-G-T P8_Dst A*
20216469-G-GTA 18054583-G-GTA P5_Dst A*
19676996-C-A 17565116-C-A P5_Prx A*
18450367-G-T 16338487-G-T P6_Dst A*
19846600-G-T 17734720-G-T P5_Prx A*
19887751-G-T 17775871-G-T P5_Prx A*
19991288-T-C 17879408-T-C P5_Prx A*
20083160-A-G 17971280-A-G P5_Dst A*
20536393-G-T 18374507-G-T P5_Dst A*
8505378-T-G 8637337-T-G BY73490 YY+++
22488169-GG-AA,GT 20326283-GG-AA,GT DYZ19 *
22316159-C-A 20154273-C-A DYZ19 *
22345687-CC-CA,GT 20183801-CC-CA,GT DYZ19 *
13452507-GAGTC-CACTTCACT 11296831-GAGTC-CACTTCACT *
22366175-TG-GA,GG 20204289-TG-GA,GG DYZ19 *
7144247-C-CT 7276206-C-CT 9×T*
22447438-TTTCA-GTTCA,GTTCT 20285552-TTTCA-GTTCA,GTTCT DYZ19 *
14530849-T-A,AA 12419050-T-A,AA *
9535155-AT-A,ATT 9697546-AT-A,ATT IR3_Prx 17×T*
20816924-CAAA-C,CAAAA 18655038-CAAA-C,CAAAA P4_Gap 22×A*
56847119-CA-AG,CG *
13485725-GGT-TGC 11330049-GGT-TGC *
13449753-CAACCCCATTCTATTCCATTCT-AAACCCCATTCCATTGCATTCC,ATGAAACCCCATTCCATTGC 11294077-CAACCCCATTCTATTCCATTCT-AAACCCCATTCCATTGCATTCC,ATGAAACCCCATTCCATTGC *
13471776-CCGGG-TCAGC 11316100-CCGGG-TCAGC *
10750778-T-C,TCATTC *
16904731-A-AGT,T 14792851-A-AGT,T 20×GT*
22316204-T-C 20154318-T-C DYZ19 *
18369802-CAA-C,CAAA 16257922-CAA-C,CAAA P6_Prx 25×A*
10660022-T-A **
22068525-C-A 19906639-C-A **
22360227-T-C 20198341-T-C DYZ19 **
10880956-T-C **
10802245-C-T **
9019122-C-A 9181513-C-A **
22069639-C-A 19907753-C-A **
10801951-C-A **
10801251-C-A **
25468526-CTTTT-C 23322379-CTTTT-C P2_r2 21×T**
22062089-T-C 19900203-T-C **
10785282-C-CCAATA **
21455860-C-A 19293974-C-A **
10779028-C-G **
21393982-T-C 19232096-T-C **
10765016-T-C FT172150 **
10925491-C-A **
13809903-T-C 11689197-T-C **
10933707-C-A **
20425940-G-T 18264054-G-T P5_Dst **
13911668-C-A 11790962-C-A **
13912451-C-A 11791745-C-A **
16707529-G-T 14595649-G-T **
21778739-C-CA **
22788581-C-A 20626695-C-A **
17776161-G-T 15664281-G-T **
18895661-G-T 16783781-G-T **
19297782-C-A 17185902-C-A **
22503500-G-A 20341614-G-A DYZ19 **
11664255-G-T **
10933728-A-T **
24779074-CAAAA-C 22632927-CAAAA-C P3_b2 22×A**
11033627-C-A **
11005019-C-A **
10976713-C-T **
10965128-G-T **
10959667-T-G **
10959190-GCATTC-G **
10938526-C-A **
13882030-G-T 11761324-G-T **
10933732-A-G **
17609677-C-A 15497797-C-A **
7503851-AACAC-A 7635810-AACAC-A IR1_L 20×AC**
22991587-C-A 20829701-C-A **
18085409-A-C 15973529-A-C **
13257283-ATATATA-T 11101607-ATATATA-T **
20493295-C-A 18331409-C-A P5_Dst **
20493276-C-A 18331390-C-A P5_Dst **
13530099-A-T 11374423-A-T **
13698852-GG-TT 11543176-GG-TT **
13726298-C-A 11570622-C-A **
20411094-G-T 18249208-G-T P5_Dst **
14977295-TCT-C 12865370-TCT-C **
20365888-A-T 18204002-A-T P5_Dst **
20269900-G-A 18108014-G-A P5_Dst **
13476550-CGGT-TGGC 11320874-CGGT-TGGC **
22722332-AGGCTGCT-CGGCGGC 20560446-AGGCTGCT-CGGCGGC **
24101909-C-A 21955762-C-A P3_b1 **
22504717-G-C 20342831-G-C DYZ19 **
21743207-CA-C **
18618897-A-G 16507017-A-G **
18511195-CAAAAAA-C 16399315-CAAAAAA-C P6_Dst 30×A**
9620998-G-T 9783389-G-T IR3_Prx **
18456069-A-ATT 16344189-A-ATT P6_Dst 15×T**
9678760-A-G 9841151-A-G IR3_Prx **
18015738-A-C 15903858-A-C P7_Dst **
20567463-G-A 18405577-G-A P5_Dst **
20609914-CA-TG 18448028-CA-TG P5_Dst **
23277776-T-C 21115890-T-C **
20941173-A-AT 18779287-A-AT P4_Dst **
23598016-C-A 21436130-C-A **
23860436-C-A 21698550-C-A **
24405206-C-A 22259059-C-A **
56763557-G-C **
24446852-A-AATAT 22300705-A-AATAT 15×AT**
8810765-C-A 8942724-C-A **
28421647-CA-C 26275500-CA-C P1_gr2 15×A**
16148530-C-T 14036650-C-T P8_Dst **
27491653-CT-C 25345506-CT-C P1_Y2 25×T**
20979104-G-T 18817218-G-T P4_Dst **
19425816-T-C 17313936-T-C ****
13545640-ATT-A 11389964-ATT-A **
25565654-GTT-G 23419507-GTT-G P1_gr1 20×T**
2856977-C-T 2988936-C-T *****
6265062-C-A 6397021-C-A IR3_Dst **
13923489-C-A 11802783-C-A ****
12374632-C-G ****
6326213-GAC-G 6458172-GAC-G IR3_Dst 8×AC**
17165315-T-C 15053435-T-C *****
18138218-A-G 16026338-A-G *****
18138234-A-G 16026354-A-G *****
8851071-C-A 8983030-C-A **
16709207-G-C 14597327-G-C **
26514931-TCACA-T 24368784-TCACA-T P1_Y1 9×CA**
8008047-G-T 8140006-G-T **
27662356-T-C 25516209-T-C P1_Y2 **
13698834-A-G 11543158-A-G **
14656154-CAAAAA-C 12544219-CAAAAA-C 24×A****
27928702-A-G 25782555-A-G P1_Y2 **
27948656-A-G 25802509-A-G P1_Y2 **
27550462-CT-C 25404315-CT-C P1_Y2 13×T**
11669504-C-A **
28763658-C-A 26617511-C-A **
17315581-C-A 15203701-C-A **
28153738-C-G 26007591-C-G P1_b4 **
22504773-C-G 20342887-C-G DYZ19 **
24264734-C-CAA 22118587-C-CAA P3_b1 **
27533857-C-T 25387710-C-T P1_Y2 **
13698886-T-C 11543210-T-C **
27311720-G-C 25165573-G-C P1_g3 **
27960506-G-T 25814359-G-T P1_Y2 **
15743755-C-A 13631875-C-A **
10980212-C-A **
10773385-C-A **
13699802-G-T 11544126-G-T **
27406421-A-G 25260274-A-G P1_g3 **
15957481-C-A 13845601-C-A **
17375303-G-T 15263423-G-T **
9398077-C-A 9560468-C-A **
28003873-T-A 25857726-T-A P1_Y2 **
27448303-G-A 25302156-G-A P1_Y2 **
28000857-G-A 25854710-G-A P1_Y2 **
16702106-G-T 14590226-G-T **
14071348-ACCCGACTT-TCCTGAC 11950642-ACCCGACTT-TCCTGAC **
10661771-C-A **
3684996-G-T 3816955-G-T **
16535053-CT-C 14423173-CT-C 35×T**
10892573-C-CGGAAG **
10892587-C-G **
20989908-CT-C 18828022-CT-C P4_Dst 11×T**
27852981-A-G 25706834-A-G P1_Y2 **
9657404-C-CA 9819795-C-CA IR3_Prx 12×A**
7256397-C-A 7388356-C-A **
7123332-G-T 7255291-G-T **
6756988-G-A 6888947-G-A **
6354388-C-A 6486347-C-A **
4663665-C-A 4795624-C-A **
4272460-G-A 4404419-G-A **
6326107-G-T 6458066-G-T IR3_Dst **
3287758-G-T 3419717-G-T **
10630580-G-T **
27775783-CA-C 25629636-CA-C P1_Y2 9×A**
10847236-G-T **
2810452-A-AT 2942411-A-AT 9×T**
27155028-ATGTGTGCG-A 25008881-ATGTGTGCG-A P1_g3 **
14483537-G-T 12362806-G-T **
20784369-GT-G 18622483-GT-G P4_Prx 13×T***
20512578-A-T 18350692-A-T P5_Dst ***
27968846-C-T 25822699-C-T P1_Y2 ***
27952289-A-G 25806142-A-G P1_Y2 ***
20928526-T-C 18766640-T-C P4_Dst ***
27899010-G-T 25752863-G-T P1_Y2 ***
20990401-T-A 18828515-T-A P4_Dst ***
20911819-A-G 18749933-A-G P4_Dst ***
20506631-T-C 18344745-T-C P5_Dst ***
27811797-C-T 25665650-C-T P1_Y2 ***
20510961-ATT-A,AT 18349075-ATT-A,AT P5_Dst 32×T***
27903011-A-G 25756864-A-G P1_Y2 ***
27893035-A-T 25746888-A-T P1_Y2 ***
27874039-C-T 25727892-C-T P1_Y2 ***
20933260-A-T 18771374-A-T P4_Dst ***
20693615-CTT-C,CT 18531729-CTT-C,CT P4_Prx 12×T***
20891251-A-T 18729365-A-T P4_Dst ***
20529089-ATT-A 18367203-ATT-A P5_Dst ***
20882630-C-T 18720744-C-T P4_Dst ***
20586936-T-C 18425050-T-C P5_Dst ***
20609799-T-C 18447913-T-C P5_Dst ***
20939312-C-T 18777426-C-T P4_Dst ***
27956998-A-G 25810851-A-G P1_Y2 ***
20934261-T-C 18772375-T-C P4_Dst ***
20503508-C-A 18341622-C-A P5_Dst ***
20874907-A-G 18713021-A-G P4_Dst ***
27895007-A-G 25748860-A-G P1_Y2 ***
27879493-A-G 25733346-A-G P1_Y2 ***
27962217-C-G 25816070-C-G P1_Y2 ***
25486710-G-A 23340563-G-A P2_r2 ***
27989198-C-A 25843051-C-A P1_Y2 ***
18516931-A-G 16405051-A-G P6_Dst ***
28255159-A-G 26109012-A-G P1_b4 ***
20140910-T-A 18029030-T-A P5_Dst ***
28347434-C-T 26201287-C-T P1_gr2 ***
20114736-G-T 18002856-G-T P5_Dst ***
20109010-A-G 17997130-A-G P5_Dst ***
28362542-A-G 26216395-A-G P1_gr2 ***
20088441-T-A 17976561-T-A P5_Dst ***
19744991-ATTTT-A,ATTT 17633111-ATTTT-A,ATTT P5_Prx 23×T***
28366066-T-C 26219919-T-C P1_gr2 ***
18514557-G-T 16402677-G-T P6_Dst ***
20199881-CAAA-C,CA 18037995-CAAA-C,CA P5_Dst 28×A***
28381422-A-G 26235275-A-G P1_gr2 ***
28392976-A-G 26246829-A-G P1_gr2 ***
18497271-G-A 16385391-G-A P6_Dst ***
18493598-A-G 16381718-A-G P6_Dst ***
18489668-G-A 16377788-G-A P6_Dst ***
18487132-G-A 16375252-G-A P6_Dst ***
28405384-CA-C 26259237-CA-C P1_gr2 10×A***
28409696-C-CA 26263549-C-CA P1_gr2 12×A***
18335545-A-G 16223665-A-G P6_Prx ***
28427859-T-C 26281712-T-C P1_gr2 ***
28228349-A-G 26082202-A-G P1_b4 ***
20217960-TA-T,TAAA 18056074-TA-T,TAAA P5_Dst 13×A***
27993564-A-G 25847417-A-G P1_Y2 ***
28088200-G-A 25942053-G-A P1_Y2 ***
27999052-A-G 25852905-A-G P1_Y2 ***
20478290-C-T 18316404-C-T P5_Dst ***
28023950-A-G 25877803-A-G P1_Y2 ***
28044774-C-T 25898627-C-T P1_Y2 ***
20450147-A-G 18288261-A-G P5_Dst ***
20992501-G-T 18830615-G-T P4_Dst ***
20435243-A-G 18273357-A-G P5_Dst ***
28060000-C-T 25913853-C-T P1_Y2 ***
20427588-A-G 18265702-A-G P5_Dst ***
28070598-T-C 25924451-T-C P1_Y2 ***
20383455-T-C 18221569-T-C P5_Dst ***
20233863-C-T 18071977-C-T P5_Dst ***
20378511-A-G 18216625-A-G P5_Dst ***
28147342-TA-T 26001195-TA-T P1_b4 10×A***
20344856-G-T 18182970-G-T P5_Dst ***
20283954-C-T 18122068-C-T P5_Dst ***
20270537-T-C 18108651-T-C P5_Dst ***
28176487-A-G 26030340-A-G P1_b4 ***
28204087-GTT-G 26057940-GTT-G P1_b4 15×T***
20264852-C-T 18102966-C-T P5_Dst ***
20252796-C-AA 18090910-C-AA P5_Dst 24×A***
20238850-C-T 18076964-C-T P5_Dst ***
20447254-C-T 18285368-C-T P5_Dst ***
27730276-A-T 25584129-A-T P1_Y2 ***
21009523-A-G 18847637-A-G P4_Dst ***
27253421-GA-G 25107274-GA-G P1_g3 ***
24587568-T-G 22441421-T-G P3_t2 ***
24583704-T-C 22437557-T-C P3_t2 ***
16154943-A-C 14043063-A-C P8_Dst ***
24545617-T-C 22399470-T-C P3_t2 ***
24544036-AT-A 22397889-AT-A P3_t2 ***
24529740-T-C 22383593-T-C P3_t2 ***
24023091-GC-G 21876944-GC-G ***
27241796-A-G 25095649-A-G P1_g3 ***
27301933-T-C 25155786-T-C P1_g3 ***
24625220-A-G 22479073-A-G P3_t2 ***
21771317-C-A ***
21765882-G-A ***
22511597-CTCAG-TTCAG,TTCAT 20349711-CTCAG-TTCAG,TTCAT DYZ19 ***
22508821-TAGT-AAGG 20346935-TAGT-AAGG DYZ19 ***
27304511-C-T 25158364-C-T P1_g3 ***
22503457-C-T 20341571-C-T DYZ19 ***
27345166-G-A 25199019-G-A P1_g3 ***
22485091-ATTG-TTTA,TTTG 20323205-ATTG-TTTA,TTTG DYZ19 ***
27366292-T-C 25220145-T-C P1_g3 ***
24618312-A-G 22472165-A-G P3_t2 ***
24626409-AT-A 22480262-AT-A P3_t2 ***
22481328-TTTAGG-GATATG,GTTATT 20319442-TTTAGG-GATATG,GTTATT DYZ19 ***
25440014-C-CTTT 23293867-C-CTTT P2_r2 19×T***
25484119-T-C 23337972-T-C P2_r2 ***
25500230-C-T 23354083-C-T P2_r2 ***
25500610-T-A 23354463-T-A P2_r2 ***
25574802-CTT-C 23428655-CTT-C P1_gr1 17×T***
25631849-C-T 23485702-C-T P1_b3 ***
25990634-GT-G,T 23844487-GT-G,T P1_Y1 23×T***
25453486-G-A 23307339-G-A P2_r2 ***
26276778-A-G 24130631-A-G P1_Y1 ***
26283209-CAAA-C 24137062-CAAA-C P1_Y1 21×A***
26424314-CAA-C 24278167-CAA-C P1_Y1 23×A***
24633474-A-G 22487327-A-G P3_t2 ***
26514623-T-C 24368476-T-C P1_Y1 ***
27149937-A-G 25003790-A-G P1_g3 ***
25433908-G-T 23287761-G-T P2_r2 ***
27178005-G-T 25031858-G-T P1_g3 ***
27199852-C-T 25053705-C-T P1_g3 ***
24760263-C-T 22614116-C-T P3_b2 ***
27219700-T-G 25073553-T-G P1_g3 ***
24756064-T-C 22609917-T-C P3_b2 ***
24668467-A-G 22522320-A-G P3_b2 ***
27368512-C-G 25222365-C-G P1_g3 ***
22477086-A-C 20315200-A-C DYZ19 ***
21979689-C-G 19817803-C-G ***
27764292-T-C 25618145-T-C P1_Y2 ***
27587815-T-C 25441668-T-C P1_Y2 ***
27627146-T-C 25480999-T-C P1_Y2 ***
27632362-T-A 25486215-T-A P1_Y2 ***
27644243-C-A 25498096-C-A P1_Y2 10×A***
27660930-A-G 25514783-A-G P1_Y2 ***
27660955-T-C 25514808-T-C P1_Y2 ***
27672058-C-T 25525911-C-T P1_Y2 ***
27714328-CTTT-C,CTT 25568181-CTTT-C,CTT P1_Y2 15×T***
25491340-G-T 23345193-G-T P2_r2 ***
27774248-T-A 25628101-T-A P1_Y2 ***
27554537-T-C 25408390-T-C P1_Y2 ***
27787658-C-T 25641511-C-T P1_Y2 ***
27792462-A-G 25646315-A-G P1_Y2 ***
27799681-T-C 25653534-T-C P1_Y2 ***
27807198-C-A 25661051-C-A P1_Y2 ***
27808951-G-T 25662804-G-T P1_Y2 ***
21979737-G-T 19817851-G-T ***
21979731-C-T 19817845-C-T ***
21979721-G-C 19817835-G-C ***
21979715-A-G 19817829-A-G ***
27554554-T-G 25408407-T-G P1_Y2 ***
27540486-G-A 25394339-G-A P1_Y2 ***
22475844-T-G 20313958-T-G DYZ19 ***
22366581-GT-AC 20204695-GT-AC DYZ19 ***
27394474-C-CT 25248327-C-CT P1_g3 ***
22472954-T-G 20311068-T-G DYZ19 ***
22453648-T-A 20291762-T-A DYZ19 ***
27413408-C-A 25267261-C-A P1_g3 ***
22448577-C-T 20286691-C-T DYZ19 ***
22420158-CACT-GACC 20258272-CACT-GACC DYZ19 ***
22366846-GGTGA-TGTGG 20204960-GGTGA-TGTGG DYZ19 ***
27458726-T-A 25312579-T-A P1_Y2 ***
27467574-C-A 25321427-C-A P1_Y2 ***
27477023-T-C 25330876-T-C P1_Y2 ***
22216901-T-A 20055015-T-A DYZ19 ***
22366554-CATG-GATT 20204668-CATG-GATT DYZ19 ***
27498061-A-G 25351914-A-G P1_Y2 ***
22361657-CGTT-AGTG 20199771-CGTT-AGTG DYZ19 ***
27529203-A-G 25383056-A-G P1_Y2 ***
22341439-T-C 20179553-T-C DYZ19 ***
27531110-T-C 25384963-T-C P1_Y2 ***
22300642-T-G 20138756-T-G DYZ19 ***
22239005-G-T 20077119-G-T DYZ19 ***
22235568-CTTTT-TCTTT,TTTTC 20073682-CTTTT-TCTTT,TTTTC DYZ19 ***
24578737-T-C 22432590-T-C P3_t2 ***
16888302-T-TAAA 14776422-T-TAAA ******
13545355-AG-AGAAGA,TGAAGA 11389679-AG-AGAAGA,TGAAGA ***
4521612-TAA-T,TA 4653571-TAA-T,TA 17×A***
14607811-G-T 12496013-G-T ***
18184844-C-A 16072964-C-A ***
21457495-G-T 19295609-G-T ***
28722436-T-TAA 26576289-T-TAA 13×A******
13480368-T-A 11324692-T-A ***
8498338-CAA-C,CA 8630297-CAA-C,CA 16×A***
8052682-C-A 8184641-C-A ***
27540976-C-CA 25394829-C-CA P1_Y2 12×A***
17885879-G-T 15773999-G-T ***
17818322-A-AT 15706442-A-AT 10×T***
15272028-CTATA-C 13160117-CTATA-C 11×TA***
17004618-CAA-C,CAAA 14892738-CAA-C,CAAA 14×A***
7567871-G-A 7699830-G-A ***
10839461-C-A ***
10992987-T-A ***
10785260-T-C ***
10979873-T-C ***
10979846-C-A ***
10979830-C-T ***
10979820-C-G ***
10686725-C-A ***
21766180-C-A ***
20497928-CCT-C 18336042-CCT-C P5_Dst ***
3640555-C-T 3772514-C-T ***
8760517-CTTTTTT-C,CTTT 8892476-CTTTTTT-C,CTTT 20×T***
8536167-G-A 8668126-G-A ***
14080435-C-A 11959729-C-A ***
13799108-GTGGAA-G 11678402-GTGGAA-G ***
13472195-C-A,T 11316519-C-A,T ***
13254687-C-A 11099011-C-A ***
10828713-C-T ***
10785268-C-CAATCGGTTTA ***
10661783-C-A ***
9006761-C-A 9169152-C-A ***
8689577-C-A 8821536-C-A ***
8647809-T-C 8779768-T-C Y64261 ***
7999977-C-A 8131936-C-A ***
19268165-C-A 17156285-C-A ***
7975826-C-A 8107785-C-A ***
7867879-GGAAAGAAAGAAA-G,GGAAAGAAAGAAAGAAAGAAAGAAA 7999838-GGAAAGAAAGAAA-G,GGAAAGAAAGAAAGAAAGAAAGAAA 16×GAAA***
7762173-G-A 7894132-G-A ***
7652912-C-A 7784871-C-A ***
7349542-C-A 7481501-C-A ***
7082560-C-A 7214519-C-A ***
4425790-C-A 4557749-C-A ***
2752725-CAAAAA-C,CAAA 2884684-CAAAAA-C,CAAA 18×A***
22010462-CAA-C,CA 19848576-CAA-C,CA 16×A***
10994159-C-G ***
4505414-ATTTT-A 4637373-ATTTT-A 22×T***
10785248-C-T ***
15742087-G-T 13630207-G-T ***
14393822-C-A 12273118-C-A ***
7579118-T-C 7711077-T-C ***
22363229-T-C 20201343-T-C DYZ19 ***
7103038-T-TAC 7234997-T-TAC 17×AC***
18499927-GA-G 16388047-GA-G P6_Dst 13×A***
27198886-C-CA 25052739-C-CA P1_g3 11×A***
22250184-T-A 20088298-T-A A3962 DYZ19 ***
9202929-T-G 9365320-T-G ***
22364704-A-G 20202818-A-G DYZ19 ***
17686249-T-TA 15574369-T-TA 9×A***
19966013-T-TA 17854133-T-TA P5_Prx 14×A***
27173659-GA-G 25027512-GA-G P1_g3 13×A***
7579109-T-C 7711068-T-C ***
13869182-ATG-CTC 11748476-ATG-CTC ***
22442215-T-C 20280329-T-C S27566 DYZ19 ***
18480043-GA-G 16368163-GA-G P6_Dst 17×A***
25831940-C-CT 23685793-C-CT P1_b3 16×T***
22225925-A-C 20064039-A-C ZS4165 DYZ19 ***
27792527-AT-A 25646380-AT-A P1_Y2 10×T***
22459160-C-G 20297274-C-G BY220260 DYZ19 ***
25500566-AT-A 23354419-AT-A P2_r2 10×T***
9559580-CT-C 9721971-CT-C IR3_Prx 11×T***
22484968-TG-T 20323082-TG-T DYZ19 ***
13748491-T-A 11592815-T-A ***
13459175-G-T 11303499-G-T ***
24598279-GA-G 22452132-GA-G P3_t2 9×A***
26900264-T-TA 24754117-T-TA P1_r3 22×A***
19007619-CATAT-C,CAT 16895739-CATAT-C,CAT 10×AT***
16059028-CTTT-C 13947148-CTTT-C 19×T***
18966043-C-A 16854163-C-A ***
18687704-CA-C,CAA 16575824-CA-C,CAA 14×A***
10992979-C-T ***
15242398-C-CT 13130484-C-CT 10×T******
10992976-T-C ***
11017489-C-A ***
22721757-GT-G 20559871-GT-G 10×T***
9618339-G-T 9780730-G-T IR3_Prx ***
11643324-G-T ***
21558722-CAAA-C 19396836-CAAA-C 16×A******
22360412-T-A 20198526-T-A DYZ19 ***
22502936-C-A 20341050-C-A DYZ19 ***
7783280-C-A 7915239-C-A V1432 FGC25563 ***
22363138-T-A 20201252-T-A DYZ19 ***
22360988-A-T 20199102-A-T DYZ19 ***
22453047-G-A 20291161-G-A DYZ19 ***
22452982-A-T 20291096-A-T DYZ19 ***
8300622-G-GA 8432581-G-GA 10×A***
22362401-G-T 20200515-G-T DYZ19 ***
22358215-A-T 20196329-A-T DYZ19 ***
22361261-GTT-CTA 20199375-GTT-CTA DYZ19 ***
9236251-T-G 9398642-T-G ***
5776564-GA-G 5908523-GA-G 11×A******
14296220-C-A 12175514-C-A ***
14393860-C-A 12273156-C-A ***
9687302-C-T 9849693-C-T IR3_Prx ***
13270742-AAAA-GAAG 11115066-AAAA-GAAG ***
16882821-A-G 14770941-A-G ***
16786235-TC-C,TTA 14674355-TC-C,TTA ***
15799136-CTTCC-C,T 13687256-CTTCC-C,T ***
14691111-C-G 12579177-C-G ***
12555882-CAA-C,CA 24×A***
13842693-G-C,GAATGG 11721987-G-C,GAATGG ***
13728961-GTCA-CTCA,CTCG 11573285-GTCA-CTCA,CTCG ***
13728941-TTGG-ATGG,ATGT 11573265-TTGG-ATGG,ATGT ***
13488952-TCCCAGGGCC-CCCCAGGCCT 11333276-TCCCAGGGCC-CCCCAGGCCT ***
13451897-T-CCATTCCATTC 11296221-T-CCATTCCATTC ***
10761013-GATTCCAC-CATTTCAA ***
18825629-CAA-C,CAAA 16713749-CAA-C,CAAA 20×A***
9975269-C-T 10137660-C-T ***
9030412-A-AGGAAA,AGGAAG 9192803-A-AGGAAA,AGGAAG ***
8100637-CAAAA-C,CAAA 8232596-CAAAA-C,CAAA 37×A***
4878246-CA-C,CAA 5010205-CA-C,CAA 18×A***
4834268-AC-AAA,C 4966227-AC-AAA,C ***
2729644-ATGTCT-ATGTC,TTTTA 2861603-ATGTCT-ATGTC,TTTTA ***
13466016-TGTT-AGTC 11310340-TGTT-AGTC ***
13716333-G-T 11560657-G-T ***
56756874-GAATGGAATG-CAATGGAATC ***
13474008-CGTAG-GGTGA 11318332-CGTAG-GGTGA ***
17270261-C-T 15158381-C-T ***
19505084-CTAA-TTAG 17393204-CTAA-TTAG ***
28563960-T-C 26417813-T-C ******
9181085-A-ACC 9343476-A-ACC ***
9679043-T-A 9841434-T-A IR3_Prx ***
9662153-A-G 9824544-A-G IR3_Prx ***
9656554-G-T 9818945-G-T IR3_Prx ***
9625902-T-C 9788293-T-C IR3_Prx ***
9592447-C-T 9754838-C-T IR3_Prx ***
9551020-T-C 9713411-T-C IR3_Prx ***
9550330-C-A 9712721-C-A IR3_Prx ***
9549013-G-A 9711404-G-A IR3_Prx ***
9542551-A-G 9704942-A-G IR3_Prx ***
9530155-T-C 9692546-T-C IR3_Prx ***
7579136-CA-TG 7711095-CA-TG ***
21261823-CTTTA-ATTT,CTTT 19099937-CTTTA-ATTT,CTTT ***
6566062-GT-G 6698021-GT-G 14×T***
6162372-T-G 6294331-T-G IR3_Dst ***
20442019-A-T 18280133-A-T P5_Dst ***
25964895-GTT-G 23818748-GTT-G P1_Y1 23×T***
28427876-T-C 26281729-T-C P1_gr2 ***
28596399-GTT-G,GTTT 26450252-GTT-G,GTTT 16×T***
23488834-TA-T,TTA 21326948-TA-T,TTA 30×A***
23452108-A-T 21290222-A-T ***
23311386-GC-G 21149500-GC-G ***
22737248-AAG-AAA,G 20575362-AAG-AAA,G ***
21464556-GAAAAGAAAAAAAGATAAAGACAAAAAAGAAAGAGAGAGAAAGAAAGGAAAGAAAGAATG-AGAAAAGAAAAAAAGATAAAGACAAAAAAGAAAGAGAGAGAAAGAAAGGAAAGAAAGAATG,GAAAAGAAAAAAAGATAAAGACAAAAAAGAAAGAGAGAGAAAGAAAGGAAAGAAATAATT 19302670-GAAAAGAAAAAAAGATAAAGACAAAAAAGAAAGAGAGAGAAAGAAAGGAAAGAAAGAATG-AGAAAAGAAAAAAAGATAAAGACAAAAAAGAAAGAGAGAGAAAGAAAGGAAAGAAAGAATG,GAAAAGAAAAAAAGATAAAGACAAAAAAGAAAGAGAGAGAAAGAAAGGAAAGAAATAATT ***
20308289-G-GA 18146403-G-GA P5_Dst 9×A***
21373462-T-A 19211576-T-A ******
14461004-G-T 12340277-G-T ***
18690273-C-A 16578393-C-A ***
23142590-C-A 20980704-C-A ***
22618570-C-A 20456684-C-A ***
22091526-C-A 19929640-C-A ***
21762359-A-G 19600473-A-G ***
21509722-C-A 19347836-C-A ***
21468745-ATTTTT-A 19306859-ATTTTT-A 25×T***
21220355-C-T 19058469-C-T ***
21138567-A-G 18976681-A-G FT129177 ***
19400973-C-A 17289093-C-A ***
19306682-C-A 17194802-C-A ***
18528039-G-T 16416159-G-T P6_Dst ***
23209584-C-A 21047698-C-A ***
18035665-CTTTTT-C 15923785-CTTTTT-C 30×T***
17851608-T-C 15739728-T-C ***
17208372-C-A 15096492-C-A ***
16905790-G-A 14793910-G-A ***
16593787-G-A 14481907-G-A ***
16482359-TTATATA-T 14370479-TTATATA-T 9×TA***
15979887-C-A 13868007-C-A ***
15823133-C-A 13711253-C-A ***
15412464-C-CAA 13300584-C-CAA 10×A***
15366018-C-T 13254138-C-T ***
15047969-C-A 12936060-C-A ***
23142789-CT-C 20980903-CT-C ***
23309349-C-T 21147463-C-T ***
16308980-T-C 14197100-T-C ***
19505087-A-G 17393207-A-G ***
12371950-CA-C,CAAAAA ***
3640559-C-T 3772518-C-T ***
22475843-T-G 20313957-T-G DYZ19 ***
13608647-CA-C,CAA 11452971-CA-C,CAA 27×A***
14097945-AT-A,ATT 11977239-AT-A,ATT 23×T***
20938054-G-T 18776168-G-T P4_Dst ***
16757043-AT-A,ATT 14645163-AT-A,ATT 27×T***
22242371-AC-GG 20080485-AC-GG DYZ19 ***
56857603-TAA-T,TAAAAA 11×A***
27502180-C-A 25356033-C-A P1_Y2 ***
19505084-C-T 17393204-C-T ***
24931831-A-G 22785684-A-G g1 ***
20386768-G-GAA 18224882-G-GAA P5_Dst 15×A***
20979546-T-C 18817660-T-C P4_Dst ***
4498179-ATTTT-A 4630138-ATTTT-A 23×T***
5248619-AT-A,ATT 5380578-AT-A,ATT 19×T***
9577293-C-CA 9739684-C-CA IR3_Prx 8×A***
13727992-AGTCA-CGTCG 11572316-AGTCA-CGTCG ***
8718956-C-A 8850915-C-A ***
26631899-A-AT 24485752-A-AT P1_g2 20×T***
18688500-CAAA-C 16576620-CAAA-C 20×A***
5878150-CTT-C 6010109-CTT-C 14×T***
19097426-G-T 16985546-G-T ******
28456269-T-C 26310122-T-C P1_gr2 ***

In the table above, the meaning of the confidence field depends on whether the data comes from an FTDNA kit or an FGC kit. For FTDNA kits, + implies a "PASS" result with just one possible variant, * indicates a "PASS" but with multiple variants, ** indicates "REJECTED" with just a single variant, and *** indicates "REJECTED" with multiple possible variants. 'A*' are heterozygous variants not called by FTDNA, but still pulled from the VCF file. For FGC kits, + indicates over 99% likely genuine (95% for INDELs); * over 95% likely genuine (90% for INDELs); ** about 40% likely genuine; *** about 10% likely genuine. Manual entries read directly from a BAM file will be either + indicating positive, or * indicating that the data show a mixture of possible variants.

For the FTDNA kits, the BED data is encoded in the background color of the cells. Those cells with a white background have coverage, those with a grey background indicate no coverage in the BED file, and those with a pink background indicate the mutation is on the edge of a coverage region. These pink regions often indicate that the individual may be positive for a SNP even if there is no corresponding entry in the vcf file.

The combBED column indicates whether or not the mutation is a SNP and falls in the combBED region defined in Defining a New Rate Constant for Y-Chromosome SNPs based on Full Sequencing Data by Dmitry Adamov, Vladimir Guryanov, Sergey Karzhavin, Vladimir Tagankin, Vadim Urasin.

The McDonald BED column indicates whether or not the mutation is a SNP and falls in the BED region used by Dr. Iain McDonald in the age analysis he does for R-U106 men.

Haplotype Progression

The data below reveals the progression of changes in the haplotype. The bottom row is the haplotype for this man and above him are the inferred ancestral haplotypes for various upstream blocks. These inferred haplotypes are very much a work in progress, and any suggested modifications are appreciated. I think we can use our vast collection of haplotype data to refine these haplotypes. Mutations made from each upstream block are shown in sequence. The cell color is determined by the block in which the mutation took place.

DYS393
DYS390
DYS19
DYS391
DYS385
DYS426
DYS388
DYS439
DYS389i
DYS392
DYS389ii
DYS458
DYS459
DYS455
DYS454
DYS447
DYS437
DYS448
DYS449
DYS464
DYS460
Y-GATA-H4
YCAII
DYS456
DYS607
DYS576
DYS570
CDY
DYS442
DYS438
DYS531
DYS578
DYF395S1
DYS590
DYS537
DYS641
DYS472
DYF406S1
DYS511
DYS425
DYS413
DYS557
DYS594
DYS436
DYS490
DYS534
DYS450
DYS444
DYS481
DYS520
DYS446
DYS617
DYS568
DYS487
DYS572
DYS640
DYS492
DYS565
DYS710
DYS485
DYS632
DYS495
DYS540
DYS714
DYS716
DYS717
DYS505
DYS556
DYS549
DYS589
DYS522
DYS494
DYS533
DYS636
DYS575
DYS638
DYS462
DYS452
DYS445
Y-GATA-A10
DYS463
DYS441
Y-GGAAT-1B07
DYS525
DYS712
DYS593
DYS650
DYS532
DYS715
DYS504
DYS513
DYS561
DYS552
DYS726
DYS635
DYS587
DYS643
DYS497
DYS510
DYS434
DYS461
DYS435
P312/S1161324141111-14121212131329179-1011112515192915-15-17-17111119-231615181736-38121211915-1681010810101223-231610121215812222013121113111112123315916122626191211131210912121011113012132413101020151913241712152412231810141791211
L21/S1451324141111-14121212131329179-1011112515192915-15-17-17111119-231615181736-38121211915-1681010810101223-231610121215812222013121113111112123515916122526191211131211912121011113012132413101020151913241712152412231810141791211
DF21/S1921324141111-14121212131329179-1011112515192915-15-17-17111119-231615181836-38121211915-1681010810101223-231610121215812222013121113111112123515916122526191211131211912121011113012132413101020151913241712152412231810141791211
S30581324141011-14121212131329179-1011112515192915-15-17-17111119-231615181836-38121211915-1681010810101223-231610121215812222013121113111112123515916122526191211121211912121011113012132413101020151913241712152412231810141791211
S4261324141011-14121212131329179-1011112515193015-15-17-17111019-231615181838-38121211915-1691010810101222-231610121215811222014121113111112123115915122526191311121211912121011113012132413101020151913231712152412231810141791211
S1901324141011-14121212131329179-1011112515193013-15-17-17111019-231615181838-38121211915-1691010810101222-231610121215811222014121113111112123115915122526201311121211912121011113012132413101020151913231712152412231810141791211
FGC32151324141011-14121212131329189-1011112515193013-15-17-17111019-231615181838-38121211915-1691010810101222-231610121215811222014121113111112123115915122526201311121211912121011113012132413101020151913231712152412231810141791211
Akin1324141011-14121312131329199-1011112615193013-15-17-18111019-231615181837-40121211915-1691010810101222-231610121215811222014121113111112123115915122526201311121211913121011113012132413101119151914221712152412231810141791211

Age Analysis Information (work in progress)

AllMcDonaldYFull
Kit: 791941906993274203467346184
Kit: 7919411483145192930088273019
Kit: 791941-A*16000000100000008300000
Used in age calculations1483145192930088273019
Counts of SNPs31
Variant counts last updated 2020-02-15 02:43:36.

* BED data not available. Using default values.


Big Tree Main Page