Tree Position

R-P312/S116 > Z290 > L21/S145 > S552 > DF13 > FGC5494 > FGC5561 > Z16503 > Z16504 > Z16502 > Z17653 > Y17660 > Y17662

Unique Mutations

The mutations unique to this man are summarized in the table below. Those with a '+' or '*' confidence level are considered by FamilyTreeDNA or FullGenomesCorp to be high quality SNPs/INDELs. For completeness, all other mutations of lesser confidence are included as well. These additional mutations may be useful for distinguishing between very closely related men.

Occasionally, some of the mutations listed here will be thought to be shared with other men in which case they might appear in upstream blocks on the tree. When this happens, the 'Blocks' field will indicate what block they appear in. Such a situation might arise with BigY men if the BED data suggests another man may be positive for a SNP, even though it doesn't appear in his VCF data. It might also happen if Chromo2 testing or Sanger sequencing of other men not on the tree show the SNP to be shared.

POS-REF-ALT (hg19) POS-REF-ALT (hg38) Blocks Names Region McDonald BED combBED STRKane-BY3
87095
BigY2
87095
13695004-G-T 11539328-G-T A*
19854767-G-T 17742887-G-T P5_Prx A*
10783520-C-A +**
56850975-G-A +
10748341-C-T +
10748338-A-T +
18971937-C-A 16860057-C-A YY+
10671898-A-G +**
56869292-C-A +**
19415614-C-A 17303734-C-A Y+**
28224-T-G +
13472213-C-CTCTT 11316537-C-CTCTT +
28285-CT-C +
17999759-G-T 15887879-G-T P7_Gap Y+
23004552-T-A 20842666-T-A Y+**
22220089-A-T 20058203-A-T DYZ19 +
22720833-A-G 20558947-A-G Y58188 YY++
22220101-G-C 20058215-G-C DYZ19 +
10651611-T-A +
10748327-CAT-C +
21714748-C-CAAAAA 19552862-C-CAAAAA 53×A+
17158-C-T +
10753616-A-C +
14208-T-A +
14231-A-C +
22240917-G-T 20079031-G-T DYZ19 +
10672818-T-C +
56706549-G-C +
22361245-G-T 20199359-G-T FGC80147 DYZ19 +
10873006-G-T +**
10753627-T-A +
10846915-T-C +
22261771-G-GT 20099885-G-GT DYZ19 +
22261766-CT-C 20099880-CT-C DYZ19 +
22261760-G-A 20099874-G-A DYZ19 +
22261672-GTTGTATCCAGAGTTTGTTCCTTCAGATGTGTCCAGAA-G 20099786-GTTGTATCCAGAGTTTGTTCCTTCAGATGTGTCCAGAA-G DYZ19 +
22259713-C-T 20097827-C-T DYZ19 +
22259703-A-G 20097817-A-G DYZ19 +
22259700-G-A 20097814-G-A DYZ19 +
22479803-G-A 20317917-G-A BY224307 DYZ19 ++
21690613-C-T 19528727-C-T Y57079 YY++
56706916-A-T +
13466378-T-A 11310702-T-A +
4907028-G-T 5038987-G-T +**
13504469-C-A 11348793-C-A +
11646236-C-A +**
10651685-CATTCCATTTT-C +
10651701-A-G +
10651728-TCCAGTCAATTCCAATCCACTCCATG-T +
10651765-CATTACTTTCCAGTTAATTCCACTCCATTCAACTCCACTCCACTCCACTATATTACATTATATCCCGTCCAATTCCACTCCACTTCACTCCTCTCCACATT-C +
9029799-G-T 9192190-G-T Y48123 Y+**
14670165-G-T 12558231-G-T Y+**
10953596-C-A +**
10929682-C-A +**
9968546-CA-C 10130937-CA-C +**
10851413-C-A +
10673541-C-A +**
10794743-C-A +**
10994634-CGTTCCGTTCCATTCCACTCCACTCA-C +
4838300-T-A 4970259-T-A +**
4282701-G-T 4414660-G-T +**
22502985-G-T 20341099-G-T DYZ19 +
19071780-C-A 16959900-C-A Y+**
21269733-T-C 19107847-T-C Y+**
13744507-A-C 11588831-A-C +
13744552-G-A 11588876-G-A +
10651720-CCTTTA-C +
10846885-T-C +
10846890-T-C +
4720740-T-C 4852699-T-C +
5678075-G-T 5810034-G-T +
14909171-G-T 12797238-G-T Y+**
6115257-CG-C 6247216-CG-C +
26544618-GATAT-G 24398471-GATAT-G P1_g2 14×AT+
11018225-C-T +
56837891-G-T +
28210-A-G +
58862684-G-T 56728187-C-A +
16301992-G-A 14190112-G-A Y51680 YY++
3875070-C-A 4007029-C-A +**
10672819-T-C +
10672829-C-A +
22502986-A-T 20341100-A-T DYZ19 +
10651713-A-T +
13744558-A-AT 11588882-A-AT +
22240918-G-T 20079032-G-T DYZ19 +
10753630-A-T +
10976148-C-CCATTG +
10846898-C-T +
22235565-AAACTTTTAAGTGCTGTAACACTCAC-A 20073679-AAACTTTTAAGTGCTGTAACACTCAC-A DYZ19 +
10964893-C-T +
10672828-T-C +
13293473-G-A 11137797-G-A +
14784700-TC-T 12672770-TC-T +
16252-T-A +
13744520-A-T 11588844-A-T +
13744506-C-A 11588830-C-A +
13744536-C-T 11588860-C-T +
26594-G-T +
26574-C-T +
58852260-C-G 56738611-G-C +
56850979-T-A +
56884423-T-TAATATATATATATATATATATATATATA +
26667-G-T +
26635-A-T +
10872313-C-A +**
13472208-CCA-C 11316532-CCA-C +
17169-G-C +
22366680-G-A 20204794-G-A DYZ19 +
13489538-G-T 11333862-G-T *
7724687-CA-C 7856646-CA-C *
7730430-T-TGATA,TGATA 7862389-T-TGATA,TGATA 11×GATA*
7991262-C-T 8123221-C-T YY*
8173610-C-A 8305569-C-A YY*
8179043-CTA-C 8311002-CTA-C *
8214326-CACTTGTAGG-C 8346285-CACTTGTAGG-C *
13465444-CAAG-C 11309768-CAAG-C *
8270762-C-T 8402721-C-T YY*
8435150-C-A 8567109-C-A YY*
8535994-C-A 8667953-C-A YY*
8550804-C-A 8682763-C-A YY*
8676470-AC- *
8658684-T-C 8790643-T-C YY*
8750684-T-A 8882643-T-A YY*
8776500-C-A 8908459-C-A YY*
8810319-C-T 8942278-C-T YY*
8842965-AGAAC-A 8974924-AGAAC-A *
8849599-T-C 8981558-T-C YY*
8877295-C-A 9009254-C-A Y*
13465070-T-A 11309394-T-A *
8911786-T-C 9043745-T-C *
10019469-GAA-G 10181860-GAA-G *
8981271-C-CA 9143662-C-CA 9×A*
56835773-ATTCCATTCCACTGCATTCCATTCCATTCCCTTCGACTCCACTCCACTCCTCTCCAT-A *
7669275-C-A 7801234-C-A YY*
7518493-CAAAA-C,CAAA 7650452-CAAAA-C,CAAA 19×A*
13489535-T-A 11333859-T-A *
6916488-C-A 7048447-C-A Y*
6155201-T-C 6287160-T-C IR3_Dst *
6226044-C-CT,CTTCTTTCT 6358003-C-CT,CTTCTTTCT IR3_Dst 13×TTCT*
6231280-G-T 6363239-G-T IR3_Dst *
6647092-G-A 6779051-G-A YY*
24079271-C-CA 21933124-C-CA P3_b1 9×A*
13465033-C-A 11309357-C-A *
6776497-CAAAAAA-C,CAAAAA 6908456-CAAAAAA-C,CAAAAA 28×A*
6826070-G-T 6958029-G-T YY*
6833465-A-T 6965424-A-T YY*
6833494-C-A 6965453-C-A YY*
6854456-T-C 6986415-T-C YY*
7033629-C-A 7165588-C-A Y*
7518477-A-C 7650436-A-C Y*
7040158-G-C 7172117-G-C Y*
22447681-C-CT 20285795-C-CT DYZ19 *
13465551-G-C 11309875-G-C *
7073067-C-CTT 7205026-C-CTT 10×T*
7144918-C-A 7276877-C-A YY*
7188713-A-G 7320672-A-G YY*
7211961-A-ACCCCC 7343920-A-ACCCCC *
7228769-C-A 7360728-C-A Y*
7282461-G-T 7414420-G-T YY*
7302561-C-A 7434520-C-A YY*
7351237-C-A 7483196-C-A YY*
7407036-C-G 7538995-C-G YY*
9130035-G-A 9292426-G-A Y*
22489955-T-G 20328069-T-G DYZ19 *
9343465-T- *
10764621-A-AT *
13484463-C-A 11328787-C-A *
13484454-G-A 11328778-G-A *
56829829-TCCATTCGATTCCACTGCATTCCACGCTATTCCTTTCTTTCAAAAGTATCTCACTCTGTCACCCTGCCTGCAGCACAGTGGCACAATCTCAGCTCACATTTCATTTCA-T *
56829753-TCCCATTCCATTCCTCTCCATTCCAGTCCACTCTACTTCACCTCACTCCACTCCACTCTAGTCCAC-T *
10753244-C-CCTCCT *
10753257-T-A *
28791498-G-T 26645351-G-T *
10753266-A-C *
10753277-T-C *
22249776-C-T 20087890-C-T DYZ19 *
13688233-A-AATGTG 11532557-A-AATGTG *
10764624-C-CTTT *
10039736-C-A 10202127-C-A *
13483352-T-C 11327676-T-C *
28791481-T-A 26645334-T-A *
10764625-C-CT *
58997080-C-A 56850933-C-A *
13453632-C-G 11297956-C-G *
10976105-C-T,T *
10976108-T-C,C *
10976109-T-A,A *
10987292-T-G *
20163478-GTGGCAGGTTCATGGTCTTGCTCACTTCAAGAATGAAGCTGCAGAATTTAGTGGTGAGCGTTACAGCACTTAAGTTTTTATGTCCAGAGTTTGTTCCTTCAGATAAGTCTAGAGATTCTTCCTTC- DYZ19 *
10987881-T-TTCCAA *
13489769-C-G 11334093-C-G *
10647986-C-A *
10039732-C-A 10202123-C-A *
6114536-T-G 6246495-T-G *
9493663-C-A 9656054-C-A *
13838471-G-T 11717765-G-T *
9342538-G-A 9504929-G-A Y*
9363147-G-A 9525538-G-A Y*
9363151-CAAACA-C 9525542-CAAACA-C *
9363157-A-G 9525548-A-G Y*
9363160-TACC-T 9525551-TACC-T *
9363168-C-CTT 9525559-C-CTT *
13489760-C-A 11334084-C-A *
9363169-G-GAAAAAA 9525560-G-GAAAAAA *
9363170-C-A 9525561-C-A Y*
9420181-C-A 9582572-C-A YY*
9461349-G-T 9623740-G-T Y*
9520074-C-G 9682465-C-G 10×T*
10026579-C-A 10188970-C-A Y*
9655553-C-A 9817944-C-A IR3_Prx *
13712863-C-A 11557187-C-A *
9666572-CCA-C 9828963-CCA-C IR3_Prx *
9730450-TCA-T 9892841-TCA-T IR3_Prx *
9737806-T-C 9900197-T-C IR3_Prx *
9815865-C-A 9978256-C-A YY*
9873547-C-A 10035938-C-A Y*
9873555-T-A 10035946-T-A Y*
9907574-G-T 10069965-G-T Y*
9974360-A-T 10136751-A-T Y*
10019457-G-GAGAT 10181848-G-GAGAT *
10022966-G-A 10185357-G-A Y*
13483303-G-A 11327627-G-A *
6114527-A-G 6246486-A-G *
6114533-A-G 6246492-A-G *
56832959-C-CA,CATT *
56825991-AGTTCATTCCATTCGAGTTCCTTCCATTCGAG-A *
22259577-C-T 20097691-C-T DYZ19 *
11293723-A- *
56832021-TCCATC-T *
56832034-ATT-A *
13484092-G-C 11328416-G-C *
56832037-CCGT-C *
13458745-C-G 11303069-C-G *
56835807-G-C,C *
56834810-T-TTCCATTCCACACCACTCCACTCC *
15558431-GAGATAGAT-G,G 13446551-GAGATAGAT-G,G 17×AGAT*
56832960-C-CCACTCCA,CTCCA *
13476350-ATCAGCTGGGTGATCAGTGTAG-A 11320674-ATCAGCTGGGTGATCAGTGTAG-A *
11001940-TTATATTCGCCTCTATTTCAC-T *
56742572-G-T *
13489549-C-T 11333873-C-T *
13480921-G-T 11325245-G-T *
56834449-C-CA *
13465169-C-T 11309493-C-T *
13484495-A-G 11328819-A-G *
56826921-A-ATTCCATTCGATTC,C *
22440115-AC-A 20278229-AC-A DYZ19 *
22488200-GCTGATATGTCCAGAGTTTGTTCCTTCAGATGTTTCCAGAGTTTCTTCCTTCTAGCAGGTTCGTGGTCTTGCTCACTTCTTTAATGAAGCTGCAGACCTTACTTGTGAGTGTTACAGCACTTAAAT-G 20326314-GCTGATATGTCCAGAGTTTGTTCCTTCAGATGTTTCCAGAGTTTCTTCCTTCTAGCAGGTTCGTGGTCTTGCTCACTTCTTTAATGAAGCTGCAGACCTTACTTGTGAGTGTTACAGCACTTAAAT-G DYZ19 *
13488613-C-T 11332937-C-T *
13488620-G-T 11332944-G-T *
10895887-A-C *
16718626-AT-A,A 14606746-AT-A,A 9×T*
13465171-C-A 11309495-C-A *
56771265-A-T *
11357463-TTCCA- *
13483373-A-T 11327697-A-T *
13465099-C-G 11309423-C-G *
26666030-ATGGAATGGAGTGGAATGGAGTGGATTGGAATGGAATGGAGTGCAGAGGAATGGAATGGAATGGTATAGAGTGGACAGGAATAGAG- *
56826961-C- *
9297652-GTCT-G 9460043-GTCT-G *
56706989-G-C *
6402235-TTCGTCGGTGTCGTAAAATACCAATGTATATGTTATATTCGTACGTGCCGTAAAATACCGACGTATATGTTATATTCTTCCGTGTCGTAAAATACCGACGTATTTGTTATAA-T 6534194-TTCGTCGGTGTCGTAAAATACCAATGTATATGTTATATTCGTACGTGCCGTAAAATACCGACGTATATGTTATATTCTTCCGTGTCGTAAAATACCGACGTATTTGTTATAA-T *
13474393-G-T 11318717-G-T *
11333958-CA- *
13480410-T-G 11324734-T-G *
13484174-A-T 11328498-A-T *
13473845-A-G 11318169-A-G *
13448886-C-CTCCACTCCAGTCCTTTCCATTCCACTCCAATCCATTCCAT 11293210-C-CTCCACTCCAGTCCTTTCCATTCCACTCCAATCCATTCCAT *
13468333-C-G 11312657-C-G *
13487280-G-T 11331604-G-T *
13468313-C-T 11312637-C-T *
56706647-T-G *
13487529-A-G 11331853-A-G *
13487532-C-G 11331856-C-G *
56731945-G-A *
56731959-G-T *
22490745-TG-T 20328859-TG-T DYZ19 *
56682020-TGG-T *
13469371-G-A 11313695-G-A *
7682451-GAA-G 7814410-GAA-G 11×A*
13479041-T-A 11323365-T-A *
56756844-C-G 8×AATGG*
2908042-C-A 3040001-C-A YY*
13448141-T-G,TAA 11292465-T-G,TAA *
13639389-C-A 11483713-C-A *
22238373-A-G 20076487-A-G DYZ19 *
22238371-C-G 20076485-C-G DYZ19 *
22238356-T-C 20076470-T-C DYZ19 *
11333954-C- *
6347781-A-AAGGAAG,AAGGAAG 6479740-A-AAGGAAG,AAGGAAG *
2702988-T-G 2834947-T-G YY*
2738336-C-A 2870295-C-A YY*
2833451-C-T 2965410-C-T YY*
2907190-T-C 3039149-T-C YY*
3343444-C-A 3475403-C-A *
3546475-ATACTT-A 3678434-ATACTT-A *
13712890-A-T 11557214-A-T *
13488716-A-G,T 11333040-A-G,T *
22509096-C-T 20347210-C-T DYZ19 *
16494380-GATAT-G 14382500-GATAT-G 8×AT*
3696086-A-G 3828045-A-G *
4473191-T-C 4605150-T-C *
13465440-G-A 11309764-G-A *
56835828-AT-A,A *
4957482-C-A 5089441-C-A *
5247162-A-T 5379121-A-T *
5603656-C-A 5735615-C-A *
13483310-A-C 11327634-A-C *
10986863-A-ACTCCT *
56706929-G-A *
9231698-AACAC-A 9394089-AACAC-A 22×AC*
11329993-G- *
11291125-C- *
13465062-A-T 11309386-A-T *
11001965-C-A *
24783191-TGA-T 22637044-TGA-T P3_b2 *
22366448-A-C 20204562-A-C DYZ19 *
13472531-A-G 11316855-A-G *
10748292-C-CACTCT *
10748324-T-TGC *
13719980-A-G 11564304-A-G *
22229214-A-T 20067328-A-T DYZ19 *
13489526-A-ATGTG 11333850-A-ATGTG *
13446809-TCCATTCCATTCCATTCCA-T 11291133-TCCATTCCATTCCATTCCA-T *
13470570-G-C 11314894-G-C *
56834420-T-TCCAC *
13478389-C-T 11322713-C-T *
6347816-G-A,A 6479775-G-A,A *
6347818-A-G,G 6479777-A-G,G *
14505108-T-TTGGA 12393313-T-TTGGA *
13476339-AATAAAGTCC-A 11320663-AATAAAGTCC-A *
23775478-A-G 21613592-A-G Y*
13446829-T-G 11291153-T-G *
13465040-A-C 11309364-A-C *
13483900-G-T 11328224-G-T *
13470651-G-GA 11314975-G-GA *
13470648-C-CGGGAA 11314972-C-CGGGAA *
3680584-C-A 3812543-C-A *
13467946-G-A,A 11312270-G-A,A *
11001970-C-T *
22341569-G-C 20179683-G-C DYZ19 *
20346713-C- DYZ19 *
22490741-T-A 20328855-T-A DYZ19 *
22464177-G-T 20302291-G-T DYZ19 *
20278230-C- DYZ19 *
22432368-G-C,C 20270482-G-C,C DYZ19 *
22366442-A-C 20204556-A-C DYZ19 *
22296197-C-T 20134311-C-T DYZ19 *
22732935-C-A 20571049-C-A YY*
22296174-C-T 20134288-C-T DYZ19 *
22296173-C-A 20134287-C-A DYZ19 *
22269609-G-GCCAC,GCCAC 20107723-G-GCCAC,GCCAC DYZ19 *
22269604-GTATA-G,G 20107718-GTATA-G,G DYZ19 *
22259576-C-A 20097690-C-A DYZ19 *
22252155-G-C,C 20090269-G-C,C DYZ19 *
22542537-C-A 20380651-C-A Y*
22766911-C-A 20605025-C-A YY*
22159406-C-T 19997520-C-T YY*
23342094-G-T 21180208-G-T YY*
21396672-AC- *
23528852-A-T 21366966-A-T YY*
23472245-T-C 21310359-T-C YY*
23387159-C-A 21225273-C-A YY*
23377598-T-C 21215712-T-C YY*
23371573-G-C 21209687-G-C YY*
23332142-C-A 21170256-C-A YY*
22935932-C-A 20774046-C-A YY*
23061960-T-C 20900074-T-C Y*
23047812-A-G 20885926-A-G Y*
23036948-C-A 20875062-C-A YY*
23013673-A-G 20851787-A-G YY*
22948139-C-A 20786253-C-A YY*
22937377-C-A 20775491-C-A YY*
22204819-C-T 20042933-C-T Y*
22097568-C-A 19935682-C-A YY*
23579472-T-C 21417586-T-C YY*
18994629-A-G 16882749-A-G YY*
19444683-T-C 17332803-T-C YY*
19255299-G-A 17143419-G-A YY*
19232445-C-A 17120565-C-A YY*
19108465-C-A 16996585-C-A YY*
19069450-C-A 16957570-C-A YY*
19061152-C-A 16949272-C-A YY*
18981109-C-A 16869229-C-A YY*
19482393-C-A 17370513-C-A YY*
18844026-C-T 16732146-C-T YY*
18785388-G-A 16673508-G-A YY*
18751874-T-C 16639994-T-C YY*
18614407-A-G 16502527-A-G YY*
18606711-TA-T 16494831-TA-T *
18343804-G-T 16231924-G-T P6_Prx *
19465098-C-A 17353218-C-A YY*
19799849-T-C 17687969-T-C P5_Prx *
22034886-A-T 19873000-A-T YY*
21566002-TAA-T 19404116-TAA-T *
22027546-G-T 19865660-G-T YY*
22027313-C-A 19865427-C-A YY*
21990509-C-A 19828623-C-A YY*
21890879-CCT-C 19728993-CCT-C *
21692422-A-G 19530536-A-G YY*
21650529-C-A 19488643-C-A YY*
21495325-A-G 19333439-A-G YY*
20640189-T-C 18478303-T-C P4_Prx *
21453399-C-A 19291513-C-A YY*
21319892-T-C 19158006-T-C YY*
21211174-G-T 19049288-G-T YY*
21184636-C-A 19022750-C-A YY*
21130193-C-A 18968307-C-A YY*
21091064-AAAAAAATAATAATAAT-A 18929178-AAAAAAATAATAATAAT-A *
20707621-G-T 18545735-G-T P4_Prx *
23572490-T-C 21410604-T-C YY*
23612458-C-A 21450572-C-A YY*
18232189-C-A 16120309-C-A Y*
56829164-CATTCCATTCT-C *
56831989-T-TCCA *
56831987-C-CGTATCCA *
56831899-T-TTCCATTCCA *
56831898-C-CA *
56831386-T-TTCCATTCCAC,TTCCTTTCCAC *
56829175-A-G *
56825940-C-T *
56832309-C-CCATTCGACTCCACTCCACTCCAATG *
56756902-T-TG *
56749786-TAATGG-T *
56742778-A-T *
56731859-G-T *
56724845-A-AATGGGATGGAATGGG *
56706984-C-G,G 5×AATGG*
56832303-C-CCATT *
56832539-C-A,CTCCAATCCATTCCATTCCATTCCAT *
56685476-G-T *
56839378-T-A *
56884272-A-G *
56869174-C-A *
56850954-G-C *
56850880-C-T *
56850458-C-A *
56842684-G-T *
56836324-G-A,A *
56832797-TCCTC-T,T *
56836310-T-TTCCAG,TTCCAG *
56834755-C-T *
56834544-A-G *
56834400-C-CCTGTCCACTCCATTCCACTCCACTTCACTCCAT,CCTGTCCACTCCATTCCACTCCACTTCACTCCAT *
56832839-C-A,A *
56832814-C-T,T *
56685481-T-G *
56685461-T-C *
23642993-A-G 21481107-A-G Y*
24672681-G-A 22526534-G-A P3_b2 *
25842360-G-T 23696213-G-T P1_b3 *
25102531-C-A 22956384-C-A g1 *
25102516-C-A 22956369-C-A g1 *
25088674-G-C 22942527-G-C g1 *
24922353-C-A 22776206-C-A g1 *
24870887-TTCTCTC-T,TTCTC 22724740-TTCTCTC-T,TTCTC IR1_R 23×TC*
24392450-C-A 22246303-C-A Y*
26409077-G-T 24262930-G-T P1_Y1 *
24221511-C-A 22075364-C-A P3_b1 *
23786145-G-T 21624259-G-T Y*
23775510-T-C 21613624-T-C Y*
23775493-T-C 21613607-T-C Y*
23775483-G-T 21613597-G-T Y*
23654428-C-A 21492542-C-A Y*
26100757-G-T 23954610-G-T P1_Y1 *
26427229-C-A 24281082-C-A P1_Y1 *
56682023-AATG-A *
28483902-C-A 26337755-C-A *
26656616-GGAATCAAATGGAATGCGGTGAAGTGGAGTGGACATGAATGGAGTGGAATGGAATGGGTTGGAATGGAATTGAGTGGATTGGAGTGGAGTGTAGTGCATTGGACTGTAGGGGATTGAAGTGGCTTGGAGTGCAATAGAGTGGAGTGGAATGGAATGGAATGGAATGGAATC- *
26640923-C- *
28757375-G-A 26611228-G-A Y*
28706438-C-A 26560291-C-A Y*
28640585-C-A 26494438-C-A *
28558489-A-G 26412342-A-G *
28429762-C-A 26283615-C-A P1_gr2 *
26563606-C-A 24417459-C-A P1_g2 *
28063813-A-T 25917666-A-T P1_Y2 *
28063808-G-T 25917661-G-T P1_Y2 *
27856170-GC-G 25710023-GC-G P1_Y2 *
27618290-C-A 25472143-C-A P1_Y2 *
27128073-A-G 24981926-A-G P1_g3 *
26834934-G-T 24688787-G-T P1_g2 *
26684569-G-T 24538422-G-T P1_g2 *
18271048-G-A 16159168-G-A *
18220165-C-A 16108285-C-A Y*
11003844-C-T *
13523633-A-AAAT 11367957-A-AAAT *
13726507-A-C 11570831-A-C *
11550434-CATGGTATGGAATGGAATGGAATGGA- *
13642835-C-T 11487159-C-T *
13602120-T-C 11446444-T-C *
13602074-C-A 11446398-C-A *
13527310-C-A 11371634-C-A *
13510089-C-A 11354413-C-A *
13745301-CATAGA-C 11589625-CATAGA-C *
13496588-ACTC-A 11340912-ACTC-A *
13496585-AGG-A 11340909-AGG-A *
13489729-C-CCAGTG 11334053-C-CCAGTG *
13489622-C-CAG 11333946-C-CAG *
13489566-G-A 11333890-G-A *
13488063-ACGGTGG-A 11332387-ACGGTGG-A *
13730067-A-T 11574391-A-T *
13838485-A-AGGAAT,T 11717779-A-AGGAAT,T 9×GGAAT*
13483429-C-G 11327753-C-G *
14065822-C-A 11945116-C-A YY*
14253022-G-A 12132316-G-A YY*
14232764-CT-C 12112058-CT-C *
14198645-T-C 12077939-T-C YY*
14158996-G-A 12038290-G-A YY*
14085776-C-A 11965070-C-A YY*
14072460-C-A 11951754-C-A YY*
14051601-C-A 11930895-C-A YY*
13843923-AGGAAT-A,A 11723217-AGGAAT-A,A 14×GGAAT*
14036953-A-T 11916247-A-T YY*
13883694-AT-A 11762988-AT-A *
13862071-A-AAATGG,AAATGG 11741365-A-AAATGG,AAATGG 11×AATGG*
13861233-TA-T 11740527-TA-T *
13858590-C-A 11737884-C-A *
13857458-A-G 11736752-A-G *
13483442-G-T 11327766-G-T *
13483336-G-C 11327660-G-C *
14342578-C-A 12221873-C-A YY*
13447159-CTCCAT-C 11291483-CTCCAT-C *
13464779-A-G 11309103-A-G *
13464408-C-G 11308732-C-G *
13458713-C-G 11303037-C-G 9×TCCAT*
13454315-T-C 11298639-T-C *
11296301-CCACA- *
13450880-C-CCAATCCACTCTACTCCACTCCTCTCCACTCCACTCCTCTACATTCAATTCCATCCAATTCCATACCACTCCACTCCTCTCCCCAA 11295204-C-CCAATCCACTCTACTCCACTCCTCTCCACTCCACTCCTCTACATTCAATTCCATCCAATTCCATACCACTCCACTCCTCTCCCCAA *
11291476-C- *
13467903-G-C,C 11312227-G-C,C *
11291128-GCCATTCCATTCCATTCCATTCCATTCCATTCCATTCCATT- 12×CCATT*
13441843-TA-T 11286167-TA-T *
13234255-A-T 11078579-A-T *
13226661-G-A 11070985-G-A *
13225583-A-G 11069907-A-G *
13225582-C-T 11069906-C-T *
13465925-C-A 11310249-C-A *
13467910-C-T,T 11312234-C-T,T *
13483163-C-A 11327487-C-A *
11314979-G- *
13482256-C-T 11326580-C-T *
13472295-G-GCA 11316619-G-GCA *
13472285-CTG-C 11316609-CTG-C *
13472284-A-ATC 11316608-A-ATC *
13472283-C-T 11316607-C-T *
13471935-G-A 11316259-G-A *
13469640-C-A 11313964-C-A *
13467930-A-T,T 11312254-A-T,T *
13469389-A-G 11313713-A-G *
13468577-C-A 11312901-C-A *
13468574-T-A 11312898-T-A *
13468332-A-T 11312656-A-T *
13468311-G-GT 11312635-G-GT *
13468290-A-G 11312614-A-G *
56832005-C-CTCCACTCCAT *
14253026-C-A 12132320-C-A YY*
14373458-A-G 12252754-A-G YY*
18126451-A-G 16014571-A-G YY*
16428293-G-C 14316413-G-C Y*
16742832-C-A 14630952-C-A YY*
16704078-T-A 14592198-T-A Y*
16626063-C-A 14514183-C-A YY*
16552776-C-A 14440896-C-A YY*
16526889-C-A 14415009-C-A YY*
16519588-C-A 14407708-C-A YY*
16370933-C-A 14259053-C-A YY*
16819638-C-CAA 14707758-C-CAA 9×A*
16275909-A-G 14164029-A-G YY*
16217931-T-C 14106051-T-C YY*
16180128-C-A 14068248-C-A Y*
16134539-C-A 14022659-C-A *
15975080-C-T 13863200-C-T YY*
15952646-C-A 13840766-C-A YY*
16768242-C-A 14656362-C-A YY*
16968448-C-A 14856568-C-A YY*
15898761-C-A 13786881-C-A YY*
17695853-C-A 15583973-C-A YY*
18084080-T-C 15972200-T-C YY*
18036181-C-A 15924301-C-A YY*
17973339-C-A 15861459-C-A Y*
17874113-G-A 15762233-G-A YY*
17859620-C-A 15747740-C-A Y*
17789803-C-A 15677923-C-A YY*
17491120-C-A 15379240-C-A YY*
16970431-C-A 14858551-C-A YY*
17157772-C-A 15045892-C-A YY*
17079044-T-C 14967164-T-C YY*
17056043-G-A 14944163-G-A YY*
17038268-C-A 14926388-C-A YY*
17038254-TA-T 14926374-TA-T *
17028526-C-A 14916646-C-A YY*
15917406-C-A 13805526-C-A YY*
15873566-A-T 13761686-A-T YY*
14392735-CTTTT-C,CTT 12272031-CTTTT-C,CTT 17×T*
14656154-C-CAAA 12544219-C-CAAA 24×A*
15122479-C-A 13010566-C-A YY*
14846769-C-T 12734835-C-T YY*
14806152-G-T 12694223-G-T YY*
14761144-A-G 12649213-A-G Y*
14743250-C-A 12631318-C-A Y*
14730368-G-A 12618436-G-A YY*
14594746-C-A 12482946-C-A YY*
15236515-ATT-A 13124601-ATT-A 12×T*
14572094-C-A 12460294-C-A YY*
14550512-A-T 12438713-A-T Y*
14515225-T-C 12403430-T-C YY*
14502299-C-A 12390504-C-A Y*
14444636-G-A 12323909-G-A Y*
14424213-CA-C 12303488-CA-C *
15173738-T-A 13061824-T-A YY*
15260664-C-T 13148748-C-T YY*
15865706-C-A 13753826-C-A YY*
15701178-G-A 13589298-G-A YY*
15849850-T-G 13737970-T-G YY*
15844574-C-A 13732694-C-A YY*
15786766-C-A 13674886-C-A YY*
15772711-CACGA-C 13660831-CACGA-C *
15739690-C-A 13627810-C-A Y*
15709422-C-A 13597542-C-A YY*
15685075-G-T 13573195-G-T Y*
15289429-C-G 13177528-C-G Y*
15677518-AAAAC-A 13565638-AAAAC-A *
15677016-G-A 13565136-G-A Y*
15592694-C-A 13480814-C-A YY*
15558932-G-A 13447052-G-A YY*
15558926-C-A 13447046-C-A YY*
15430353-AC-A 13318473-AC-A *
15382924-C-A 13271044-C-A YY*
17419439-ATTTTTT-A,ATTTT 15307559-ATTTTTT-A,ATTTT 25×T*
15143797-C-A 13031884-C-A YY*
15070614-CAAAA-C,CAAAAA 12958705-CAAAA-C,CAAAAA 20×A*
22367714-C-T 20205828-C-T DYZ19 *
13601004-C-T 11445328-C-T *
7021911-C-A 7153870-C-A Y*
13952727-C-A 11832021-C-A Y*
15394046-C-A 13282166-C-A YY*
14397310-C-A 12276606-C-A YY****
13996122-C-A 11875416-C-A Y*
22367719-C-T 20205833-C-T DYZ19 *
13405007-C-A 11249331-C-A *
5189751-C-A 5321710-C-A *
13461819-G-C 11306143-G-C *
24108403-GT-G 21962256-GT-G P3_b1 12×T*
58834079-A-T 56756792-T-A *
18783917-C-A 16672037-C-A YY*
13465414-T-A 11309738-T-A *
9316492-T-C 9478883-T-C Y*
13469347-T-A 11313671-T-A *
56724759-C-T *
13404645-T-A 11248969-T-A ***
13700566-A-T 11544890-A-T *
4325980-T-C 4457939-T-C *
22970282-CAAAAAAAA-C 20808396-CAAAAAAAA-C 27×A*
28797096-G-T 26650949-G-T *
13698528-G-T 11542852-G-T *
9907477-G-T 10069868-G-T Y*
22849522-C-A 20687636-C-A YY*
19125694-CAA-C,CA 17013814-CAA-C,CA 24×A*
19511984-C-A 17400104-C-A YY*
10963057-G-T ***
11652859-A-G BY27137 *
6427298-C-A 6559257-C-A *
13461050-A-C 11305374-A-C *
21939522-C-A 19777636-C-A YY*
14735252-C-A 12623320-C-A YY***
8155823-C-A 8287782-C-A YY*
6144674-G-T 6276633-G-T IR3_Dst *
13488618-G-A 11332942-G-A *
13474456-C-G 11318780-C-G *
13465143-G-T 11309467-G-T *
10895870-C-G *
22259538-A-T 20097652-A-T DYZ19 *
8207791-C-CT 8339750-C-CT 8×T*
13485656-G-T 11329980-G-T *
58883595-T-A 56707276-A-T *
22481555-T-G 20319669-T-G DYZ19 *
13484478-G-A 11328802-G-A BY210387 *
18098939-G-T 15987059-G-T FT416324 YY****
13480392-C-T 11324716-C-T *
13480430-C-T 11324754-C-T *
22238311-C-A 20076425-C-A DYZ19 *
13480428-A-T 11324752-A-T *
9188489-GTCT-G 9350880-GTCT-G *
18605194-C-A 16493314-C-A Y102205 YY***
9327706-CTG-C 9490097-CTG-C 8×TG*
22341501-C-T 20179615-C-T DYZ19 *
16779339-TAC-T 14667459-TAC-T *
15973404-TGA-T 13861524-TGA-T *
22510765-C-G 20348879-C-G DYZ19 *
22341554-C-A 20179668-C-A DYZ19 *
10017070-TCACA-T 10179461-TCACA-T 16×CA*
13465034-C-T 11309358-C-T *
28819133-A-T 26672986-A-T *
15864264-C-A 13752384-C-A YY****
22490659-T-A 20328773-T-A DYZ19 *
58979018-CTCTAT-C 56832871-CTCTAT-C *
13474371-C-T 11318695-C-T *
13465241-C-T 11309565-C-T *
15558934-A-T 13447054-A-T YY*
13474332-T-C 11318656-T-C *
22366487-T-C,G 20204601-T-C,G DYZ19 *
13730454-G-T 11574778-G-T *
9303212-G-C 9465603-G-C Y*
8439884-AT-A 8571843-AT-A 10×T*
7105351-GA-G 7237310-GA-G 11×A*
13478793-G-T 11323117-G-T *
13572804-T-G 11417128-T-G *
13572803-A-T 11417127-A-T *
9183437-G-A 9345828-G-A Y*
10802281-C-T ****
16862301-C-A 14750421-C-A YY*
15650992-T-G 13539112-T-G YY*
22760658-C-A 20598772-C-A YY*
21858185-C-A 19696299-C-A YY****
7453566-AGTGTGT-A,AGTGT 7585525-AGTGTGT-A,AGTGT IR1_L 16×GT*
15957651-C-A 13845771-C-A YY*
7029347-C-A 7161306-C-A Y*
3275882-C-A 3407841-C-A *
20104256-GGA-G 17992376-GGA-G P5_Dst 22×GA*
8563745-CTTTTTTT-C 8695704-CTTTTTTT-C 21×T*
23196222-C-A 21034336-C-A Y*
15677505-C-CAA 13565625-C-CAA 16×A*
23232554-CTT-C 21070668-CTT-C 12×T*
6630512-CTT-C,CTTT 6762471-CTT-C,CTTT 15×T*
19721420-C-A 17609540-C-A P5_Prx *
3012085-C-A 3144044-C-A *
13480450-A-G 11324774-A-G *
13480440-C-T 11324764-C-T *
10895880-C-G *
14453669-C-A 12332942-C-A YY*
8911612-G-T 9043571-G-T ***
13715114-A-C 11559438-A-C *
7415544-T-G 7547503-T-G YY*
2791224-G-T 2923183-G-T Y*
13468568-G-A 11312892-G-A *
15336707-CAAAAA-C 13224825-CAAAAA-C 20×A****
15271047-GAAAAAA-G 13159136-GAAAAAA-G 19×A*
17895175-ATT-A,ATTT 15783295-ATT-A,ATTT 21×T*
8843536-ATTTTTT-A,ATTTTT 8975495-ATTTTTT-A,ATTTTT 23×T*
14497374-TGG-T 12385579-TGG-T 11×G*
8636152-C-A 8768111-C-A FT192612 YY*
26435139-C-A 24288992-C-A P1_Y1 *
3640457-C-A 3772416-C-A *
16342092-C-A 14230212-C-A YY*
21608018-C-A 19446132-C-A YY*
15211352-C-A 13099438-C-A YY*
13484113-C-T 11328437-C-T *
9974579-G-T 10136970-G-T Y*
10764637-T-C *
10764642-T-A *
4769310-T-C 4901269-T-C ****
27641706-C-A 25495559-C-A P1_Y2 *
9907566-G-T 10069957-G-T Y*
21212417-C-A 19050531-C-A YY*
23761608-A-AAAGAAG,AAAGAAGAAG 21599722-A-AAAGAAG,AAAGAAGAAG 23×AAG*
13449407-T-C 11293731-T-C *
10037639-C-A 10200030-C-A *
27990895-G-T 25844748-G-T P1_Y2 *
3992096-C-A 4124055-C-A *
7237318-C-A 7369277-C-A Y****
9124380-T-C ****
10946846-C-A *
6580217-C-A 6712176-C-A *
15143815-C-A 13031902-C-A YY*
13489447-G-A 11333771-G-A *
10033006-C-G 10195397-C-G Y***
13489510-G-C 11333834-G-C *
13489483-C-G 11333807-C-G *
10744461-T-C ****
11014628-C-A *
56831371-C-A *
10987288-T-C *
10918228-G-T ****
15618492-C-A 13506612-C-A YY*
8214860-GTT-G,GT 8346819-GTT-G,GT 21×T*
16560094-C-A 14448214-C-A YY*
28536049-C-CAT 26389902-C-CAT *
19485229-T-TCA 17373349-T-TCA *
21890883-G-A 19728997-G-A YY*
6479224-C-A 6611183-C-A FT173755 ***
17707065-G-GA 15595185-G-GA 9×A*
19038035-C-A 16926155-C-A YY*
6886960-T-A 7018919-T-A YY****
13234270-C-A 11078594-C-A *
26346031-T-C 24199884-T-C Z3000/S951BY44248 P1_Y1 *
9967500-C-A 10129891-C-A Y*
5967730-C-A 6099689-C-A *
13458721-C-A 11303045-C-A *
7203635-T-A 7335594-T-A YY***
8126274-C-A 8258233-C-A YY*
18969353-C-T 16857473-C-T Y***
13489561-G-A 11333885-G-A *
15525736-T-G 13413856-T-G YY*
18406488-C-A 16294608-C-A P6_Gap *
18958958-TA-T 16847078-TA-T 8×A*
19415821-C-A 17303941-C-A Y*
7941727-C-CA 8073686-C-CA 9×A*
3696984-G-T 3828943-G-T *
16599116-G-GA 14487236-G-GA 8×A*
16366381-TA-T 14254501-TA-T 9×A*
7780430-C-A 7912389-C-A YY*
8746532-C-A 8878491-C-A YY*
14700260-A-C 12588326-A-C YY*
15191680-CT-C 13079766-CT-C 9×T*
17192852-A-ATG 15080972-A-ATG 8×TG*
21212457-C-A 19050571-C-A YY*
2902156-C-A 3034115-C-A YY*
8441133-C-A 8573092-C-A YY*
9974351-TAA-T 10136742-TAA-T *
19517399-C-A 17405519-C-A YY*
13726462-T-C 11570786-T-C *
13726463-C-G 11570787-C-G *
8834208-TGAGA-T 8966167-TGAGA-T 10×GA*
28514917-C-A 26368770-C-A Y*
10039766-C-A 10202157-C-A *
20560666-G-T 18398780-G-T P5_Dst *
19373948-C-A 17262068-C-A YY*
28017909-G-T 25871762-G-T P1_Y2 *
56834581-T-C *
17082960-C-A 14971080-C-A YY*
19012396-C-A 16900516-C-A YY***
22366296-G-A 20204410-G-A DYZ19 *
13257699-C-A 11102023-C-A *
14691832-C-A 12579898-C-A YY*
56724735-A-C *
16213983-C-A 14102103-C-A YY*
13489767-C-A 11334091-C-A *
16742830-C-A 14630950-C-A YY*
21099764-A-G 18937878-A-G YY*
18793399-G-T 16681519-G-T YY*
16952175-C-A 14840295-C-A YY*
5443724-C-A 5575683-C-A *
20829647-C-A 18667761-C-A P4_Gap *
16905870-CAA-C,CA 14793990-CAA-C,CA 25×A*
15122489-C-A 13010576-C-A YY*
7922566-G-T 8054525-G-T YY*
6347486-G-T 6479445-G-T 9×A*
4201268-C-A 4333227-C-A *
7832047-C-A 7964006-C-A YY*
13483898-G-C 11328222-G-C *
13480829-T-C 11325153-T-C *
13480845-G-A 11325169-G-A *
13480891-G-C 11325215-G-C *
13744477-G-C 11588801-G-C *
13644632-C-A 11488956-C-A *
13936945-C-A 11816239-C-A Y*
14846767-T-G 12734833-T-G YY*
13486311-G-C 11330635-G-C *
24406185-G-T 22260038-G-T *
22509092-T-A 20347206-T-A DYZ19 *
6931128-A-C 7063087-A-C YY*
13481034-T-A 11325358-T-A *
25698627-TTG-T 23552480-TTG-T P1_b3 *
22298381-G-C 20136495-G-C FT455407 DYZ19 *
19720709-ATTT-A,ATT 17608829-ATTT-A,ATT P5_Prx 23×T*
13484167-A-G 11328491-A-G *
13465463-C-A 11309787-C-A *
28819116-G-C 26672969-G-C *
9130015-C-A 9292406-C-A Y*
17672289-C-A 15560409-C-A YY*
20128468-TAAA-T 18016588-TAAA-T P5_Dst 20×A*
4357817-G-T 4489776-G-T *
7188575-C-A 7320534-C-A YY*
58883892-C-G 56706979-G-C *
13476927-G-A 11321251-G-A *
16028911-C-A 13917031-C-A Y*
13465409-C-T 11309733-C-T *
7188711-G-A 7320670-G-A FT303473 YY10×GA*
6689853-C-A 6821812-C-A YY*
27756278-C-A 25610131-C-A P1_Y2 *
13468305-C-G 11312629-C-G *
23306154-C-A 21144268-C-A Y*
28814937-C-A 26668790-C-A *
16478359-CAAAAA-C,CAAAA 14366479-CAAAAA-C,CAAAA 18×A*
13473848-G-T 11318172-G-T *
16039821-C-A 13927941-C-A YY*
16713668-C-A 14601788-C-A YY*
10753264-C-G *
4581665-GT-G 4713624-GT-G 8×T*
21946855-C-A 19784969-C-A YY*
7471256-G-T 7603215-G-T IR1_L *
16016826-C-A 13904946-C-A Y*
5264101-T-C 5396060-T-C *
13467011-A-G 11311335-A-G *
21990257-T-C 19828371-T-C YY*
26325267-T-A 24179120-T-A Z5834 P1_Y1 *
9160320-AACAC-A 9322711-AACAC-A 17×AC*
13489512-G-A 11333836-G-A *
22723424-T-A 20561538-T-A YY*
28589176-T-C 26443029-T-C ****
58858939-C-A 56731932-G-T *
13719993-C-G 11564317-C-G *
13467010-C-A 11311334-C-A *
13461853-G-T 11306177-G-T *
56847834-G-A ****
7768626-C-A 7900585-C-A YY*
13718084-G-A 11562408-G-A *
2859965-C-A 2991924-C-A YY*
15332210-G-T 13220328-G-T YY*
22229215-T-A 20067329-T-A DYZ19 *
16654899-C-A 14543019-C-A YY*
11014612-A-T *
11014624-C-A *
22483875-T-C 20321989-T-C DYZ19 *
4325957-A-C 4457916-A-C *
22367712-G-T 20205826-G-T DYZ19 *
22464172-G-A 20302286-G-A BY221266 DYZ19 *
14253030-C-T 12132324-C-T F18706 YY*
13433607-A-T 11277931-A-T *
10038139-AAG-A 10200530-AAG-A *
9173026-T-G 9335417-T-G Y*
2783753-G-A 2915712-G-A YY*
13461878-G-A 11306202-G-A *
15480111-ATTTTTT-A 13368231-ATTTTTT-A 21×T*
8755817-GGAGA-G 8887776-GGAGA-G 12×GA*
22723426-C-A 20561540-C-A YY*
21148851-C-A 18986965-C-A YY****
28787578-G-GAATGGAATGGGATGGGAAAA 26641431-G-GAATGGAATGGGATGGGAAAA *
13572807-G-A 11417131-G-A *
21211683-G-A 19049797-G-A YY****
13482320-G-T 11326644-G-T *
13445326-C-A 11289650-C-A *
6114530-T-G 6246489-T-G *
2690497-TTG-T 2822456-TTG-T *
22279247-T-C 20117361-T-C DYZ19 *
13472461-C-A 11316785-C-A *
28549587-C-A 26403440-C-A *
15968277-C-A 13856397-C-A YY*
8333701-TCTC-T 8465660-TCTC-T *
14697145-C-A 12585211-C-A YY*
28815884-T-A 26669737-T-A FT462741 *
21099740-CTTTTT-C 18937854-CTTTTT-C 16×T*
2783756-C-A 2915715-C-A YY*
16016833-C-A 13904953-C-A Y*
7984040-TAAA-T,TA 8115999-TAAA-T,TA 21×A*
13453698-C-T 11298022-C-T *
13196309-C-A 11040633-C-A *
5191036-C-A 5322995-C-A *
8835404-C-A 8967363-C-A YY*
17504824-G-A 15392944-G-A Y*
13919330-C-A 11798624-C-A Y*
11031632-G-A *
9329239-C-G 9491630-C-G Y*
13202695-C-A 11047019-C-A *
18806044-CTTTT-C,CTTT 16694164-CTTTT-C,CTTT 19×T*
22367973-T-G 20206087-T-G DYZ19 *
13464392-A-C 11308716-A-C *
13474693-A-T 11319017-A-T *
13483289-T-G 11327613-T-G *
13471953-T-A 11316277-T-A *
14501935-C-A 12390140-C-A **
7939266-C-A 8071225-C-A **
7391783-C-A 7523742-C-A **
21151709-C-A 18989823-C-A **
13939175-C-A 11818469-C-A **
17159564-C-A 15047684-C-A **
7340941-G-T 7472900-G-T **
4958390-G-T 5090349-G-T **
27384169-G-T 25238022-G-T P1_g3 **
7281057-C-A 7413016-C-A **
13558199-C-A 11402523-C-A **
5293818-C-A 5425777-C-A **
7853237-AT-A 7985196-AT-A 8×T**
9985982-C-A 10148373-C-A **
14776914-C-A 12664983-C-A **
14799890-C-A 12687961-C-A **
15556758-C-A 13444878-C-A **
15305718-C-A 13193817-C-A **
8238268-T-C 8370227-T-C FT310988 **
21678025-C-A 19516139-C-A **
8749050-C-A 8881009-C-A **
10997346-C-A **
19304700-C-A 17192820-C-A **
15138137-C-A 13026224-C-A **
15059793-C-A 12947885-C-A **
13227326-C-A 11071650-C-A **
9979151-C-A 10141542-C-A FT462795 **
10671312-C-G **
15733544-C-A 13621664-C-A **
18621714-C-A 16509834-C-A **
18687510-T-G 16575630-T-G **
10989451-A-C **
20741858-T-TC 18579972-T-TC P4_Prx **
13433255-C-A 11277579-C-A **
25461433-CTT-C 23315286-CTT-C P2_r2 26×T**
8067362-A-C 8199321-A-C **
18937315-C-A 16825435-C-A **
21281536-C-A 19119650-C-A **
2708558-C-A 2840517-C-A **
19899598-GA-G 17787718-GA-G P5_Prx **
10926739-G-A **
14308230-C-A 12187524-C-A **
18565316-C-A 16453436-C-A **
7313576-C-A 7445535-C-A **
7242657-T-C 7374616-T-C **
16747579-C-A 14635699-C-A **
15386628-C-A 13274748-C-A **
15394225-C-A 13282345-C-A **
15686755-G-T 13574875-G-T **
15909248-A-G 13797368-A-G **
16095996-T-C 13984116-T-C FTB39227 **
16172175-C-T 14060295-C-T **
16417327-C-T 14305447-C-T **
16484357-C-A 14372477-C-A **
16498045-T-C 14386165-T-C **
16842015-C-A 14730135-C-A **
15262449-A-C 13150533-A-C **
16904628-C-A 14792748-C-A **
16920095-A-G 14808215-A-G **
17042833-C-A 14930953-C-A **
17187361-G-A 15075481-G-A **
17187373-C-A 15075493-C-A **
17218193-G-C 15106313-G-C **
17218197-T-A 15106317-T-A **
17218205-A-T 15106325-A-T **
17218214-C-T 15106334-C-T **
17218215-A-G 15106335-A-G **
15358736-C-A 13246855-C-A **
15150871-G-A 13038958-G-A **
17244390-G-T 15132510-G-T **
14284961-C-A 12164255-C-A **
13460426-T-A 11304750-T-A **
13491086-G-A 11335410-G-A **
13614164-TA-T 11458488-TA-T **
11643554-G-C **
13958429-T-G 11837723-T-G **
13987258-C-A 11866552-C-A **
13990163-C-A 11869457-C-A **
14195071-C-T 12074365-C-T **
14252206-A-G 12131500-A-G **
14384316-T-C 12263612-T-C **
15068943-A-T 12957034-A-T **
14409069-G-T 12288366-G-T **
14501096-C-A 12389301-C-A **
14515110-T-A 12403315-T-A **
14515133-A-T 12403338-A-T **
14528327-C-A 12416528-C-A **
14589022-T-A 12477222-T-A **
14715567-C-A 12603634-C-A **
14766679-C-A 12654748-C-A **
14982058-C-A 12870126-C-A **
14982063-A-T 12870131-A-T **
17218223-A-C 15106343-A-C **
17319835-C-A 15207955-C-A **
13213556-T-G 11057880-T-G **
22956251-T-G 20794365-T-G **
21118630-T-C 18956744-T-C **
21153340-C-A 18991454-C-A **
21495504-T-A 19333618-T-A **
21747744-C-A 19585858-C-A Z30080 **
21874866-C-A 19712980-C-A **
21915801-T-C 19753915-T-C **
22175881-G-A 20013995-G-A **
22193124-T-C 20031238-T-C **
22662084-T-C 20500198-T-C **
22995393-TTTTTG-T 20833507-TTTTTG-T **
20825658-G-A 18663772-G-A P4_Gap **
23128687-C-A 20966801-C-A **
23441315-C-A 21279429-C-A **
23819062-C-A 21657176-C-A **
23955145-A-G 21808998-A-G **
24220726-C-A 22074579-C-A P3_b1 **
26089606-G-A 23943459-G-A P1_Y1 **
26834518-C-A 24688371-C-A P1_g2 **
28484871-CA-C 26338724-CA-C **
28558899-C-A 26412752-C-A **
28700639-T-C 26554492-T-C **
21077001-G-GA 18915115-G-GA 8×A**
20655043-T-C 18493157-T-C P4_Prx **
17355754-C-A 15243874-C-A **
18653451-A-G 16541571-A-G **
17371243-C-A 15259363-C-A **
17504080-G-T 15392200-G-T **
18037839-C-A 15925959-C-A **
18071783-C-A 15959903-C-A **
18183167-G-C 16071287-G-C **
18242795-T-G 16130915-T-G **
18243851-C-A 16131971-C-A **
18529021-G-A 16417141-G-A P6_Dst **
18530995-G-A 16419115-G-A P6_Dst **
18695913-A-G 16584033-A-G **
20611297-G-T 18449411-G-T P5_Dst **
18750175-T-A 16638295-T-A **
18753365-G-T 16641485-G-T FT261621 **
18987092-A-C 16875212-A-C **
18991166-T-A 16879286-T-A **
19228849-G-A 17116969-G-A **
19465836-T-C 17353956-T-C **
19524635-A-C 17412755-A-C **
19899592-A-G 17787712-A-G P5_Prx **
19899607-A-G 17787727-A-G P5_Prx **
20229551-C-CATATAT 18067665-C-CATATAT P5_Dst **
6321385-C-CAA 6453344-C-CAA IR3_Dst **
13253877-C-A 11098201-C-A FT208142 **
11038210-C-T **
6835612-G-T 6967571-G-T **
5216342-C-A 5348301-C-A **
5367068-C-A 5499027-C-A **
5411956-G-A 5543915-G-A **
5690162-C-A 5822121-C-A **
5807025-C-A 5938984-C-A **
5968344-C-A 6100303-C-A **
6756885-G-A 6888844-G-A **
6765759-A-T 6897718-A-T **
6816690-TG-T 6948649-TG-T **
6903824-C-A 7035783-C-A **
4778408-C-A 4910367-C-A FT113891 **
6981167-C-T 7113126-C-T **
7033536-C-A 7165495-C-A **
7050197-T-A 7182156-T-A **
7111600-C-A 7243559-C-A **
7134114-T-C 7266073-T-C **
7216649-T-C 7348608-T-C **
7242653-G-A 7374612-G-A **
7242659-A-G 7374618-A-G **
7242665-C-T 7374624-C-T **
4973668-CAAAAA-C 5105627-CAAAAA-C 19×A**
4442551-TG-T 4574510-TG-T **
7259031-T-C 7390990-T-C **
14389962-C-A 12269258-C-A **
21457732-G-T 19295846-G-T **
11033541-C-A **
7242644-G-A 7374603-G-A **
14587705-C-A 12475905-C-A **
28570488-C-A 26424341-C-A **
14241749-C-A 12121043-C-A **
15402950-C-A 13291070-C-A **
4794876-TG-T 4926835-TG-T **
13233443-C-A 11077767-C-A **
7756894-C-A 7888853-C-A **
4243723-A-C 4375682-A-C **
15742370-C-A 13630490-C-A **
7231478-C-A 7363437-C-A **
3436313-C-A 3568272-C-A **
19035953-C-A 16924073-C-A **
15404245-C-A 13292365-C-A **
2745184-C-A 2877143-C-A **
2942525-C-A 3074484-C-A **
3599415-C-A 3731374-C-A **
4005798-G-T 4137757-G-T **
4005856-G-T 4137815-G-T **
11033568-A-T **
7242667-T-C 7374626-T-C **
7281025-C-A 7412984-C-A **
10986435-A-T **
7307674-T-C 7439633-T-C **
10926729-A-T **
10926742-C-T **
10926754-A-T **
10926760-T-C **
10926775-T-C **
10934278-C-A **
10946325-A-G **
10959071-C-A **
11016409-C-A **
10885867-C-T **
11017436-C-T **
11017443-T-C FT69384 **
11017450-T-A **
11017458-CCCCTA-C **
11017470-A-T **
11033533-T-C **
11033547-C-T **
11033551-C-T **
11033558-A-T **
10885906-G-A **
10893442-C-T **
10846822-T-C **
9874958-T-C 10037349-T-C **
7331382-C-A 7463341-C-A **
7418649-G-T 7550608-G-T **
7446339-C-A 7578298-C-A **
7990993-C-A 8122952-C-A **
8035977-C-T 8167936-C-T **
8184662-A-G 8316621-A-G **
8731642-G-T 8863601-G-T **
9524247-C-T 9686638-C-T **
10846818-G-T **
9857341-C-A 10019732-C-A **
7000432-C-T 7132391-C-T **
10809652-C-A **
9926848-G-C 10089239-G-C **
10057110-C-T 10219501-C-T **
10674022-C-T **
10788444-T-C **
10792291-C-G **
10799385-C-A **
10808481-C-A **
56833327-A-G ***
56833313-T-A ***
56826101-T-A ***
10673839-A-ATATCT ***
28811872-C-A 26665725-C-A ***
10673852-C-CCTCTT ***
15969983-AAG-A 13858103-AAG-A ***
22974116-CAAAAA-C,CAA 20812230-CAAAAA-C,CAA 24×A***

In the table above, the meaning of the confidence field depends on whether the data comes from an FTDNA kit or an FGC kit. For FTDNA kits, + implies a "PASS" result with just one possible variant, * indicates a "PASS" but with multiple variants, ** indicates "REJECTED" with just a single variant, and *** indicates "REJECTED" with multiple possible variants. 'A*' are heterozygous variants not called by FTDNA, but still pulled from the VCF file. For FGC kits, + indicates over 99% likely genuine (95% for INDELs); * over 95% likely genuine (90% for INDELs); ** about 40% likely genuine; *** about 10% likely genuine. Manual entries read directly from a BAM file will be either + indicating positive, or * indicating that the data show a mixture of possible variants.

For the FTDNA kits, the BED data is encoded in the background color of the cells. Those cells with a white background have coverage, those with a grey background indicate no coverage in the BED file, and those with a pink background indicate the mutation is on the edge of a coverage region. These pink regions often indicate that the individual may be positive for a SNP even if there is no corresponding entry in the vcf file.

The combBED column indicates whether or not the mutation is a SNP and falls in the combBED region defined in Defining a New Rate Constant for Y-Chromosome SNPs based on Full Sequencing Data by Dmitry Adamov, Vladimir Guryanov, Sergey Karzhavin, Vladimir Tagankin, Vadim Urasin.

The McDonald BED column indicates whether or not the mutation is a SNP and falls in the BED region used by Dr. Iain McDonald in the age analysis he does for R-U106 men.

Age Analysis Information (work in progress)

AllMcDonaldYFull
Kit: 87095963987078453967736187
Kit: 87095983797777465787600162
Used in age calculations983797778453967736187
Counts of SNPs283229
Variant counts last updated 2022-11-21 03:50:36.



Big Tree Main Page